ID: 1149963282

View in Genome Browser
Species Human (GRCh38)
Location 17:61136058-61136080
Sequence CGGGGAAGGCAGGCGCGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149963282 Original CRISPR CGGGGAAGGCAGGCGCGAAG GGG (reversed) Intronic
901234776 1:7661882-7661904 CGGGGCAGGCGGGCGCCACGGGG + Intronic
902773209 1:18658232-18658254 GGGGGAGGGCAGGAGCGAGGAGG - Intronic
903788220 1:25875328-25875350 CGGGGAAGACAGGCAGGACGCGG - Intergenic
908262412 1:62349419-62349441 TGGGGAAGGGAGGGGAGAAGAGG + Intergenic
910935691 1:92483670-92483692 CGGGCCAGGGAGGCGCGCAGAGG + Intronic
915124537 1:153654416-153654438 AGGTGAAGGCAGGCAGGAAGGGG + Intergenic
915912230 1:159922440-159922462 TGGGGAAGGCAGGCGGGGTGGGG + Intronic
917751913 1:178061216-178061238 CGGGGAAGGAAGAAGCGGAGAGG - Intergenic
921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG + Intergenic
922348246 1:224715081-224715103 CGTGGAAAGCAGGCAGGAAGAGG - Intronic
922797720 1:228349213-228349235 CTGGGCAGGCAGGGGTGAAGAGG + Intronic
924289767 1:242524853-242524875 CGGGAAAGGCGGGTGCGGAGCGG - Intergenic
1065099893 10:22321859-22321881 CGGGGCCGGCAGGCGCGGGGCGG - Intronic
1066026636 10:31364490-31364512 CGGGGAAGCCTGGCGCGATCTGG - Intronic
1066672687 10:37857359-37857381 CGTGGAGTGCAGGAGCGAAGGGG - Exonic
1070822956 10:79373490-79373512 TGGGGAAGGAAGGCGGGATGGGG + Intergenic
1076141276 10:128080332-128080354 CAGGGAGGACAGGTGCGAAGTGG - Intronic
1076736243 10:132460434-132460456 CGTGGAAGGCAGCAGAGAAGTGG - Intergenic
1076834601 10:133014731-133014753 CGGGGAAGTCGGGAGCCAAGAGG + Intergenic
1077352203 11:2098235-2098257 GGGGGAGGGCAGGCGCCCAGAGG - Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1079217491 11:18526822-18526844 CGGGGAAGGGAGTCGCCAGGCGG - Exonic
1079314425 11:19395740-19395762 TGAGGAAGGGAGGCGGGAAGAGG - Intronic
1080836274 11:35943977-35943999 CGGGGAAGGCGGGAGGGAGGAGG + Intronic
1081705608 11:45180728-45180750 CCGGGAAGGCTGGCGAGAGGGGG + Intronic
1083188693 11:61034156-61034178 CGGGGAAGGATGGCATGAAGAGG + Intergenic
1083457035 11:62786400-62786422 CAGGGAAGGGAGGCTGGAAGGGG - Intronic
1083457226 11:62787155-62787177 CGGGGAAGGCAGTCTGGAAAAGG - Exonic
1083474970 11:62909660-62909682 CGGGAAAGGCCGGTGGGAAGAGG - Exonic
1085143419 11:74170865-74170887 CGGGGAACGCAGGCGCCGTGGGG - Exonic
1089768134 11:120783395-120783417 AGAGGAAGGCAGGAGAGAAGAGG - Intronic
1090003961 11:122984223-122984245 CGGAGAAGCCAGGAGCGATGAGG + Intergenic
1090404048 11:126466739-126466761 CAGGGAAGGGAGGGGCGGAGTGG - Intronic
1091168130 11:133498496-133498518 CGAGGAAGGCTGGAGAGAAGGGG - Intronic
1091222248 11:133936412-133936434 GGGAGAAGGCAGGCAGGAAGGGG - Intronic
1091985821 12:4909796-4909818 GGGGGAGGGCAGGAGCGAGGAGG - Intergenic
