ID: 1149958272

View in Genome Browser
Species Human (GRCh38)
Location 17:61077875-61077897
Sequence ATAAGCTTGATCCTCAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149958270_1149958272 22 Left 1149958270 17:61077830-61077852 CCTTTACTTTTCCTTGGATGGTT 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1149958272 17:61077875-61077897 ATAAGCTTGATCCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 4
4: 127
1149958271_1149958272 11 Left 1149958271 17:61077841-61077863 CCTTGGATGGTTCAAGAACAACT 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1149958272 17:61077875-61077897 ATAAGCTTGATCCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149958272 Original CRISPR ATAAGCTTGATCCTCAGTGA AGG Intronic
901148908 1:7087376-7087398 ATAAGCTTGATCCTGCTGGAAGG + Intronic
906184525 1:43851405-43851427 ATAAGCTGGACCCACAGTGCTGG - Intronic
908615355 1:65914750-65914772 ATAATCCTGATCCTCCCTGAGGG + Intronic
912182453 1:107235658-107235680 ATAGACTTTATCCTCAGTTAAGG + Intronic
912815010 1:112821971-112821993 ATAAGAATTGTCCTCAGTGAGGG + Intergenic
917301307 1:173577212-173577234 ATTAGCCCTATCCTCAGTGATGG - Intronic
918093965 1:181319242-181319264 ATAAGCTTAATCCACAGAGCAGG + Intergenic
922363233 1:224841807-224841829 ATAAGCATTGTCCTGAGTGATGG + Intergenic
922949152 1:229543776-229543798 ATCTGCTTGCTCCTCTGTGAAGG - Intronic
923273494 1:232377940-232377962 ATATGCTAGATGCTCAGTCAAGG - Intergenic
1064519838 10:16189503-16189525 ATAAGCTAGAGTTTCAGTGAGGG - Intergenic
1070934836 10:80285106-80285128 ATAAGCTGCATCCTCATTGTAGG - Intronic
1070971135 10:80568301-80568323 GTAAGCTTGACCTTGAGTGAAGG + Intronic
1080109049 11:28545060-28545082 ATAATCTTGATCCATAGTGCAGG - Intergenic
1085570564 11:77554599-77554621 ATAAGCATTGTCCTTAGTGATGG - Intronic
1093909874 12:24734429-24734451 GTAAGCTGGATCCTCAAAGAAGG + Intergenic
1094269184 12:28592171-28592193 ATAAAATTTATCCTCAGGGAGGG + Intergenic
1094702623 12:32884853-32884875 ATCATCGTGCTCCTCAGTGACGG - Intronic
1096550479 12:52368814-52368836 ATCAGCCTGATCCTGGGTGAAGG - Intergenic
1096812446 12:54180092-54180114 ACCAGCTTGATCCCCAGGGAGGG - Intronic
1097396809 12:59085130-59085152 ATATGCTTGCCCCACAGTGAGGG - Intergenic
1098395156 12:70009785-70009807 ATCAGCATGCTCCTGAGTGAAGG + Intergenic
1098905779 12:76160987-76161009 ATAAGCTAGAGCTTGAGTGAGGG - Intergenic
1101127540 12:101652704-101652726 ATCACCTTCATCTTCAGTGAGGG - Exonic
1101282073 12:103268513-103268535 ATGAGCTTGATCCTGAGTGGTGG - Intronic
1101820299 12:108179063-108179085 CAGAGTTTGATCCTCAGTGAGGG - Intronic
1103088163 12:118078057-118078079 TTAAATTTGATCCTCAGTGTTGG + Intronic
1105501970 13:20980653-20980675 ATAACCTTGGTGCCCAGTGAAGG - Intronic
1108207580 13:48106456-48106478 GGAAACTTGATCCTCAGTGTTGG - Intergenic
1109886389 13:68551544-68551566 ATAAGCTTAAGCTTGAGTGAAGG - Intergenic
1110158280 13:72344257-72344279 ATATGCTTGAACCTCAGCAAGGG + Intergenic
1111627787 13:90811685-90811707 ATCATCTTGCTCCTCAGTAATGG + Intergenic
1112129901 13:96511352-96511374 GTAAGCTTTATCATCAGTGCAGG + Intronic
1119031256 14:71194490-71194512 ACAAGCCTGATCCTTAGTTAGGG + Intergenic
1119110271 14:71966371-71966393 ATAAGCATGATTCTTAGAGATGG - Intronic
1121912490 14:97804032-97804054 ATGAGTTTCATCATCAGTGAAGG + Intergenic
1126536875 15:49775893-49775915 GGAAGCTGGATCCTGAGTGAAGG + Intergenic
