ID: 1149958343

View in Genome Browser
Species Human (GRCh38)
Location 17:61078666-61078688
Sequence TTCCCTGTCATTACTTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149958341_1149958343 27 Left 1149958341 17:61078616-61078638 CCCTTTTGGCACAGTATCATGTT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1149958343 17:61078666-61078688 TTCCCTGTCATTACTTGAGATGG 0: 1
1: 0
2: 0
3: 16
4: 160
1149958342_1149958343 26 Left 1149958342 17:61078617-61078639 CCTTTTGGCACAGTATCATGTTG 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1149958343 17:61078666-61078688 TTCCCTGTCATTACTTGAGATGG 0: 1
1: 0
2: 0
3: 16
4: 160
1149958340_1149958343 28 Left 1149958340 17:61078615-61078637 CCCCTTTTGGCACAGTATCATGT 0: 1
1: 0
2: 1
3: 12
4: 128
Right 1149958343 17:61078666-61078688 TTCCCTGTCATTACTTGAGATGG 0: 1
1: 0
2: 0
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149958343 Original CRISPR TTCCCTGTCATTACTTGAGA TGG Intronic
901594510 1:10374100-10374122 TTTCCTTTCATAACTTCAGAAGG + Intronic
901819969 1:11822628-11822650 GTCCCCGTCATCACTTGAGAGGG - Intronic
902549432 1:17210594-17210616 TGCCCTGTCATTGCTTGGGGAGG - Intronic
905258613 1:36701664-36701686 TTCCATGATATCACTTGAGAGGG - Intergenic
905690892 1:39941838-39941860 TGGCCTGCCAGTACTTGAGAGGG + Intergenic
906335482 1:44926428-44926450 TTCCCTGTCTTTTCTTGCCAAGG - Intronic
907995918 1:59632568-59632590 TTCCCTTTCTTTGCTTGAGGGGG - Intronic
908481151 1:64540769-64540791 TTCCCTGTAATTTCTTTTGAGGG + Intronic
910063036 1:83116889-83116911 ATCCTTCTCATTACTTGTGATGG - Intergenic
910183897 1:84514336-84514358 TTCTTTGCCATTACTTTAGAAGG + Intergenic
912024207 1:105146435-105146457 TTTCTTGTAATTACTAGAGAAGG - Intergenic
914973409 1:152332727-152332749 TTCTATGGCAATACTTGAGAAGG + Intergenic
915007133 1:152648925-152648947 TTCCCTGGCTTTACTCAAGAGGG - Intergenic
915356083 1:155255748-155255770 TTCCCCGTCATTAATGGAGAGGG + Intergenic
919665310 1:200285718-200285740 TTCCCTTCCCTTCCTTGAGAGGG - Intergenic
923432232 1:233933846-233933868 TTCCCTTTCCTTTTTTGAGATGG - Intronic
1063496028 10:6509327-6509349 TATCCTTTCATTAATTGAGAAGG + Intronic
1064279852 10:13941774-13941796 TTCCCTGACATCACTTTACATGG + Intronic
1068242332 10:54318911-54318933 TTCCCTTTCATTTCTTTGGAAGG + Intronic
1069330725 10:67289705-67289727 TTGCCTGTCATTTCTTAAGCAGG + Intronic
1069747470 10:70724961-70724983 TTCCCTGCCATTCCTTTAGTGGG + Intronic
1070699809 10:78593476-78593498 TTCCTTCTCATTTCTTGAGCTGG - Intergenic
1071079652 10:81795577-81795599 TTACCAATCATAACTTGAGAGGG - Intergenic
1073510748 10:104041051-104041073 CTCCCTGACATTACCTGAGTTGG + Exonic
1074607141 10:114984195-114984217 TTCCATCTCATTTCCTGAGATGG + Intergenic
