ID: 1149957675

View in Genome Browser
Species Human (GRCh38)
Location 17:61070743-61070765
Sequence CTGTATTTACACAGGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149957668_1149957675 13 Left 1149957668 17:61070707-61070729 CCACAGATAATTTATCCTGTCTC 0: 1
1: 0
2: 2
3: 17
4: 274
Right 1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 157
1149957667_1149957675 14 Left 1149957667 17:61070706-61070728 CCCACAGATAATTTATCCTGTCT 0: 1
1: 0
2: 3
3: 23
4: 202
Right 1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 157
1149957671_1149957675 -2 Left 1149957671 17:61070722-61070744 CCTGTCTCCTAGGCTGGCCTTCT 0: 1
1: 0
2: 2
3: 27
4: 264
Right 1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 157
1149957666_1149957675 18 Left 1149957666 17:61070702-61070724 CCTTCCCACAGATAATTTATCCT 0: 1
1: 1
2: 2
3: 7
4: 203
Right 1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 157
1149957665_1149957675 19 Left 1149957665 17:61070701-61070723 CCCTTCCCACAGATAATTTATCC 0: 1
1: 0
2: 2
3: 22
4: 192
Right 1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 157
1149957672_1149957675 -9 Left 1149957672 17:61070729-61070751 CCTAGGCTGGCCTTCTGTATTTA 0: 1
1: 0
2: 1
3: 30
4: 316
Right 1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149957675 Original CRISPR CTGTATTTACACAGGCAGCC TGG Intronic
901322814 1:8349780-8349802 CTGTGTATGCACAGGCACCCGGG - Intergenic
902240211 1:15083389-15083411 CTGGAGTGACACAGGCAGCCTGG - Intronic
902698493 1:18156011-18156033 AACTATTTACACAGGCTGCCAGG - Intronic
907234345 1:53031438-53031460 CTGCATTAGCAAAGGCAGCCTGG + Intronic
911180291 1:94854550-94854572 CTGCATTCACACAGCCATCCAGG + Intronic
911294356 1:96096217-96096239 TTGTATTTACACAGGCAGTATGG - Intergenic
916428718 1:164707280-164707302 CAGTATTTCCACAGGAGGCCAGG + Intronic
919273422 1:195381253-195381275 CTTTATATACACAGAAAGCCAGG + Intergenic
919964525 1:202509030-202509052 CTTTATTTACAAAAGCAGGCCGG + Intronic
920058875 1:203213875-203213897 CTGGGTTAACAAAGGCAGCCAGG + Intronic
923091806 1:230746790-230746812 CTTTATTTACAAAGGCAGGTGGG - Intergenic
924123572 1:240827154-240827176 TTGTATTTACACATCCAGGCTGG + Exonic
924353322 1:243141507-243141529 CTGTATTAAAACTGGCAGCAAGG + Intronic
924616038 1:245612886-245612908 CTGTGTTTCCAAAGTCAGCCCGG + Intronic
924850837 1:247828734-247828756 CTATATTTACACTGTCACCCAGG - Intergenic
924881504 1:248166089-248166111 CTGTATTTACCGAGGGATCCTGG - Intergenic
1064465116 10:15571647-15571669 CTGCATTTTAACAGACAGCCAGG + Intronic
1069770589 10:70896859-70896881 TTGTAGTTACACAGGAACCCAGG + Intergenic
1070143834 10:73759608-73759630 CTTTCTTTTCACAGGCTGCCTGG + Exonic
1070359783 10:75676425-75676447 CTGTATTTTCAGATGCAACCTGG - Intronic
1070697639 10:78574671-78574693 CTGTATTTACATAGAGAGCAAGG + Intergenic
1070740004 10:78896650-78896672 CTGCATTTTCACAGGCTCCCTGG + Intergenic
1071321394 10:84462943-84462965 CTGGGTTTACTGAGGCAGCCAGG + Intronic
1073079230 10:100847340-100847362 CTGCATCTACCGAGGCAGCCTGG + Intergenic
1074084616 10:110199361-110199383 CTCTATCTAGACAGTCAGCCCGG + Intergenic
1074429610 10:113382660-113382682 CTGTATTTACACTGGGATACTGG + Intergenic
1074470836 10:113725278-113725300 CAGCATTTTCAGAGGCAGCCTGG - Intronic
1075167655 10:120083771-120083793 CTCTCTTCACACAGCCAGCCTGG - Intergenic