1092155394 12:6278774-6278796 CGGGGAAGCCAGGGGCGGAGGGG + Intergenic
1093182916 12:15987878-15987900 AGGGCAAGCCAGGCGCGGAGTGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097161360 12:57048617-57048639 AGGGGAAGGCAGGCACCCAGTGG + Intronic
1097791958 12:63824554-63824576 CGGGGAGGGGAGGGGAGAAGAGG + Intergenic
1099304560 12:80937582-80937604 CGGGGAAGGGAGGAGGGGAGAGG + Intronic
1101717269 12:107321449-107321471 AGGGGAAGGAAGGAGCAAAGCGG + Intronic
1102443024 12:112978112-112978134 GGGGGAATTGAGGCGCGAAGAGG + Intergenic
1102532792 12:113558958-113558980 CTGGGAAGGAAGGAGTGAAGTGG + Intergenic
1103274732 12:119701753-119701775 CTGTAAAGGCAGGCGAGAAGCGG + Intronic
1103722304 12:122981343-122981365 CGGGGAAGTCGGGCGAGCAGTGG + Exonic
1104724686 12:131068423-131068445 CGGGGAGGGAAGGCGTGGAGTGG + Intronic
1104830493 12:131747583-131747605 CGGGGCAGGCAGCAGCCAAGAGG + Intronic
1104845502 12:131844864-131844886 CGGGGAGGGCAGGAGCTCAGGGG - Intronic
1105004132 12:132710722-132710744 CGGGGCAGCCTTGCGCGAAGGGG - Intergenic
1107895826 13:44961767-44961789 CGGGGAAGGCATCCGTGAATGGG - Intronic
1108299643 13:49061436-49061458 AGGGGAAGGGAGGGGAGAAGGGG - Intronic
1109370359 13:61414181-61414203 GGGGGAAGGCGGGGGCGGAGGGG - Intronic
1110823166 13:79940016-79940038 CTGGGAAGGCAGGAGCTAAAGGG + Intergenic
1112302033 13:98239631-98239653 CAGGGATGGCAGGCACCAAGTGG + Intronic
1113670075 13:112170494-112170516 CGGGGAAGCCAGGCTCCAAGGGG + Intergenic
1113750930 13:112776016-112776038 CGGGCCAGGGAGGCGGGAAGGGG - Intronic
1119523196 14:75301597-75301619 TGGGGAGGGCAAGCGAGAAGAGG + Intergenic
1119759402 14:77140641-77140663 GGCGGGAGGCGGGCGCGAAGGGG - Intronic
1121235687 14:92389875-92389897 CAGGGAACGCAGGCGCCCAGGGG - Intronic
1124187294 15:27541859-27541881 CGGGGACGGGACGCACGAAGCGG - Exonic
1124465574 15:29936376-29936398 CGGGGAAGGCAGGCACTGACAGG - Intronic
1124564623 15:30801749-30801771 CGGGGTGGGCAGGCTGGAAGAGG + Intergenic
1127920254 15:63488705-63488727 TGGGGAAGGGAGGCGGGAACTGG - Intergenic
1129888856 15:79057772-79057794 TGGGGAAGCCAGGTGCAAAGAGG + Intronic
1130816747 15:87444039-87444061 AGGGGAAGGCAGGTGTCAAGGGG + Intergenic
1131257413 15:90871636-90871658 CGGGGAAGGCAAGCGCGTCTGGG + Intronic
1132636972 16:954744-954766 GGGGCGAGGCAGGCGGGAAGGGG + Intronic
1132710877 16:1266662-1266684 CGGGGAAGGCAGGCAGGGATGGG + Intergenic
1133813238 16:9177384-9177406 AGGGGAAGGGAGGGGAGAAGGGG - Intergenic
1139848318 16:69935741-69935763 CAGGGAAGGAAGGCGGGTAGCGG + Intronic
1141598807 16:85113149-85113171 CGGGGATGGGAGGCGGGCAGAGG + Intergenic
1141625316 16:85258536-85258558 CCTGGAGGGCAGGCGGGAAGGGG - Intergenic
1142549833 17:732123-732145 CGGGGAAGGAAGGAGGGAGGCGG - Intergenic
1143162587 17:4881270-4881292 CGGGGAGGGAAGGCGGGCAGGGG - Intronic