1076653616 10:132006671-132006693 TTCTCTGCCATATCTTGAGATGG - Intergenic
1077232239 11:1463019-1463041 TTCCCACTCCTTACTTGGGAAGG + Intergenic
1078287381 11:9970822-9970844 TTCCCTGTCTTTGCTAGATATGG - Intronic
1080032222 11:27673786-27673808 TTCAATGTCATTAATTCAGAAGG + Intronic
1080102024 11:28470773-28470795 TTCCTTTTTGTTACTTGAGATGG + Intergenic
1080895600 11:36446718-36446740 CTCCCTGGCATCACTGGAGAGGG - Intronic
1082742156 11:56922969-56922991 TTCCCTGTCATTCTTTGGTAGGG - Intergenic
1082763097 11:57145478-57145500 TTCCCTCCCATTTCTTTAGAGGG - Intergenic
1083559365 11:63660323-63660345 TTCCATATCATTACTTAACAGGG + Intronic
1084455419 11:69265407-69265429 TTGCCTGTCACTTCTTCAGAGGG - Intergenic
1087425769 11:97983710-97983732 TTCCCGGTCCTGACTTCAGAGGG + Intergenic
1090523783 11:127506897-127506919 TTCCCTGTCAGCCCTTGTGAGGG + Intergenic
1091112279 11:132980876-132980898 ATCCCTGTCATTAAGTGACACGG - Intronic
1091964954 12:4732300-4732322 TTCTCTCCCATTGCTTGAGATGG + Intronic
1094618627 12:32059120-32059142 TTCTCTGTCATATCTTGAAATGG + Intergenic
1096593420 12:52677792-52677814 GTCCCTCTCATTACCTGTGAGGG + Intronic
1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG + Intronic
1107377601 13:39821392-39821414 TTCTCTGTCATTACCTGAAATGG + Intergenic
1108534159 13:51356006-51356028 TTTCCTGTGATTCCTTAAGAAGG - Intronic
1110574780 13:77042864-77042886 ATCCCTTTCATAACTTGAGATGG + Intergenic
1114747039 14:25160270-25160292 TTCCATGTCTTTACTTGGGATGG + Intergenic
1119166998 14:72502757-72502779 TTTCCTTTCTTTTCTTGAGATGG - Intronic
1122477463 14:102020824-102020846 TTTCCTGTCATTACTGTACAAGG + Intronic
1125610926 15:40969698-40969720 TTCCCTGTCTGTCCTTGAGCGGG + Intergenic
1126131527 15:45346620-45346642 TTCCCTCTCAGTACTTTACAGGG + Intergenic
1128286080 15:66438257-66438279 TTTTCTATCATTACTAGAGATGG + Intronic
1130348512 15:83069632-83069654 TCACCTGTCATTAGTAGAGACGG + Intergenic
1133122116 16:3615520-3615542 TTCCCTGTCAGCATTTGAGGCGG + Intronic
1133934466 16:10257390-10257412 TTGCTTGTCACTAGTTGAGATGG - Intergenic
1143641313 17:8199686-8199708 CTCCCTGACAGGACTTGAGAAGG + Intergenic
1144154055 17:12481105-12481127 TTCATTGTCATTATTTGAAAAGG + Intergenic
1145964552 17:28907445-28907467 CTCCCTGTCATTCCTGGAGGAGG - Intronic
1147877242 17:43630295-43630317 CACCCTGACATCACTTGAGATGG - Intergenic
1149958343 17:61078666-61078688 TTCCCTGTCATTACTTGAGATGG + Intronic
1152270575 17:79322365-79322387 TTCCAAGTCATTAAGTGAGATGG + Intronic
1155206349 18:23561475-23561497 GGCCTTGTCATTACTTGAGGGGG + Exonic
1159884234 18:73889011-73889033 TTCACTGTCACTATTAGAGAAGG + Intergenic