1077729076 11:4709214-4709236 CTGTATGTACACGGGCAGATGGG - Intronic
1078405771 11:11068669-11068691 GTGTATGTACACATTCAGCCAGG + Intergenic
1083477182 11:62922129-62922151 CTGCACTTACACAGGCTGCATGG - Intergenic
1084094610 11:66902784-66902806 CTGTGATTACACAGTTAGCCTGG - Intronic
1084943404 11:72626225-72626247 CTCTCTTTACTCAGTCAGCCAGG + Intronic
1085013912 11:73159948-73159970 CTGAATTAACAAAGGCAGCTGGG - Intergenic
1085025448 11:73233904-73233926 CTGAATTTACAAAAGCAGACTGG + Intronic
1085193279 11:74647967-74647989 CTTTATTTACACATGAAGACAGG + Intronic
1089645317 11:119875008-119875030 CTTTATTTACAGGTGCAGCCTGG - Intergenic
1089660450 11:119982036-119982058 CTGTGGGTTCACAGGCAGCCGGG - Intergenic
1093640191 12:21518979-21519001 CTGTATTGCCACAGGCAGTTGGG + Intergenic
1094691495 12:32773863-32773885 CTGCATTTTCACAGCCAGCAGGG - Intergenic
1097971806 12:65640863-65640885 CTGTATTAACCTAAGCAGCCAGG - Intergenic
1099087613 12:78264673-78264695 CTGTCTTTCCACAGATAGCCTGG + Intergenic
1100662312 12:96713464-96713486 TTTTATTAACACAGGAAGCCAGG - Intronic
1102254456 12:111407497-111407519 CTGTTTCCACTCAGGCAGCCAGG - Intronic
1102473067 12:113170639-113170661 CTTTATTTACACAGACAAGCAGG - Intronic
1103288526 12:119824268-119824290 CTGAAATAACACAGGCAGTCTGG - Intronic
1105594681 13:21826175-21826197 CTGTAATTCCACATGCAGCAAGG + Intergenic
1115288518 14:31744286-31744308 TTGTATTTAAACAGGCAGTTTGG + Intronic
1115332482 14:32213069-32213091 CTGTATTTGAACAGGCACCCAGG + Intergenic
1117885568 14:60357934-60357956 CTGTATTCATACAGGCAGTCTGG + Intergenic
1121125563 14:91404487-91404509 CTGTATTTTAACAGGCCCCCAGG - Intronic
1122000111 14:98640999-98641021 TTGTATTTACAAAGCCAGCAAGG - Intergenic
1127994652 15:64146160-64146182 CTGTATCACCACACGCAGCCTGG + Intergenic
1129604436 15:77017979-77018001 CTGGCTTTACACAGGCACACAGG - Intronic
1132572656 16:650778-650800 CTGTATTTTCCCAAGCACCCTGG - Intronic
1132781570 16:1629276-1629298 CTGTCTCTGCACAGGCAGCCGGG + Intronic
1137594413 16:49714314-49714336 CTATATTTCAACACGCAGCCAGG + Intronic
1138224888 16:55284643-55284665 TTGGATTTTCACAGGGAGCCTGG + Intergenic
1141311738 16:82920143-82920165 CTGAATTTATACACCCAGCCAGG - Intronic
1141607653 16:85163976-85163998 CTGTATTTAAAAAGGCAACAAGG + Intergenic
1144342806 17:14324155-14324177 CTGTTTTTACACATGGAGACAGG + Intronic
1144390594 17:14790067-14790089 CTGCATTTTAACAAGCAGCCCGG - Intergenic
1147329229 17:39687039-39687061 CTTTATTTACTCAGGGAGCAGGG - Intronic
1149066303 17:52484488-52484510 CTGGATTTTCAAAGACAGCCAGG - Intergenic
1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG + Intergenic
1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG + Intronic
1155908972 18:31486923-31486945 ATGTATTTACACATTCAGCTGGG + Intergenic
1157605348 18:48922868-48922890 CAGTCTTCCCACAGGCAGCCTGG + Intronic
1157681124 18:49607902-49607924 CAGTTTTTACACAGACAGGCAGG + Intergenic
1158632094 18:59124172-59124194 CTGGGTTTACTCATGCAGCCTGG + Intergenic
1160542517 18:79632417-79632439 GTGTATGTACACAGGGAGACAGG + Intergenic
1161055210 19:2187528-2187550 CTGCATTTGCACAGCCTGCCAGG + Intronic
1162997150 19:14343414-14343436 CTGTGTTCACAGAGCCAGCCAGG + Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164507623 19:28872427-28872449 CTCTCTTGTCACAGGCAGCCAGG - Intergenic