1143976871 17:10836788-10836810 CGGGGAAGGCAGGATGGAAGTGG + Intronic
1144704820 17:17361559-17361581 GGGGGAGGACAGGCGCGGAGGGG + Intergenic
1144844408 17:18208885-18208907 CGTGGATGGCAGGTGAGAAGTGG - Exonic
1145815758 17:27793846-27793868 CGGGGAAGGCAGGGAAGGAGGGG - Intronic
1145911919 17:28548021-28548043 GGAGGAAGGCAGGCGTGAACTGG + Exonic
1146182827 17:30708681-30708703 CGGGGAAGGAGGGCGCAAATGGG - Intergenic
1146639332 17:34528008-34528030 CGGGGAAGGGAGGCCCTAAGCGG - Intergenic
1146947261 17:36882396-36882418 GGGGAAAGGCAGGCCTGAAGAGG - Intergenic
1147149970 17:38509031-38509053 AGGGGAAGGCAGGGGCGGGGCGG + Intronic
1147726065 17:42566890-42566912 CGGGGAGGGCAGGCACGGCGGGG + Intergenic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1149963282 17:61136058-61136080 CGGGGAAGGCAGGCGCGAAGGGG - Intronic
1150309070 17:64112752-64112774 AGGGCAAGGCATGCGGGAAGGGG - Intronic
1151218289 17:72592538-72592560 CGGGGAAGAAAGGCGAGGAGCGG - Intergenic
1152518480 17:80840152-80840174 TGGGGAAGGGAGGAGCTAAGAGG - Intronic
1152789918 17:82273394-82273416 CCGGGAGGGCAGGAGCGAATCGG - Exonic
1152878368 17:82801135-82801157 TGGGGGAGGCAGGCGCCATGGGG + Intronic
1157544807 18:48539915-48539937 CGGGGAAGGGAGGGGCGGCGTGG - Intronic
1158273108 18:55738043-55738065 AGGGGAAGGGAGGAGGGAAGGGG - Intergenic
1160040138 18:75337600-75337622 GGGCCAAGGCAGGCGGGAAGAGG + Intergenic
1160873295 19:1286491-1286513 CGGGGAAGGCAGGCGCGAAAAGG - Intronic
1160881366 19:1322223-1322245 CGGGGAAAGGAGGGGTGAAGGGG + Intergenic
1160981999 19:1820448-1820470 CGGGGAACGCAGACGCGATGAGG + Intronic
1161425044 19:4198577-4198599 CGGGGAAGGGAGGGGAGAGGAGG - Intronic
1161772100 19:6236465-6236487 CAGGGAAGGCAGCCACGACGAGG + Intronic
1162323739 19:9986339-9986361 CGGGGCAGGCTGGCGAGGAGGGG - Exonic
1162403617 19:10461036-10461058 CGTGGATGGCAGCCGCGAAGAGG - Exonic
1162975988 19:14207124-14207146 CGGGGAAGGAGGGCGCAAATGGG + Intergenic
1164973916 19:32556677-32556699 CTGGGAAGGGAGGGGAGAAGAGG + Intergenic
1165114830 19:33522438-33522460 GGAGGAGGGCAGGCGAGAAGTGG + Intergenic
1166273639 19:41735080-41735102 GGGGGAAGGCAGGTAGGAAGAGG + Intronic
1166278745 19:41775263-41775285 CGGGGAAGGCAGATAGGAAGAGG + Intergenic
1166762574 19:45234332-45234354 CGGGGTAGGCGGGCGCCAGGCGG + Intronic
1168342512 19:55633434-55633456 GAGGGAAGGCAGGTGGGAAGAGG + Intergenic
925304558 2:2839076-2839098 CGGGGAAGACAGGGCCGAACTGG + Intergenic
926225110 2:10961639-10961661 CGAGCAAGGCAGGTGGGAAGGGG - Intergenic
926763653 2:16303270-16303292 TGGGGAAGCCAGGAGAGAAGAGG - Intergenic
927471483 2:23380899-23380921 AGGGGAAGGCAGGGGCCAGGAGG - Intergenic
927959959 2:27234985-27235007 CTGGGAAGGCTTGAGCGAAGGGG + Intronic
927964878 2:27262516-27262538 CAGGGAAGGCAGGCGCCGCGGGG + Intronic