1163052739 19:14696687-14696709 TGCCCTGTGATTACTTCAGAAGG - Intronic
1164540101 19:29115624-29115646 CTCCCTGTCAGTCCTCGAGAGGG + Intergenic
925626510 2:5846733-5846755 TTCCTTCTCATTGCTAGAGATGG - Intergenic
926035520 2:9632410-9632432 CTCCCTGTCCTGACTTGTGAAGG + Intergenic
926517753 2:13870600-13870622 TTCACTGTAATTATGTGAGAAGG + Intergenic
928713519 2:34034254-34034276 TTCTTTCTCTTTACTTGAGATGG + Intergenic
929174994 2:38967287-38967309 CTCCCTGTTGTTACTGGAGAAGG + Intronic
930774751 2:55160867-55160889 CTCACTATCATTACTTAAGAGGG - Intergenic
931215909 2:60244459-60244481 TTCCATGTCATTACTAGAGTGGG - Intergenic
932639675 2:73431152-73431174 TTTGCTGTCATAACTTGTGAGGG - Intronic
934219203 2:90065799-90065821 TTTTCTTTCATTACTTGAAATGG + Intergenic
936288293 2:111198616-111198638 TTACCTGTCATAACATGAGTGGG - Intergenic
939392912 2:141591863-141591885 TTCCCTGTCAGTACTGGAACTGG - Intronic
941410817 2:165155402-165155424 TTCCCTTTCTTTTTTTGAGATGG + Intronic
943801017 2:192057467-192057489 ATCCATGGCATTACTTGATAAGG - Intronic
947747558 2:232516816-232516838 TTCCCTGTCTCTTCTTGAAATGG + Intergenic
1169338965 20:4781578-4781600 TTCTCTGTGATCACATGAGAGGG - Exonic
1169662542 20:7996605-7996627 TTTCCTGTCATAACAAGAGAAGG - Intronic
1170950553 20:20932143-20932165 TTCCTTGGCATTGCTAGAGATGG + Intergenic
1171399537 20:24863609-24863631 ATCCCTGTCACTGCTTGATATGG + Intergenic
1174289089 20:49494709-49494731 TTCCCTATCTTTAAATGAGATGG - Intergenic
1175092555 20:56517117-56517139 TTCCCTGTCTTAACTTTTGATGG - Exonic
1175300742 20:57941081-57941103 TTCCCTGTCATTCCCTGTGATGG - Intergenic
1175529827 20:59666942-59666964 TTCCCTTTCATTACCTTTGAGGG + Intronic
1175732565 20:61364092-61364114 TTTCCTGTCCTTGCTTCAGATGG - Intronic
1177915921 21:27088130-27088152 TTCCCTGTCATTCTCTGATAAGG - Intergenic
1179060032 21:37971377-37971399 TTCCATTTCATCCCTTGAGAAGG + Intronic
1181168724 22:20996626-20996648 TTCCCTGTCCTTCCCTGGGAGGG + Intronic
1182810057 22:33108476-33108498 GTTCATGTCATTACTTGTGATGG - Intergenic
1182965038 22:34513076-34513098 GTCCTTGTCATTCCCTGAGAGGG - Intergenic
1185395843 22:50587544-50587566 TTCATTGTCATTACTTGGCATGG - Intronic
949733537 3:7143850-7143872 TTCCTTTTCATTTCTTGTGAGGG + Intronic
949912016 3:8918956-8918978 TTCTCAGTTATTAGTTGAGAGGG - Intronic
951333970 3:21399040-21399062 TTCCCTGTCATTGAGGGAGAAGG - Intergenic
951640121 3:24827482-24827504 TTCTCTTTCATTACTTAAAATGG + Intergenic
952123128 3:30268095-30268117 ATCCTTGCCATTACTTGAGGAGG - Intergenic
955276883 3:57555415-57555437 TTGCCTGTTTGTACTTGAGAGGG + Intergenic
957399884 3:79696848-79696870 TTCCCAGTCAATACATTAGAAGG - Intronic
960676575 3:120201150-120201172 GTCTCTGGCATAACTTGAGAAGG - Intronic
