ID: 1149965619

View in Genome Browser
Species Human (GRCh38)
Location 17:61161011-61161033
Sequence CAAAGTTGACACAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149965619_1149965627 26 Left 1149965619 17:61161011-61161033 CCCCCTTCCCTGTGTCAACTTTG 0: 1
1: 0
2: 4
3: 26
4: 310
Right 1149965627 17:61161060-61161082 AAATACTCTGCAGATGATGAAGG 0: 1
1: 0
2: 1
3: 26
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149965619 Original CRISPR CAAAGTTGACACAGGGAAGG GGG (reversed) Intronic
900186467 1:1335486-1335508 CACAGCTGCCACAGGGAGGGAGG - Exonic
900352315 1:2241054-2241076 AAACGTTGACACATGGAAGAGGG + Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902482908 1:16720875-16720897 CAAGGTTGAAACAGGGCTGGAGG + Intergenic
903225810 1:21893667-21893689 CAGAGTAGAGACAGAGAAGGAGG + Intronic
903659876 1:24970450-24970472 CAAAGATGACACTGGGCAGAAGG - Intergenic
904054036 1:27658691-27658713 CAACGTGGGCAGAGGGAAGGAGG + Intergenic
905042666 1:34973182-34973204 CTGCGTTGACTCAGGGAAGGAGG - Intergenic
907321126 1:53603009-53603031 CCAAGGTCACACAGGGAAGAAGG + Intronic
908507667 1:64821644-64821666 CAAAGTTGACAAAAGCAATGGGG + Intronic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
909548542 1:76873541-76873563 AAAAGTTGACATAGGTAAGTAGG - Intronic
911513318 1:98835325-98835347 CATAGTTGTAACAGTGAAGGTGG + Intergenic
912500640 1:110119901-110119923 GAGAGTTCACACAGAGAAGGCGG - Intergenic
914329349 1:146651530-146651552 CAAAGTTGACAAAAGCAATGGGG + Intergenic
915155564 1:153873098-153873120 AAATGTTAACACAGGGAAGAAGG + Intronic
915191845 1:154157485-154157507 CGAAAAAGACACAGGGAAGGAGG + Intronic
916415928 1:164591962-164591984 CAAAAGTGCCACAGGGGAGGTGG - Intronic
916563209 1:165950841-165950863 CACAGGGGACGCAGGGAAGGAGG + Intergenic
916692352 1:167202441-167202463 TAAACTTGACAGAGGGGAGGTGG - Intergenic
917183162 1:172321623-172321645 CAATGATGTCACAGGGTAGGAGG - Intronic
917553950 1:176064921-176064943 CAAGCTTGAAAAAGGGAAGGAGG - Intronic
920516189 1:206586111-206586133 TCAAGTCCACACAGGGAAGGTGG - Intronic
920614168 1:207472966-207472988 GAAAGTTTACACAGGGGAGCAGG - Exonic
920838489 1:209534130-209534152 CAAAACTGACACCAGGAAGGAGG + Intergenic
920991690 1:210945880-210945902 GAAAAATGAAACAGGGAAGGGGG - Intronic
921740810 1:218682303-218682325 CAGAGATGCCACAAGGAAGGAGG + Intergenic
923521086 1:234735287-234735309 CAAAGTTGAGACTTGGAAGAAGG + Intergenic
923546595 1:234927858-234927880 CAAGGTTGCCACAGGGAGGGAGG - Intergenic
1062897605 10:1116235-1116257 CAGAGATGACCCAGGGCAGGGGG - Intronic
1063020321 10:2120334-2120356 CAAAGTTAACAGAGGGAAATAGG - Intergenic
1063071516 10:2671331-2671353 CGGAGATGACACAGGGAAAGAGG - Intergenic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064798759 10:19044472-19044494 CAAAAATGAGACAGGTAAGGTGG - Intergenic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1067433941 10:46264362-46264384 CACAGGGGACACAGGGCAGGTGG + Intergenic