929604345 2:43225260-43225282 CGTGGAAGCCATGCGCGAACTGG + Exonic
929808432 2:45169073-45169095 GGGGGACGGCAGGCGGGGAGTGG + Intergenic
930667621 2:54115483-54115505 CGGGGACGCCAGGAGGGAAGAGG - Exonic
932567247 2:72917774-72917796 CGGGCGAGCCAGGCGCGGAGCGG - Exonic
934580518 2:95434231-95434253 CAGGGAAGGCAGGCGCTGTGTGG + Intergenic
934598930 2:95642486-95642508 CAGGGAAGGCAGGCGCTGTGTGG - Intergenic
935446830 2:103166245-103166267 AGGGGAAGGGAGGGGCGAAAGGG + Intergenic
936020153 2:108988580-108988602 TGGGGAAGGCAGGCGCGGCAGGG - Intronic
938079681 2:128363067-128363089 CGGGGAAGGCAGGAGCGGTGCGG + Intergenic
938097464 2:128473111-128473133 CGGGGATGGAAGGAGGGAAGCGG - Intergenic
938379542 2:130828909-130828931 CGGGGAAGGCTGGTGCCAGGAGG - Intergenic
940851354 2:158690678-158690700 TGGGGAAGGGAGGAGAGAAGTGG - Intergenic
942314226 2:174683011-174683033 CGGGGCAGGCGGGCGCGCGGAGG - Intergenic
942944282 2:181656651-181656673 CGGGGAGGGGAGGCGAGAAAAGG + Intronic
943669852 2:190649030-190649052 CGGGGAAGGCAGGGGAGGGGAGG + Intronic
944191641 2:197010067-197010089 CGAGGAAGGAAGGAGAGAAGTGG + Intronic
946040809 2:216781310-216781332 AGGGGAGGGCAGGGGAGAAGAGG - Intergenic
947521574 2:230849935-230849957 CGGGGAAGGCAGGGGTGCCGAGG + Intergenic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948237529 2:236401757-236401779 CGGGGAAGAGAGGGGGGAAGGGG + Intronic
948503567 2:238411825-238411847 CGGGGAAGGCAGGATCGGGGGGG + Intergenic
948619516 2:239225595-239225617 CGGGGAAGGCAGGTCGGCAGGGG + Intronic
1168760619 20:347514-347536 TGGGGAAGGGAGGCGGGAAATGG + Intronic
1168965614 20:1896208-1896230 CGGGGAAGGCAGGAGGAAGGGGG - Intronic
1169669819 20:8084384-8084406 TGAGGAAGGCAGGGGAGAAGAGG - Intergenic
1173180063 20:40799548-40799570 CTGGAATGGCAGGCGTGAAGCGG - Intergenic
1174442696 20:50568696-50568718 AGGAGAAGGCGGGGGCGAAGAGG - Intronic
1175119655 20:56708234-56708256 TGGGGATGGCAGGAGAGAAGTGG + Intergenic
1179283843 21:39958810-39958832 CAGGTAAGGCAGGAGAGAAGGGG + Intergenic
1179581447 21:42347079-42347101 CGGGGAAGCCACGGGAGAAGGGG + Intronic
1179887140 21:44319010-44319032 CGGGGAAGGCAGAGGCGAGGGGG + Intronic
1180910755 22:19448260-19448282 CAGGGAACGCAGGCTTGAAGTGG + Intergenic
1182620977 22:31618365-31618387 CGGGCAACGCAGGCGCCAATGGG - Exonic
1183122817 22:35743583-35743605 CGGAGAAGACAGGAGGGAAGAGG + Intronic
1183464801 22:37974122-37974144 CGGGCAAGGCAGACCCGAAGCGG - Exonic
1183858638 22:40653245-40653267 GGGGGAGGGCAGGGGAGAAGGGG + Intergenic
1184109925 22:42388660-42388682 GGAGGGAGGCAGGCGCCAAGAGG + Intronic
1184370432 22:44078447-44078469 CGGGGCAGGCATGGGGGAAGTGG + Intronic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
950046404 3:9951061-9951083 GAGGGAAGGAAGGCGGGAAGAGG - Intronic