1131548806 15:93338707-93338729 ATGAGCTTGTTCCCCTGTGAAGG + Intergenic
1131743948 15:95424570-95424592 ATATGCATTATGCTCAGTGAAGG - Intergenic
1133939063 16:10293360-10293382 ATAAGCATTGTCCTGAGTGATGG - Intergenic
1135663465 16:24316353-24316375 CCAAGCCTGGTCCTCAGTGAGGG - Intronic
1138254254 16:55539673-55539695 AAAAGCTGGAGCCTCAGAGATGG - Intronic
1144867867 17:18348350-18348372 ATAAGCTGGACCCACAGTGCTGG - Exonic
1144931087 17:18859155-18859177 AAAAGCTATATGCTCAGTGATGG - Intronic
1146735064 17:35231947-35231969 ATAAGTCTGACCCTGAGTGAAGG + Intergenic
1148593293 17:48832507-48832529 ATAATGATGATCCTAAGTGAAGG - Intronic
1149958272 17:61077875-61077897 ATAAGCTTGATCCTCAGTGAAGG + Intronic
1152173947 17:78774078-78774100 AAAATGTTGATCCTCACTGAGGG + Intronic
1153178464 18:2405878-2405900 TTAAGCTTGATCCTTCATGAAGG + Intergenic
1157115181 18:44855813-44855835 ATAAGCTAGATGATGAGTGATGG + Intronic
1158626070 18:59072591-59072613 ACAAGCTTGATGCTCAGAGGCGG + Intergenic
1163944145 19:20520412-20520434 ATAAGCATTGTCCTAAGTGATGG + Intergenic
1164531446 19:29051315-29051337 ATGAGGTTGATACTCAGTGAGGG - Intergenic
1164977654 19:32585698-32585720 ACAAGCTTGTCCCTCAGTGTAGG - Intronic
1166355834 19:42226727-42226749 ATAAGCTTGGTGCTCAGTGAAGG - Exonic
933236660 2:79871610-79871632 AGAAGCTTCACCCTCAGTGTAGG - Intronic
935541518 2:104354299-104354321 ATATTCTAGATCCTCACTGAAGG + Intergenic
938995640 2:136674715-136674737 ATAAGCTTGACTCCCAGTGTAGG + Intergenic
939651335 2:144766399-144766421 ATAAGCTTGTTCCTGGATGAGGG - Intergenic
940217167 2:151313386-151313408 ATAAGCATTGTCCTGAGTGATGG - Intergenic
941330028 2:164168694-164168716 ATAAGCTAGAGCTTGAGTGAGGG - Intergenic
941417732 2:165242938-165242960 ATCAGTTTGTTCCTCAGTAAAGG + Intronic
946649933 2:221881358-221881380 ATAAGCCTAATCCTAAGTCATGG + Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1170624333 20:18019901-18019923 ATGAGCCAGATCCTCAGTGCAGG + Intronic
1174703972 20:52637064-52637086 TTAAGCTGAAACCTCAGTGATGG + Intergenic
1175179208 20:57133369-57133391 ATAAGGTTCATCCTCTGGGAAGG - Intergenic
1180608596 22:17080812-17080834 GTAAGATTGGTCCTCACTGATGG - Intergenic
949369712 3:3321474-3321496 ATTAGCATGATCCTCTTTGAAGG + Intergenic
953834127 3:46328476-46328498 ATAAGCTTTGCCCTGAGTGATGG + Intergenic
954645172 3:52126902-52126924 AGAAACTTGATCCCCAGTGTGGG - Intronic
957373988 3:79333520-79333542 ATAAGCTTGAGACTGTGTGATGG - Intronic
959919847 3:111858562-111858584 ATAAGCTATTTCTTCAGTGACGG + Intronic
960650023 3:119937208-119937230 TAAAACTTGATCCTCAGTGTTGG + Intronic
963863171 3:150331399-150331421 ATATGATAGATGCTCAGTGAAGG - Intergenic
965469362 3:169071662-169071684 AAAAGCATTATCCTCAGTGCTGG + Intergenic
967226923 3:187301023-187301045 TGAAGTTTGATCCTCAGTGTTGG + Intergenic
968182430 3:196606074-196606096 ATAAGCTGGCTCTTCAGGGAGGG - Intergenic
975267771 4:72391405-72391427 CTAAGCTTTATCTTCAGTGTGGG - Intronic
975845158 4:78517108-78517130 ATCAGGTTTATCCTCACTGAAGG + Intronic
978067814 4:104427312-104427334 ATAAGCTTCAGCATTAGTGAGGG + Intergenic
982594067 4:157355067-157355089 ATAAGCTAGAGCTTGAGTGAGGG + Intronic
987436933 5:17906086-17906108 ATAAACTTGATGCTCTTTGAGGG - Intergenic
988914899 5:35882509-35882531 ATAAGCTAGAGCTTGAGTGAAGG + Intergenic
989008833 5:36846619-36846641 ACATGCTGGATCCTCACTGAAGG + Intergenic