1067581901 10:47451534-47451556 CACAGGGGACACAGGGCAGGTGG - Intergenic
1068472489 10:57482667-57482689 CTACTTTGTCACAGGGAAGGAGG - Intergenic
1069757033 10:70779678-70779700 GACAGTTGACTCAGGCAAGGGGG + Exonic
1070647302 10:78210863-78210885 CTCAGTTGACACAGGGGTGGAGG + Intergenic
1070648125 10:78215611-78215633 GAATTTCGACACAGGGAAGGAGG + Intergenic
1070695967 10:78563337-78563359 CTAAGGTCACACAGGGCAGGGGG - Intergenic
1071536221 10:86433553-86433575 CAAAGGTTAAACAGGGAAAGAGG + Intergenic
1071849379 10:89552984-89553006 CAAAGTGGACAGAGGGACGGAGG - Intronic
1073378081 10:103054179-103054201 CACAGATGCCACGGGGAAGGAGG - Intronic
1074093105 10:110282060-110282082 TAAAGTTCATACAGGGAAGGTGG + Intronic
1074350562 10:112732906-112732928 CAGAGTTGACACAGTAAAGGTGG + Intronic
1074435737 10:113432620-113432642 AAAAGTTGACAAAGGGAGGTGGG + Intergenic
1075765949 10:124893014-124893036 CAAAGAAGACACAGGGAAGAAGG - Intergenic
1075907908 10:126098211-126098233 CAAATTGCACACAGGAAAGGTGG - Intronic
1075979933 10:126729385-126729407 CAAAGTCAGCCCAGGGAAGGGGG - Intergenic
1078796233 11:14594402-14594424 AATTGTTGGCACAGGGAAGGGGG + Intronic
1078942203 11:16020121-16020143 CAATGTGAACACAGGAAAGGAGG - Intronic
1079344169 11:19637439-19637461 CAATGTTGACACACACAAGGTGG + Intronic
1079495675 11:21040980-21041002 GAAAGTTGACAAAGGAAAGCTGG - Intronic
1080746183 11:35110687-35110709 CAAGGCTGGAACAGGGAAGGGGG + Intergenic
1081631502 11:44692850-44692872 CAAAAGGGGCACAGGGAAGGTGG + Intergenic
1083811242 11:65108107-65108129 CAAAGCACACACAGGGCAGGGGG - Intronic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084412846 11:69014064-69014086 GAAAGTTGGCCCAGGGTAGGAGG - Intergenic
1087035893 11:93756012-93756034 CAAAAATTAGACAGGGAAGGTGG + Intronic
1087262328 11:96024860-96024882 CCAGTTTGACACAGGCAAGGTGG - Intronic
1088335150 11:108695474-108695496 TGAAGTGGACACAGGGCAGGTGG - Intronic
1088539657 11:110900693-110900715 CAAAGTAGACAGAGGAAAGAAGG - Intergenic
1088681674 11:112248964-112248986 TAAGGTTGACACTGGAAAGGTGG + Exonic
1088986099 11:114909907-114909929 CACAGTTGACACAGGCAAGGAGG - Intergenic
1089711460 11:120317752-120317774 CATGGCTGACACAGGGAAAGGGG + Intronic
1090243665 11:125201058-125201080 CAATGATGGCACAGAGAAGGTGG - Intronic
1090615377 11:128509494-128509516 CAAAGTAGACACATGAAAGGTGG - Intronic
1091353088 11:134913360-134913382 CAGAGATGAGACAGAGAAGGAGG + Intergenic
1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG + Intronic
1093761224 12:22913913-22913935 AAAACTTGAGAGAGGGAAGGAGG - Intergenic
1094165370 12:27437641-27437663 AACAGTTCACAAAGGGAAGGGGG + Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1096628063 12:52907311-52907333 CAAACCTGGGACAGGGAAGGCGG + Intronic