1165592112 19:36977905-36977927 CTGCACTTACACTGGCAACCTGG + Intronic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1167289093 19:48614855-48614877 CTGTGTTTACACAAGGGGCCGGG - Intergenic
925995934 2:9293160-9293182 CTGTATGTACACATGCATGCTGG + Intronic
926152149 2:10431265-10431287 CTGTATTTACTCAGTGAGCATGG - Intergenic
932368075 2:71165933-71165955 TTGCATTTACACAGGCATCCGGG - Intergenic
932629972 2:73332560-73332582 CTGTGTCTACACAGGCAGGGTGG + Intergenic
933321976 2:80787719-80787741 GTGTTTTCACCCAGGCAGCCTGG + Intergenic
933983645 2:87573406-87573428 CCGTATTTACCCTGGCTGCCAGG + Intergenic
934689309 2:96346198-96346220 CTGTCTTAAAACAGGAAGCCAGG + Intronic
936310206 2:111377388-111377410 CCGTATTTACCCTGGCTGCCAGG - Intergenic
941314860 2:163979660-163979682 CTATATTTACACAGGTAGGTAGG - Intergenic
942833893 2:180269215-180269237 TTGTATTTACAAAGGCAGTTTGG - Intergenic
943051060 2:182913854-182913876 CTGTATTTCCACAGGCTGTGGGG - Intronic
944515277 2:200506935-200506957 CTGTATTTACACAGCCCGGCGGG - Exonic
948395840 2:237644378-237644400 GTGTATTAACACAGCCTGCCAGG + Intronic
1170310502 20:14986172-14986194 CTTTATTTAAACAAGCAACCAGG - Intronic
1170525776 20:17235656-17235678 CTGTGTTTACACAGAAAGCAAGG - Intronic
1170891177 20:20376934-20376956 CTTTATTTACAAAAGCAGGCTGG - Intergenic
1172240174 20:33407964-33407986 CTGTGAGCACACAGGCAGCCCGG - Exonic
1172551242 20:35801904-35801926 CTTTTTTCAGACAGGCAGCCAGG - Intronic
1172683574 20:36736409-36736431 CTGAATTCACACAGCCAGCTAGG + Intronic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1175336941 20:58202727-58202749 CTGTTTTTTAAAAGGCAGCCAGG + Intergenic
1175395559 20:58657472-58657494 CTGTGTTTACTCAGGAAGTCTGG - Intronic
1175499303 20:59438514-59438536 CTGTAATTAAACAGCCAACCTGG + Intergenic
1175804408 20:61819508-61819530 ATGCATTTACAAAGGCGGCCGGG + Intronic
1180134535 21:45853726-45853748 CTGTACTCACACAGGCAGAATGG - Intronic
1184721172 22:46314379-46314401 ATGGATTTAAACAGGCACCCAGG - Intronic
950689908 3:14647392-14647414 CTGGATTTAGAGAGGCAGCAGGG - Intergenic
959013194 3:101102735-101102757 CTGTATTGAGACAGGCAAGCAGG + Intergenic
960668615 3:120135276-120135298 CTATATTTAAACAAGCAACCTGG + Intergenic
961114021 3:124313429-124313451 TTGTATCTCCACAGACAGCCTGG + Intronic
965396495 3:168165652-168165674 CAGCAGTTACAGAGGCAGCCTGG + Intergenic
966234627 3:177686841-177686863 CTCTATTTTCAGAGACAGCCTGG - Intergenic
968578045 4:1377020-1377042 CGGTGTTTGCACAGGCAGCCCGG - Intronic
969366297 4:6696356-6696378 CTGAAGTCACACAGGGAGCCGGG - Intronic
969570580 4:8005972-8005994 GTGCATCTGCACAGGCAGCCTGG + Intronic
972035575 4:34515151-34515173 TTGGTTTTACAAAGGCAGCCTGG - Intergenic
972307803 4:37849330-37849352 CTGCATTTGCACAGAGAGCCAGG - Intronic
973213262 4:47639556-47639578 CTGAATGTACAAAGGCAGGCTGG + Intronic
974711784 4:65606938-65606960 CTGTATTTAAAGAGGCAGTTAGG - Intronic
979248614 4:118538790-118538812 CTGTATTAAAACTGGCAGCAAGG - Intergenic
979965587 4:127073130-127073152 GTGTATTTACATCAGCAGCCAGG - Intergenic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
981706076 4:147660331-147660353 CTGTATTTAAATAAGCAGGCTGG + Intronic
982811607 4:159832248-159832270 CAGGATTTCCACGGGCAGCCTGG + Intergenic
982882758 4:160741112-160741134 CTGTATTTCCACAGTATGCCTGG + Intergenic
985822989 5:2173057-2173079 CTGTATTTACAAAGGGCGCATGG + Intergenic
986414838 5:7518310-7518332 CTCTATCTACACAGGCAGGCTGG - Intronic