991442927 5:66669907-66669929 ATAAGCTTCATCCTCAGACTTGG - Intronic
995902908 5:117091169-117091191 CTTAAGTTGATCCTCAGTGATGG - Intergenic
996650806 5:125873700-125873722 AGAAGGTGGGTCCTCAGTGAGGG - Intergenic
996966238 5:129309447-129309469 TTAAGCTTGATCCTCATTACTGG + Intergenic
999891116 5:155979693-155979715 ACAAGGTTGATTCTCAGAGAAGG + Intronic
1001078656 5:168650254-168650276 AAAATCTTAATCCTAAGTGACGG - Intergenic
1001853052 5:174986071-174986093 ATAAAAATGATCATCAGTGAAGG - Intergenic
1004852758 6:19717149-19717171 AAAAGCTTTTTCCTCAGTGATGG - Intergenic
1007209122 6:40177550-40177572 ATAAGCTGGATCCCCAATGATGG - Intergenic
1008772980 6:55002015-55002037 CTAAGCATGATATTCAGTGATGG - Intergenic
1010380058 6:75214099-75214121 GTAATCCTGATGCTCAGTGAGGG + Intergenic
1010841043 6:80649426-80649448 ATAAGCGTTGTCCTGAGTGATGG + Intergenic
1011268038 6:85546021-85546043 AAAAGCATTATCCTGAGTGAAGG + Intronic
1014612328 6:123560522-123560544 ATAAGCGTTGTCCTGAGTGATGG - Intronic
1014955872 6:127615085-127615107 ATCAGCCTGTGCCTCAGTGAGGG - Intergenic
1018077907 6:160232727-160232749 ATAAGCATTGTCCTGAGTGATGG - Intronic
1018088842 6:160328599-160328621 ATGATCTTGACCTTCAGTGAAGG - Intergenic
1020435247 7:8155372-8155394 ATCAGCTTGATCCTCTCTGCAGG + Intronic
1021262972 7:18481760-18481782 ATACACTAGATCCACAGTGAGGG - Intronic
1022156817 7:27669089-27669111 ATAATTTTGTTCCTCAGTCATGG + Intergenic
1023850794 7:44149235-44149257 ATTGGATTGCTCCTCAGTGAAGG + Intronic
1024123369 7:46267351-46267373 ATGAGGTGGAGCCTCAGTGATGG + Intergenic
1027791273 7:82640703-82640725 AAAAGCTTCATCCTCTGGGAAGG - Intergenic
1028899917 7:96086002-96086024 AAAAGCTTGCTCTTCAGTAATGG - Intronic
1029417673 7:100453506-100453528 AGGAGCTTGAGTCTCAGTGAAGG + Intergenic
1030574721 7:111271711-111271733 ATAAGCCTGATCCTGAGAGGTGG - Intronic
1036947552 8:13108755-13108777 ATATGCATGATCAGCAGTGATGG + Intronic
1042051520 8:64714644-64714666 CTAAGGTCAATCCTCAGTGATGG + Intronic
1042975343 8:74463097-74463119 CTAAGATTGATCCTCAGTTGTGG + Intronic
1043077449 8:75719987-75720009 ATGAGGGTGATCCCCAGTGAGGG + Intergenic
1043486807 8:80705818-80705840 ATGAGCTTGCTACTCAGTCATGG + Intronic
1045768485 8:105705762-105705784 ATAAGCTGGCTCCCAAGTGAAGG + Intronic
1047300448 8:123609412-123609434 ATAAGCAGGGTCCTCAGGGAGGG + Intergenic
1048404273 8:134103898-134103920 TTAAATTTGATCCTCAGTGTGGG - Intergenic
1048718053 8:137290155-137290177 ATAATTTTGAACTTCAGTGATGG + Intergenic
1048947729 8:139465544-139465566 AGAAGCTTGTTTCTCACTGATGG - Intergenic
1050793449 9:9505063-9505085 GCAAGCTTGACCCTGAGTGAGGG - Intronic
1051940744 9:22502820-22502842 GTTAGTTTGATCTTCAGTGAAGG - Intergenic
1052116401 9:24652995-24653017 ACATGCTTGATGCTCAGTAAAGG - Intergenic
1052724721 9:32216075-32216097 CTAAGCTGGATACTAAGTGAAGG - Intergenic
1056723519 9:89091509-89091531 ATTAGTTTGATCTACAGTGAAGG + Intronic
1059181943 9:112224149-112224171 AGAAGCTGGATGTTCAGTGAAGG - Exonic
1188235466 X:27725223-27725245 GTAAGATTCATCCCCAGTGATGG + Intronic
1189201124 X:39196472-39196494 TGAAACTTGATCCTCAGTGTTGG - Intergenic
1193275115 X:79577248-79577270 ATAAGCTTCATCCTAACTTAAGG - Intergenic
1195114883 X:101687357-101687379 ATCAGCTTTTTCATCAGTGATGG + Intergenic
1197500049 X:127231132-127231154 ATAAGCATTGTCCTGAGTGATGG - Intergenic
1199260986 X:145774689-145774711 TAAAGTTTGATCCTCAGTGTTGG - Intergenic