1098073200 12:66698612-66698634 CAAACAAGAAACAGGGAAGGAGG - Intronic
1098572414 12:72003290-72003312 CAAAGCTGACAAAGGGCTGGGGG + Intronic
1100595600 12:96069096-96069118 AAAACTTGATTCAGGGAAGGGGG + Intergenic
1100982867 12:100176219-100176241 CAAAGATGACAGATGGAAGGAGG + Intergenic
1102911701 12:116719958-116719980 GAATGCTGATACAGGGAAGGGGG + Intronic
1104121024 12:125800153-125800175 CAGAGATGACACAGAGAAAGAGG + Intergenic
1104821339 12:131679232-131679254 AAGAGATGACACTGGGAAGGGGG + Intergenic
1106853286 13:33818383-33818405 GAAAAATAACACAGGGAAGGGGG + Intronic
1107028027 13:35823492-35823514 CAAAGTTGAGTGAGAGAAGGAGG + Intronic
1107343282 13:39432522-39432544 CAAAGATGACATAGGAGAGGGGG - Intronic
1107385491 13:39904139-39904161 GAAAGGTAAAACAGGGAAGGGGG + Intergenic
1109348393 13:61145202-61145224 CAAAGTGGGCACTGGGAATGGGG - Intergenic
1110782537 13:79482280-79482302 CAAAGTTTACACAGTTAAGCTGG - Intronic
1111040019 13:82735800-82735822 CAATGTTGACAAAAGCAAGGGGG - Intergenic
1112874205 13:104015255-104015277 CAATATTGACACAGGGAAAGCGG + Intergenic
1113804533 13:113105746-113105768 CAAGGGTGACAGAGGGATGGGGG - Intergenic
1114215796 14:20656835-20656857 CAAAGTAGACACAGCAAAGTGGG + Intergenic
1114949383 14:27729511-27729533 CAAAGGTGACAAAGTGAAGCTGG + Intergenic
1118683432 14:68266661-68266683 CAAAGTTATCAGAGGGAATGAGG + Intronic
1120482422 14:85068020-85068042 TAAAGTTGAGAGAGGGGAGGTGG - Intergenic
1122873266 14:104651060-104651082 CAAACTTCACACTGGAAAGGTGG + Intergenic
1123727822 15:23122348-23122370 CGAAGATGACAAATGGAAGGGGG - Intergenic
1123730435 15:23139526-23139548 CGAAGATGACAAATGGAAGGGGG + Intergenic
1123748573 15:23336944-23336966 CGAAGATGACAAATGGAAGGGGG + Intergenic
1124531827 15:30515305-30515327 CAAAGATGACAAATGGAAGGGGG - Intergenic
1124562529 15:30788436-30788458 CAACGATGACAAATGGAAGGGGG - Intergenic
1124766830 15:32492385-32492407 CAAAGATGACAAATGGAAGGGGG + Intergenic
1125466451 15:39957752-39957774 GGAAGATGACACAGGGAAAGTGG + Intronic
1125769792 15:42157498-42157520 CAAAGGTGACAGAGGTGAGGCGG + Intergenic
1128040840 15:64572075-64572097 AAAAGTTGAGAAAGGGAAAGAGG + Intronic
1128283303 15:66415216-66415238 AAAAGATGACACAGGGACAGTGG - Intronic
1128778846 15:70344710-70344732 AAGTGTTGACACAGGTAAGGAGG + Intergenic
1129030361 15:72612968-72612990 CAAACTAGACACAGGAAAAGGGG + Intergenic
1129376824 15:75138740-75138762 GAAGGGGGACACAGGGAAGGAGG + Intergenic
1129632670 15:77278638-77278660 AAAAGCTGACACTGGCAAGGAGG + Intronic
1129730654 15:77929851-77929873 CAAAGAGGACAAATGGAAGGGGG + Intergenic
1129837286 15:78718148-78718170 CAAAGATGACAAATGGAAAGGGG - Intronic
1130222298 15:82029938-82029960 CAAAGAAGACAAAGTGAAGGCGG + Intergenic
1131100604 15:89686479-89686501 CAAAGCTGGCAAAGAGAAGGTGG - Exonic
