ID: 1149965576

View in Genome Browser
Species Human (GRCh38)
Location 17:61160712-61160734
Sequence GATTATAGTGGACCACACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149965570_1149965576 22 Left 1149965570 17:61160667-61160689 CCATCTATGCCTCCAAAATATAA 0: 1
1: 0
2: 4
3: 21
4: 276
Right 1149965576 17:61160712-61160734 GATTATAGTGGACCACACTATGG 0: 1
1: 0
2: 0
3: 2
4: 47
1149965572_1149965576 13 Left 1149965572 17:61160676-61160698 CCTCCAAAATATAAAAAAGGTCA 0: 1
1: 0
2: 5
3: 59
4: 708
Right 1149965576 17:61160712-61160734 GATTATAGTGGACCACACTATGG 0: 1
1: 0
2: 0
3: 2
4: 47
1149965573_1149965576 10 Left 1149965573 17:61160679-61160701 CCAAAATATAAAAAAGGTCATGG 0: 1
1: 0
2: 4
3: 30
4: 357
Right 1149965576 17:61160712-61160734 GATTATAGTGGACCACACTATGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149965576 Original CRISPR GATTATAGTGGACCACACTA TGG Intronic
905161859 1:36043187-36043209 GCTGATAGTTGACCCCACTATGG - Intronic
906397337 1:45477803-45477825 AATTATAGTGGAGCAGAGTAGGG - Intronic
911950781 1:104171822-104171844 GATTATAGTTGACTACAGTTAGG + Intergenic
914691627 1:150034038-150034060 AATTATAATGGACAACACTGAGG + Intergenic
1065797537 10:29321081-29321103 GATTATACTGAGCCACGCTAAGG + Intergenic
1072858622 10:98977675-98977697 GAATATAATGGAAGACACTATGG - Intronic
1082261967 11:50083339-50083361 GATGATAGTGGTCCTGACTAGGG - Intergenic
1093234416 12:16588940-16588962 GGTGACAGTGGACCACAGTAGGG - Intronic
1111378017 13:87406420-87406442 GATGATATTTAACCACACTAAGG - Intergenic
1113343873 13:109454381-109454403 GATTATATTGGCACACAATAGGG - Intergenic
1124984314 15:34591432-34591454 GATGATAGTGTACCACACCCGGG - Intergenic
1125747840 15:42009366-42009388 GATTATGGTGGTCTACACCAGGG - Intronic
1131457160 15:92590537-92590559 GATAAGAGTGGACCAGATTAAGG - Intergenic
1133948748 16:10371899-10371921 GTATGTAGTGGATCACACTATGG + Intronic
1149965576 17:61160712-61160734 GATTATAGTGGACCACACTATGG + Intronic
1150792918 17:68213612-68213634 GATGAAAGTGGCCCACACAAGGG - Intergenic
1153533970 18:6080325-6080347 GATTATATTGTACCAAGCTAAGG - Intronic
1153968002 18:10199281-10199303 GATTACAGTAGTCCCCACTAGGG - Intergenic
1156775066 18:40777458-40777480 AGTTATAGTGGAGCACACAATGG + Intergenic
1157115570 18:44859562-44859584 GTTTATAGTTGAACACACTGAGG - Intronic
1157802975 18:50635890-50635912 GACTATAGTGGACCAGGCCATGG - Intronic
1159074435 18:63664470-63664492 GATTACAGGGGACCAGTCTATGG + Intronic
1160274077 18:77414010-77414032 GGTTATAGAGGACCCCTCTAAGG - Intergenic
1164212087 19:23107765-23107787 GTTTATGGTGGAACACACTCAGG + Intronic
940072486 2:149704044-149704066 AATTATTATTGACCACACTAGGG - Intergenic
940974033 2:159923723-159923745 GATTATACTGGAGCACTCCACGG + Intergenic
1169650158 20:7858126-7858148 GATGATAGTGGATCAGACCAGGG + Intergenic
1173239523 20:41281943-41281965 GATGACAGTGGCCCACATTAGGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
963830455 3:150002498-150002520 GATAATGATAGACCACACTATGG + Intronic
964110054 3:153078525-153078547 GAATCCAGTGGACCACACTGTGG - Intergenic
965812769 3:172608984-172609006 GATTATAATTGACCAGGCTATGG + Intergenic
967494514 3:190127887-190127909 CATTTTAGTGGACCAGACTTAGG - Intergenic
968962915 4:3754459-3754481 GGTTATAGAGCACCAGACTAAGG + Intergenic
977481302 4:97579688-97579710 TTTTAAAGTGTACCACACTAAGG + Intronic
984206707 4:176793772-176793794 GGTTACAGAGGACCACGCTAAGG + Intergenic
1000045944 5:157522064-157522086 ATTTATTGTGCACCACACTATGG - Intronic
1007207410 6:40164048-40164070 GATTCTAGTAGACCCCAATAAGG + Intergenic
1013738361 6:113254139-113254161 GACTATTGTGGAACACAGTATGG + Intergenic
1030745123 7:113155901-113155923 AATTATATTGATCCACACTAAGG - Intergenic
1031953824 7:127921879-127921901 AATTATAGTACACCACACAATGG - Intronic
1037046226 8:14307582-14307604 CATTAAAGTGGATCACACTTTGG + Intronic
1037280239 8:17233061-17233083 GATTATAGCAGACCACTCTAAGG - Intronic
1044275755 8:90297690-90297712 GATTATTGTGGGGCAAACTAAGG - Intergenic
1047547151 8:125829381-125829403 AATTATAGTGGATCAGACTGAGG - Intergenic
1053587559 9:39476379-39476401 GACTAAAGCAGACCACACTATGG - Intergenic
1054578738 9:66888859-66888881 GACTAAAGCAGACCACACTATGG + Intronic
1191897680 X:66010891-66010913 GATTTTAGGGGTCCAGACTATGG - Intergenic
1194031758 X:88825727-88825749 TATTTTAGGGGACCACTCTATGG - Intergenic
1195066744 X:101244240-101244262 GATTATGGTGGCCCAGACTAGGG + Intronic