952752204 3:36833690-36833712 CAGGGAAGGTAGGAGAGAAGAGG - Exonic
953638541 3:44684441-44684463 CGGGGAAGGGAAGTGCAAAGAGG - Intergenic
954687352 3:52378133-52378155 AGGGGTAGGCAGCCCCGAAGTGG + Intronic
961324451 3:126102081-126102103 CGCAGAAGGCAGGTGGGAAGTGG + Intergenic
962259945 3:133895842-133895864 CGGAGGAGGCAGGCGGGAGGGGG - Intergenic
962345026 3:134612361-134612383 CGTGGAAGGAAGGGGAGAAGGGG + Intronic
963901985 3:150741801-150741823 ATGGGAAGGCAGGCAGGAAGGGG + Exonic
968879520 4:3292148-3292170 AGGGGAAGGCAGGAAGGAAGGGG + Intergenic
968879530 4:3292187-3292209 CGGGGAAGGAAGACACGAAGAGG + Intergenic
968970864 4:3792986-3793008 CTGGGAAGGCAAGCCTGAAGGGG + Intergenic
969063648 4:4460075-4460097 CGGGGAAGGAAGAAGGGAAGTGG - Intronic
972725604 4:41744823-41744845 CGGGGTAGGCGGGAGCGAGGGGG + Exonic
979225363 4:118278597-118278619 GGGGGAAAGGAGCCGCGAAGGGG + Intergenic
981046881 4:140272809-140272831 TGGGGAAGGAAGGCGGGGAGGGG + Intronic
982054682 4:151536437-151536459 CAGGGAGGGCAGGAGGGAAGTGG - Intronic
986581209 5:9267764-9267786 CGGGGTGGGCATGGGCGAAGTGG + Intronic
988513553 5:31886366-31886388 CAGGGAAGGAAGGGGCCAAGGGG - Intronic
992528045 5:77630419-77630441 CGGGGAAGGCGGGCTGGTAGAGG + Exonic
994043445 5:95284054-95284076 CGGGGGAGGCTGGGGCGAGGAGG + Exonic
997028816 5:130098201-130098223 GGGGTAAGGCAGGAGGGAAGAGG - Intronic
997304948 5:132830180-132830202 CGGGGAAGGATCGCGCGCAGGGG + Intronic
998135078 5:139670189-139670211 TGGGGGAGGCAGGCGAGAGGCGG - Intronic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
1001083456 5:168683745-168683767 AGAGGAAGGCAGGCCCGCAGAGG - Intronic
1002716527 5:181231529-181231551 CTGGGAAGGGAGGAGGGAAGAGG - Intronic
1002896823 6:1384313-1384335 CTGGGAAGGCGGGCGGGAGGAGG + Intergenic
1003114115 6:3271977-3271999 CCAGGAAGGCAGGCGTGAGGGGG + Exonic
1004044400 6:12011640-12011662 CGGGGCGGGGAGGGGCGAAGCGG + Intronic
1006389486 6:33750066-33750088 CAGGGAAGGCAGCAGTGAAGTGG - Intergenic
1006391436 6:33761314-33761336 CAGGGCAGGCAGGAGAGAAGGGG - Intergenic
1008588079 6:52967128-52967150 GGGGGCAGGCAGGAGTGAAGTGG - Intergenic
1010378949 6:75205385-75205407 CGGGGAGGGCAGGCGTGCGGCGG - Intronic
1017103419 6:150866811-150866833 CGGGGAAGGCTGGAGCCCAGGGG - Intronic
1017219009 6:151944231-151944253 TGGGGAGGGCAGGGGTGAAGTGG + Exonic
1017245845 6:152223649-152223671 AGGGGAAGGGAGGGGAGAAGAGG + Intronic
1018238131 6:161745707-161745729 CTGGGAAGGCAGACGGCAAGGGG + Intronic
1019420793 7:949802-949824 CAGGGCAGGCAGGCAGGAAGCGG + Intronic
1019517896 7:1447740-1447762 GGGGCATGGCAGGCGTGAAGAGG - Exonic
1020098133 7:5379827-5379849 CTGGGAAGGCCGGCCCCAAGGGG - Intronic
1020198239 7:6059044-6059066 CGGGGTCCGCAAGCGCGAAGAGG - Exonic
1020363335 7:7353439-7353461 TGGGGAAGGCATGCAGGAAGAGG - Intergenic