1131187679 15:90289185-90289207 CAAAGAGGACAAATGGAAGGGGG - Intronic
1131270236 15:90942814-90942836 CCAGGGAGACACAGGGAAGGGGG - Intronic
1131274123 15:90966418-90966440 CAAAGTAGGCACAGGAATGGGGG + Exonic
1132782887 16:1637941-1637963 CAAAGGTGACAAAGGACAGGAGG - Intronic
1133200619 16:4202132-4202154 CACAGCTGTCAGAGGGAAGGAGG + Intronic
1133501965 16:6375315-6375337 GAGAAATGACACAGGGAAGGTGG - Intronic
1134164024 16:11915796-11915818 CAACGCTGACTGAGGGAAGGCGG + Exonic
1137539841 16:49354805-49354827 CAAAAATGCCACAGGCAAGGTGG - Intergenic
1137716372 16:50600866-50600888 GAGAGTTTGCACAGGGAAGGTGG - Intronic
1137863035 16:51865969-51865991 CAGAGTTGACAAGAGGAAGGAGG - Intergenic
1137938245 16:52656182-52656204 CGAAAAAGACACAGGGAAGGAGG - Intergenic
1140004212 16:71059404-71059426 CAAAGTTGACAAAAGCAATGGGG - Intronic
1140288656 16:73629139-73629161 CACAGATGACACACGGAAGGTGG - Intergenic
1142890724 17:2940834-2940856 AAAAGATGACACAGCCAAGGAGG - Intronic
1144342241 17:14319407-14319429 AACAGTGGACACAGGGAAGAGGG + Intronic
1145720694 17:27069302-27069324 CAAAGTTGACAAAAGCAATGGGG - Intergenic
1146874793 17:36400512-36400534 CAAAGTTTCCACAGGGGAGAGGG - Intronic
1147064594 17:37912367-37912389 CAAAGTTTCCACAGGGGAGAGGG + Intergenic
1147721351 17:42541462-42541484 CAAACGAGACACTGGGAAGGAGG - Intronic
1148734101 17:49854924-49854946 GAAAGCTTACACAGGGCAGGGGG + Intergenic
1149723280 17:58866903-58866925 CAAAGATGACAAAAGGAAGGAGG + Intronic
1149965619 17:61161011-61161033 CAAAGTTGACACAGGGAAGGGGG - Intronic
1151255667 17:72874488-72874510 CAAAGCTGACACCAGGAGGGAGG + Intronic
1151649063 17:75454714-75454736 CAATGCAGACACAGAGAAGGAGG + Intronic
1155630873 18:27890796-27890818 AAAGGCTGACACAGGGAAGAGGG - Intergenic
1156212315 18:34958184-34958206 CAAAGTAAACACTGGGAAGTGGG - Intergenic
1156488314 18:37480715-37480737 CAAAGTTGAAAGAGGGAGGGAGG + Intronic
1157257761 18:46153597-46153619 CAAATTTGATACAGGGATGAAGG + Intergenic
1157948362 18:52006480-52006502 CACAGTTGACAGAGGTAAGATGG - Intergenic
1162227100 19:9232211-9232233 CAAGGTTGACAAAAGGAAGATGG - Intergenic
1166363975 19:42269396-42269418 CAGGGCTGACACAGGAAAGGGGG + Intronic
1166586700 19:43955282-43955304 CAAAAATGACACAGTGAAGATGG - Intronic
1167971308 19:53189141-53189163 AAAAGTTGACACAGTGGAGGAGG + Intronic
925211414 2:2050691-2050713 AAAAGATGACACATGGTAGGGGG + Intronic
925431765 2:3800906-3800928 CAAATGCCACACAGGGAAGGAGG + Intronic
925858955 2:8156699-8156721 CAAAGGTGACAGAGGGATGCGGG + Intergenic
926048216 2:9725744-9725766 CTAAGTTGTCACAGAGAAGGAGG - Intergenic
926395141 2:12433728-12433750 CATGGTTGACGGAGGGAAGGAGG - Intergenic
926438313 2:12860251-12860273 TCAACTTGACACAGGGCAGGCGG + Intergenic
927598957 2:24423365-24423387 CAAAGATGAAACAGGGAAAGAGG + Intergenic
928032407 2:27792739-27792761 CAAACTAGACACAGAGAAAGGGG - Intronic