988092314 5:26560001-26560023 CTGGCTTTACACAGGAAGCATGG + Intergenic
990249716 5:53901101-53901123 CGTTAATTACAGAGGCAGCCAGG + Intronic
994102433 5:95908616-95908638 GTGTATTCACACTGGCAGCCTGG - Intronic
998565751 5:143214589-143214611 ATGTGTTTACAGATGCAGCCAGG - Intronic
999631984 5:153580833-153580855 CTGTATTCAGAGAGGCATCCTGG + Intronic
1000126601 5:158251321-158251343 CTCAATATACACAAGCAGCCAGG - Intergenic
1001169392 5:169404375-169404397 ATGTTTCTTCACAGGCAGCCAGG + Intergenic
1001652472 5:173325668-173325690 CTGTGTCTACACAGGCAGGGTGG - Intronic
1005803762 6:29453726-29453748 CTGTAGTTTCCCAGTCAGCCAGG - Intronic
1007956278 6:45920672-45920694 CTTTCTTTCCACAGGCAGCTAGG + Intronic
1010024307 6:71197923-71197945 CTGTGTCTAGACAGGCAGCCTGG - Intergenic
1011267391 6:85536346-85536368 CTGTATTTATACAAGCTTCCAGG + Intronic
1012754810 6:103214557-103214579 CTGAATTTAGACAGGCAGGTGGG + Intergenic
1013441428 6:110174227-110174249 CTGGATTTACACTGGGAGTCAGG - Intronic
1014138801 6:117917814-117917836 CTCTATCTACACATGCATCCAGG - Intronic
1014571760 6:123017395-123017417 CTGTATTCATTCAGGCAGCCTGG + Intronic
1016814796 6:148293551-148293573 CTGTACTTTCCCAGGCAGCGTGG + Intronic
1018475074 6:164132449-164132471 CTGTATGCACATGGGCAGCCAGG - Intergenic
1024210981 7:47203739-47203761 CTGCATTTTCACAGGGACCCAGG - Intergenic
1024685902 7:51744846-51744868 CTGTGTATACAAAGGCAGTCTGG + Intergenic
1025023210 7:55496032-55496054 CTGTAGCTGCACTGGCAGCCAGG - Intronic
1025851356 7:65247333-65247355 CTGTATTTCCACAGGAAGTCAGG - Intergenic
1030700853 7:112638708-112638730 CAGTATTTTGACAGGCAGCTGGG + Intergenic
1032586371 7:133150924-133150946 CTGTAGCTACTCAGCCAGCCAGG + Intergenic
1034554325 7:151840306-151840328 CTTTCTCTACACAGGCAGCCTGG - Intronic
1034690693 7:153011284-153011306 CTGTATTTTCAGAGGAAGTCAGG + Intergenic
1038199786 8:25401282-25401304 CTGTATTTTCACAGGCGCTCTGG - Intronic
1039075619 8:33688428-33688450 CTGAATTCAGACAGACAGCCTGG + Intergenic
1040319516 8:46285592-46285614 GTGTCTCTACACAGGCACCCTGG + Intergenic
1041426869 8:57731064-57731086 CTCCATTTTCACAGGCATCCAGG - Intergenic
1047765807 8:127988903-127988925 CTGAAGTCACACAGGCAGTCAGG - Intergenic
1048341749 8:133545346-133545368 CTTTATTTACAAAGGCAGACTGG + Intronic
1049302894 8:141881074-141881096 CTGCAGTTACACTGTCAGCCAGG + Intergenic
1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG + Intergenic
1050236725 9:3589247-3589269 CTGTATTTCCAGAGGTAACCTGG + Intergenic
1050663062 9:7904968-7904990 CAGTATGAACCCAGGCAGCCTGG + Intergenic
1050919737 9:11186436-11186458 CGGAATTAACAGAGGCAGCCTGG + Intergenic
1051671271 9:19513206-19513228 ATGTATATACACAGGCATGCAGG + Exonic
1053196876 9:36126438-36126460 CTGTGGTTACACAGGGAGTCAGG + Intergenic
1060970119 9:127733020-127733042 CTGTGTTTCCTCAGGCAGCATGG - Intronic
1186829917 X:13379824-13379846 CAGTATTTACACAGAAAGCTGGG + Intergenic
1187540661 X:20190827-20190849 CTGTATTAACACAGGAAGAGAGG - Intronic
1189546619 X:42048814-42048836 CTGCATCTAATCAGGCAGCCTGG + Intergenic
1197182818 X:123554350-123554372 CTATATTTCCACAGGCAACAGGG + Intergenic
1197559597 X:128001281-128001303 TTATATTTACAAAAGCAGCCTGG - Intergenic
1202300159 Y:23404887-23404909 CTTTATTTACAAAAGCAGGCCGG + Intergenic
1202570651 Y:26265711-26265733 CTTTATTTACAAAAGCAGGCCGG - Intergenic