1020946395 7:14613655-14613677 AGGGGAAGGCAGTCAGGAAGAGG + Intronic
1024521077 7:50304503-50304525 CGGGGGCGGCCGGCGCGGAGGGG + Intronic
1026060223 7:67019117-67019139 CGGGGAAGGCTGATGTGAAGGGG - Intronic
1027055783 7:75048487-75048509 CACGGAAGTCAGGAGCGAAGGGG - Intronic
1027733367 7:81903396-81903418 CAGTGAAGGCAGGCAGGAAGGGG - Intergenic
1028955473 7:96684474-96684496 CGGGGGAGGCAGGGGAGATGAGG + Intronic
1029530538 7:101122365-101122387 CGGGGAAGACAGAAGCAAAGAGG + Intergenic
1031836909 7:126690270-126690292 AGGGCAAGGCAGGCACGGAGTGG + Intronic
1032284098 7:130527999-130528021 CGGGGAGGAAAGGCGCAAAGGGG + Intronic
1032284872 7:130532376-130532398 TGGGGAGGGAAGGCGCAAAGGGG + Intronic
1034263900 7:149772513-149772535 CGGAGAAGAGAGGCGCGGAGGGG - Intronic
1035546985 8:489267-489289 GGGGGAAGGCGGGGGCAAAGTGG + Intergenic
1037769634 8:21790737-21790759 CAGGGAGGGCAGGCCTGAAGGGG - Intronic
1037807417 8:22066430-22066452 CGGGGAGGGCAGGTGCGGCGGGG + Intronic
1037891898 8:22628037-22628059 TGGGGATGGGAGGGGCGAAGAGG + Intronic
1038632890 8:29262787-29262809 GGGGGAAGGGAGGGGAGAAGAGG + Intronic
1039983235 8:42427086-42427108 TGGGGAAGGAAGGCAGGAAGAGG - Intronic
1040052887 8:43033332-43033354 CGGGGATGGCGGCCGGGAAGAGG + Intronic
1041673601 8:60516815-60516837 CGGGCAAGGCAGGCGCGGGGCGG + Intergenic
1048282094 8:133113200-133113222 TGGGGAAGGCAGGCACAGAGAGG + Intronic
1049193319 8:141301109-141301131 CGGGGCAGGCAGGCTGGAGGTGG - Intronic
1049693952 8:143974679-143974701 GGGGGAGGGCAGGAGGGAAGTGG - Intronic
1049936335 9:504673-504695 CGGGGAAGGGCGGGGCGCAGGGG - Exonic
1050707184 9:8414843-8414865 CGGGGAGGGAAGGCGTGCAGGGG + Intronic
1056646661 9:88418150-88418172 CTGGGAAGGGAGGCGGGTAGAGG - Intronic
1061237428 9:129351149-129351171 CGGGGAAGGCGGGGCTGAAGAGG - Intergenic
1061727627 9:132590119-132590141 CGGGGCAGGAAGGGGCCAAGGGG + Exonic
1062050477 9:134444335-134444357 GGGGGAAAGCAGGAGGGAAGGGG - Intergenic
1062080805 9:134622478-134622500 GGAGGAAGGCAGGGGGGAAGGGG - Intergenic
1062314761 9:135961214-135961236 CCGGGAAGGCGGGCGGGGAGGGG + Exonic
1203789944 EBV:145716-145738 GGGGGAAGGCAGGCGACAATTGG - Intergenic
1185512741 X:675698-675720 AGGGGAAGGCAGGGACGCAGGGG - Intergenic
1187045936 X:15647340-15647362 GGGAGAAGGCAGGAGCGAATGGG - Intronic
1187051914 X:15703641-15703663 GGGAGAAGGCAGGAGCGAATGGG - Intronic
1187225827 X:17375102-17375124 CGGGGGAGGCCGGGGCGAGGGGG - Intergenic
1189989477 X:46580637-46580659 CAGGGAAGGCAGGCCCAAATGGG - Intronic
1197074703 X:122340787-122340809 CTGGGAAAGCAGCCGGGAAGGGG - Intergenic
1201438619 Y:13985547-13985569 GGAGGGAGGCAGGCGGGAAGAGG - Intergenic
1201445954 Y:14057161-14057183 GGAGGGAGGCAGGCGGGAAGAGG + Intergenic
1201575324 Y:15456193-15456215 CCGGCCAGGAAGGCGCGAAGAGG - Intergenic