928955554 2:36863439-36863461 CAAAGTTGACAAAAGCAATGGGG - Intronic
930015892 2:46970369-46970391 CAAATGCCACACAGGGAAGGTGG + Intronic
931049227 2:58391575-58391597 CAAAGGAGACACAGCTAAGGGGG + Intergenic
931231926 2:60382420-60382442 CAAAGGGGGCACAGGAAAGGAGG - Intergenic
931409097 2:62011894-62011916 AAAAGTTGATACAGGCAAGATGG + Intronic
931785916 2:65619402-65619424 CAGGGCTTACACAGGGAAGGAGG - Intergenic
932582421 2:73000451-73000473 CATAGTTGACACAGGCATTGTGG + Exonic
934158351 2:89224656-89224678 CACAGTGGACACAGGTAAGAAGG + Intergenic
934208917 2:89957769-89957791 CACAGTGGACACAGGTAAGAAGG - Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
935836178 2:107056798-107056820 CCAAGTGGAAAGAGGGAAGGTGG - Intergenic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936541444 2:113355274-113355296 CTAAGCTGACACAGGTAGGGTGG - Intergenic
937074087 2:119088435-119088457 CACAGTTGCCAAAGGGCAGGAGG - Intergenic
937294108 2:120799363-120799385 CATAGTTGCCACAGGGCAGGTGG + Intronic
938318842 2:130348646-130348668 CAATGTAGCCACAAGGAAGGAGG - Intergenic
938442518 2:131348681-131348703 TAAACTTGTCACAGGGAAGCAGG - Intronic
940346603 2:152635637-152635659 CAGAGTTGAGTCAGGCAAGGGGG + Intronic
940710496 2:157156955-157156977 AAGAGTTGGCACAGGGAAAGAGG + Intergenic
941413130 2:165185581-165185603 CAAAGCTGACACACTGAGGGTGG + Intronic
941886651 2:170535042-170535064 GAAAGTTAAAGCAGGGAAGGGGG - Intronic
943770054 2:191706510-191706532 CCAACTTGAAACAGGGAAGATGG - Intergenic
944440362 2:199736961-199736983 CACAGTGGACACAGGGAAACAGG + Intergenic
944590369 2:201211391-201211413 CAAAGATGAGAGAGAGAAGGAGG - Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
945788938 2:214278939-214278961 AAAAGATGACACAGGAAAAGTGG - Intronic
946541994 2:220694961-220694983 AAAAGGTGTCAAAGGGAAGGAGG - Intergenic
946652060 2:221903013-221903035 CAAAGTAAATAAAGGGAAGGAGG + Intergenic
948491000 2:238313497-238313519 CAAAGATGACACCAGGAGGGTGG - Intergenic
948685998 2:239670098-239670120 CAAAGCTGCCACAGGTGAGGAGG + Intergenic
948935170 2:241159172-241159194 GACAATTGACACAGGCAAGGGGG - Intronic
1168836586 20:881685-881707 CAAGGCTGGCACAGAGAAGGTGG + Intronic
1168915366 20:1481034-1481056 CAAAGTGGATACAGAGAAAGAGG + Intronic
1168977388 20:1977630-1977652 CAATTTTGGCACAGGGTAGGTGG + Intergenic
1169041153 20:2496659-2496681 GAAAGTGGACACAGTGTAGGTGG + Intronic
1169463863 20:5820649-5820671 CAAAGTTCACAAAGTGAAGAAGG + Intronic
1171296210 20:24019269-24019291 AAAAAGTGAGACAGGGAAGGAGG - Intergenic
1171976420 20:31597518-31597540 CTAAGGTGACTCAGGAAAGGAGG + Intergenic
1172180116 20:32997939-32997961 TAGAGTTGGAACAGGGAAGGGGG - Intronic
1172235458 20:33369898-33369920 CAAAGGTGACTGAGGGAATGAGG + Intronic
1172474869 20:35228963-35228985 GAAAGCTGACAGAGGGAAGGGGG - Intronic