961352606 3:126313570-126313592 TTCCCAGACATTGCTTGGGATGG - Intergenic
961894505 3:130156180-130156202 TTCACTGTCATTACCAGTGACGG + Intergenic
964826909 3:160838723-160838745 TTCCATCTCCTTACTAGAGATGG - Intronic
964877918 3:161390313-161390335 TTCCTTGCCAAGACTTGAGACGG - Intergenic
964951969 3:162306881-162306903 CTCCCTGTCATTACTGTAGGAGG + Intergenic
965666091 3:171094867-171094889 TTCCCTCTCATTGCTTGTGATGG + Intronic
968653613 4:1769526-1769548 AACCCTGTCATTACTTGATCGGG - Intergenic
969852225 4:9968339-9968361 TTCACTTTCTTTCCTTGAGAAGG + Intronic
970718238 4:18953950-18953972 GTCCATGCCATTATTTGAGAGGG - Intergenic
972018075 4:34271271-34271293 TTGCCTGTGACTACTTGATATGG - Intergenic
975421034 4:74164948-74164970 TGCCCTGTCATTACTTGCTCAGG - Intronic
976201516 4:82584142-82584164 ATCCCTGTCATTCCTACAGATGG + Intergenic
977772216 4:100873016-100873038 TTCCTTGTGATTCCTAGAGAAGG - Intronic
978220699 4:106270703-106270725 CTCCCATTCATTATTTGAGATGG - Intronic
979183194 4:117756073-117756095 TCCCCTGACATTCCTTGAGTGGG + Intergenic
981950788 4:150404296-150404318 TTCCCAATTATTACTTGAGATGG - Intronic
984351477 4:178600353-178600375 TTGCCTGACATTCCTGGAGAGGG + Intergenic
984499326 4:180538434-180538456 TTGCCTTTAATTGCTTGAGAAGG + Intergenic
987251611 5:16106695-16106717 TTTGTTGTCATTACTGGAGAAGG + Intronic
989457603 5:41661456-41661478 TTCCCTGTGATCAGTTGACAAGG - Intergenic
989466355 5:41760119-41760141 TTCCCTGTCTTCCCTTGAGCTGG + Intronic
991155792 5:63433357-63433379 TTCTGTTACATTACTTGAGATGG + Intergenic
993067779 5:83121424-83121446 ATCCTTGTCATTACTTGGTATGG + Intronic
993414185 5:87605745-87605767 TTCCCTGTCTTGACTTGGGGAGG + Intergenic
994709732 5:103252985-103253007 TTCCTTGTCATAGCATGAGATGG - Intergenic
996152197 5:120052964-120052986 TTCCTTGTCATTTCTAAAGAGGG - Intergenic
998705746 5:144757808-144757830 TGCCCTCTCTTTACGTGAGATGG - Intergenic
999048601 5:148496737-148496759 TTCCTTGTCATCACTGGTGATGG - Intronic
999082422 5:148856873-148856895 TTGCCTGGCACTTCTTGAGAAGG - Intergenic
999880997 5:155863762-155863784 TTTCCTTTAAGTACTTGAGAAGG + Intergenic
1000250763 5:159492576-159492598 TCACCTGTCTATACTTGAGATGG - Intergenic
1000804870 5:165777317-165777339 TTGTCTGTCATAACTTAAGAGGG - Intergenic
1002408758 5:179056792-179056814 TTCCCTGACATATCTTGAGATGG - Intergenic
1005410092 6:25535474-25535496 TACCCTGTCATTCCTAGATAAGG - Intronic
1006992369 6:38226314-38226336 TTCCCTGTTCTGTCTTGAGAAGG - Intronic
1007056960 6:38895917-38895939 TTCCCTGTCCTGAATTGAGAAGG + Intronic
1008022527 6:46596783-46596805 GTTCCTGCCATTACTTTAGATGG - Intronic
1010723040 6:79305277-79305299 TTGCATGTCATTACTAGAAATGG + Intergenic