1173351882 20:42253053-42253075 CAAAGGTGATACAGGGATAGAGG + Intronic
1173905898 20:46628496-46628518 GACAGGTGCCACAGGGAAGGAGG + Intronic
1174193387 20:48756144-48756166 CAGAGTTGACTCAGAGAAGGAGG - Intronic
1175043544 20:56079477-56079499 CAAGGATGAGATAGGGAAGGAGG - Intergenic
1176945031 21:14969540-14969562 CAAAATTGACCTAAGGAAGGGGG + Intronic
1184461243 22:44639451-44639473 CAGAGATGCCACATGGAAGGAGG + Intergenic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
949207098 3:1453358-1453380 AAAAGTTGAAAAAGGAAAGGAGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950340726 3:12241760-12241782 CAAGGTTGACACAGGGTAGGAGG - Intergenic
950682930 3:14597477-14597499 CAAAGTGGAGGCAGGGCAGGTGG + Intergenic
951520730 3:23608951-23608973 CCAGGTTGCCACAGGGCAGGCGG - Intergenic
951978160 3:28537552-28537574 AAGAAGTGACACAGGGAAGGTGG + Intronic
952409283 3:33032930-33032952 GACATTTGACACAGGGAAGCTGG - Intronic
952510153 3:34044757-34044779 GAGAGCTGACACAGGGAAAGTGG + Intergenic
952656184 3:35788548-35788570 GGAGGTTGAAACAGGGAAGGCGG - Intronic
955972220 3:64446743-64446765 GAAAGTTCTCTCAGGGAAGGTGG - Intergenic
956460690 3:69468724-69468746 CAAAGATGACAGAGGACAGGGGG + Intronic
959880337 3:111438081-111438103 CAAAGGTAACAATGGGAAGGAGG + Intronic
960699593 3:120427249-120427271 CAAAGTTCAGAGAAGGAAGGGGG - Intronic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
961577230 3:127847435-127847457 CATGCTTGACAGAGGGAAGGAGG + Intergenic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
964202081 3:154128858-154128880 GAAACATGAAACAGGGAAGGGGG - Intronic
966250804 3:177863393-177863415 CAGAGCCTACACAGGGAAGGAGG - Intergenic
966364906 3:179174515-179174537 CAAAGTTGTGAGAGGGAATGGGG - Intronic
966624218 3:181999151-181999173 GAAAGTTGCCACAGGTAAGTAGG - Intergenic
967319673 3:188183261-188183283 CAAAGAGGACATAAGGAAGGTGG - Intronic
967843479 3:194026175-194026197 TAAAGCTGACACACAGAAGGCGG + Intergenic
968827462 4:2909827-2909849 CAAAGTTGAACCAGCGAGGGTGG - Intronic
969825262 4:9752741-9752763 CATAGTTGACACAGTGATTGTGG - Intergenic
970568194 4:17352948-17352970 CAAAGCTGAGACAGGCAAGAAGG + Intergenic
970651512 4:18183989-18184011 CAAAGCAGAAACATGGAAGGTGG - Intergenic
970920354 4:21386931-21386953 CAAAGTTTACACTGTGCAGGAGG - Intronic
971149869 4:24020689-24020711 CAGAGATGAGAAAGGGAAGGGGG + Intergenic
974122642 4:57658070-57658092 CAAAATGGACATAGAGAAGGGGG + Intergenic
976106469 4:81624408-81624430 CAAAGATAAATCAGGGAAGGGGG + Intronic
976871637 4:89801002-89801024 CAAAGAGGAAACAGGGAGGGAGG + Intronic
978507276 4:109472599-109472621 CAATGGTGACTCAGGTAAGGAGG - Intronic
978721307 4:111913233-111913255 AAAAGATGACACAGTGAAGAAGG + Intergenic
979938969 4:126735881-126735903 GATGGTTGACACAGGGAGGGTGG - Intergenic
980897272 4:138871957-138871979 CAAAGTGGTCAGAGGCAAGGGGG + Intergenic