1011093757 6:83635570-83635592 ATGCGTGTCATTACATGAGATGG + Intronic
1013723809 6:113066732-113066754 TTCCCTGTCATTATTCTAAAAGG + Intergenic
1017432221 6:154382529-154382551 TTCCTTTTCTTTTCTTGAGAGGG - Intronic
1020419303 7:7982638-7982660 TTCCAAATAATTACTTGAGAGGG - Intronic
1022180335 7:27912885-27912907 TCCCCTGTCATCACTCGTGATGG + Intronic
1022906842 7:34865988-34866010 TTCCCTGCCTTTATTTGAAAAGG + Intronic
1023392072 7:39720312-39720334 TGGCCTGTCAGCACTTGAGAGGG + Intergenic
1023470984 7:40519188-40519210 TTCCTTGTCATTCATGGAGATGG - Intronic
1029577572 7:101413513-101413535 TTTCCTTTCTTTTCTTGAGATGG - Intronic
1031210944 7:118825405-118825427 TTGCCTGTCATTCCTTGGTAGGG + Intergenic
1031495413 7:122441511-122441533 TACACTTTCATTACTTGAAAGGG - Exonic
1034683764 7:152951759-152951781 TTCCCTGTCATTACCTAGGAGGG + Intergenic
1035598683 8:882090-882112 TTCCCTGTAAATACTTGAAATGG + Intergenic
1038719833 8:30024979-30025001 TTCAATGTCATTACTTGCTATGG - Intergenic
1038762232 8:30394975-30394997 TTACCTGTTTTTATTTGAGATGG + Intronic
1038926762 8:32149195-32149217 TTCTCTGTAATTCCTTGTGAAGG - Intronic
1042213418 8:66404352-66404374 TTCACTGTCTTTTTTTGAGATGG - Intergenic
1044141711 8:88662741-88662763 TTCCTTCTCATTACTTGTGCAGG - Intergenic
1045053035 8:98343877-98343899 TTCCCTGACATTCATTGTGAGGG - Intergenic
1047040368 8:120987738-120987760 TTTGCTGTCTTTACTTGAGCTGG - Intergenic
1049194896 8:141309425-141309447 TTCCTTGTCAACACTTGATATGG - Intergenic
1051848036 9:21474866-21474888 TCCACTCTCATTACTTTAGACGG - Intergenic
1052568491 9:30189561-30189583 TTCCCAGTCATTCCAGGAGAAGG - Intergenic
1055857337 9:80705874-80705896 AAATCTGTCATTACTTGAGAAGG - Intergenic
1059788011 9:117607755-117607777 TTAACTGTCACAACTTGAGATGG + Intergenic
1060712511 9:125882386-125882408 GTATCTCTCATTACTTGAGACGG + Intronic
1060949980 9:127595288-127595310 TGCCCTGTCATAACTGGAGAAGG - Intergenic
1062411154 9:136425279-136425301 TTCCCTTTCTTTTTTTGAGATGG + Intergenic
1188427676 X:30067795-30067817 TTCCCTGTCTTTCCTTGACTGGG - Intergenic
1188557253 X:31426690-31426712 ACCCCTGTAATTACTTGAGAGGG - Intronic
1188759054 X:34002867-34002889 TTCCCTCTTATAACTTGGGATGG + Intergenic
1189014814 X:37086222-37086244 TTACCTGTTTTTATTTGAGATGG + Intergenic
1189904611 X:45744780-45744802 TTGCCTATCATTAAATGAGAAGG - Intergenic
1191125144 X:56946565-56946587 TTGCCTGTCTTTATTTGATATGG - Intergenic
1192176109 X:68886576-68886598 GGCCTTGTCATTACTTGGGATGG + Intergenic
1196475497 X:116079976-116079998 TTCCTTGTCCTTCCTTGAGTGGG - Intergenic
1197829706 X:130628382-130628404 GTCACTTTCATTACTTGTGATGG + Intronic
1201376390 Y:13325786-13325808 ATCCCAGTCAATATTTGAGAAGG + Intronic