981020261 4:140020105-140020127 CACAGTTGACAAAGGTCAGGAGG - Intronic
981524417 4:145695605-145695627 CAAAGTTGACAAAGGGGATCTGG - Intronic
982321944 4:154086153-154086175 AAAGGTTTACACAGGGAAAGAGG - Intergenic
982427121 4:155277500-155277522 TAAATTTGAAAAAGGGAAGGAGG - Intergenic
982878930 4:160686206-160686228 CAATGGTGGCACAGGGCAGGGGG - Intergenic
984173767 4:176391093-176391115 CATAGTGTACACAGGCAAGGAGG - Intergenic
985208193 4:187563644-187563666 ACAAATGGACACAGGGAAGGAGG - Intergenic
987194739 5:15514959-15514981 CAAACTGGACAGAGAGAAGGTGG - Intronic
988550471 5:32196552-32196574 CAAAGATGAGCCAGGGATGGTGG - Intergenic
989714917 5:44451579-44451601 CAAAGATGGCAAAAGGAAGGAGG + Intergenic
990993038 5:61703590-61703612 ACAAGTTGACAGAGGCAAGGAGG - Intronic
992820585 5:80492011-80492033 CACAGGTCGCACAGGGAAGGAGG + Intronic
992969889 5:82045610-82045632 GATAGATGACACAGAGAAGGAGG + Intronic
993135597 5:83957624-83957646 CCATGTTGAGAAAGGGAAGGAGG + Intronic
997466011 5:134088513-134088535 CAAAAATGAGACAGAGAAGGAGG + Intergenic
998566663 5:143221887-143221909 CATAGTTGATACTGGGCAGGTGG + Intronic
1000369386 5:160520164-160520186 AAAAGTGCAGACAGGGAAGGGGG + Intergenic
1001758908 5:174191588-174191610 CAAGGAGGATACAGGGAAGGAGG - Intronic
1002561236 5:180083704-180083726 CAAGGTTGAGACAGGGACAGAGG - Intergenic
1003205160 6:4002353-4002375 GAAAGGAGACAGAGGGAAGGAGG - Intergenic
1004268901 6:14176306-14176328 AAAGGCTGACACAGTGAAGGTGG + Intergenic
1004741455 6:18465146-18465168 CAAAGTTGGCAAGGAGAAGGAGG - Exonic
1005750595 6:28878609-28878631 CAAAGTTGAGACAAAAAAGGGGG + Intergenic
1006174403 6:32113351-32113373 CAAAGTGGGCATAGGGCAGGAGG + Intronic
1006387590 6:33740011-33740033 CCAAGTTGACTCATGGAAGTCGG - Intronic
1008364765 6:50664918-50664940 TAAAGTCGACACAGGATAGGTGG - Intergenic
1008515096 6:52311316-52311338 AAAAGTTGGAACAGGGAAGCTGG + Intergenic
1010935505 6:81856153-81856175 CAAAGTTTTCACAGGGCTGGTGG + Intergenic
1012703561 6:102494221-102494243 AAAAGTGTACAAAGGGAAGGTGG - Intergenic
1013496940 6:110706916-110706938 CCAAATTGACAAAGGGAAAGAGG - Intronic
1013907785 6:115238071-115238093 CATAGTAGACACAGATAAGGGGG + Intergenic
1014886972 6:126793626-126793648 GAAAAGTGAGACAGGGAAGGAGG + Intergenic
1015426148 6:133070126-133070148 CACAGTTGAACCAGGGTAGGTGG + Intergenic
1015558704 6:134491467-134491489 CAAATTTGTGGCAGGGAAGGAGG - Intergenic
1015866067 6:137728018-137728040 CAAAGCAGAAAGAGGGAAGGAGG + Intergenic
1017045952 6:150347302-150347324 CAAAGTTGTCCCAGGAGAGGAGG - Intergenic
1021004012 7:15370991-15371013 CAAAGTTGACAAAAGCAATGGGG + Intronic
1022081364 7:27025041-27025063 CAAAAAAGAAACAGGGAAGGAGG - Intergenic
1023320966 7:38997143-38997165 CAAAGTCAACACAGAGCAGGTGG - Intronic
1023357027 7:39377635-39377657 CAAGGTTGACACAGCGAGGGGGG - Intronic
1023536033 7:41212085-41212107 CAATGTTGACAAAATGAAGGTGG - Intergenic
1024256074 7:47540871-47540893 CAAAGCAGTCACAAGGAAGGAGG + Intronic
1024263641 7:47590116-47590138 GAGAGATGACAGAGGGAAGGGGG - Intergenic
1024359909 7:48457332-48457354 TAAAGTTGAGAGAGGGGAGGAGG - Intronic
1025079514 7:55969531-55969553 CAATGATGACACAAGGAAGTAGG - Intronic
1025141808 7:56472818-56472840 AGAAGTTGACACGGGGAAGGAGG - Intergenic
1025611663 7:63080211-63080233 AGAAGTTGACACAGGGAAGGAGG + Intergenic
1025707953 7:63884270-63884292 AGAAGTTGACACGGGGAAGGAGG - Intergenic
1025779460 7:64587136-64587158 CAAAGCTGACAAGGGGAATGTGG - Intergenic
1027906948 7:84197144-84197166 TAATGTTGACACATGGAAGTTGG + Intronic
1029225267 7:99022410-99022432 CAGAGGTGAAACAGGGAAGGTGG + Intergenic
1029700900 7:102246297-102246319 CAAGGTAGCCCCAGGGAAGGGGG + Intronic
1030344523 7:108417389-108417411 CAAGAGAGACACAGGGAAGGGGG + Intronic
1030757206 7:113301585-113301607 CAGATTTGACATGGGGAAGGGGG - Intergenic
1030919862 7:115369377-115369399 CAAAGTTGACTAAGAAAAGGTGG + Intergenic
1031168375 7:118259758-118259780 CAAAGTTGACAGAGTCAAGAAGG - Intergenic
1034442372 7:151092486-151092508 CAGAGTTGAGGTAGGGAAGGGGG + Intronic
1035939835 8:3886786-3886808 CAAAGATTACAGAAGGAAGGAGG + Intronic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1036202129 8:6778670-6778692 CAAAATAGACTCAGGGAAGCAGG + Intergenic
1037321130 8:17644421-17644443 CAATGTTGACACATGCAGGGAGG + Exonic
1037384690 8:18325937-18325959 CAAAGGTGACAGAGAGAAGATGG - Intergenic
1038510728 8:28132180-28132202 CAAAGTTAACACAAGGAACAAGG - Intronic
1038680685 8:29664299-29664321 CAGACCTGACAAAGGGAAGGAGG - Intergenic
1042588944 8:70376127-70376149 AAAAGTAGAAACAGGGCAGGAGG + Intronic
1042823131 8:72953405-72953427 CAAAGGGGAAACAGAGAAGGTGG + Intergenic
1043591352 8:81836887-81836909 CACAGATCACATAGGGAAGGAGG - Intronic
1044262555 8:90144075-90144097 GAAAGTTGAAGCAGGGAAGGAGG + Intergenic
1044968777 8:97599516-97599538 CAAAGTTCTCACAAGGATGGAGG + Intergenic
1047462505 8:125080526-125080548 CAAAGTAGACAAGGAGAAGGGGG - Intronic
1048587096 8:135784185-135784207 GAATGGTGAGACAGGGAAGGAGG - Intergenic
1049082014 8:140450827-140450849 CAAACGGGACACAGAGAAGGGGG + Exonic
1049300678 8:141867811-141867833 CACAGAGGACACAGGGGAGGAGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049860714 8:144896655-144896677 CACAGTTCAGGCAGGGAAGGAGG + Intronic
1050431688 9:5568722-5568744 CACAGTTGTCTCAGGGAGGGAGG + Intronic
1050640307 9:7660509-7660531 CTAAGTTGGTACAGGAAAGGTGG + Intergenic
1050713665 9:8494938-8494960 CAAAGTGGAGACAGGACAGGAGG - Intronic
1051384641 9:16494640-16494662 CAAAGTTGAACAAGTGAAGGAGG + Intronic
1051663430 9:19446200-19446222 CGAAGGAGACACAGGAAAGGTGG + Intronic
1051685850 9:19657547-19657569 CAAAGAATACACAGGGAGGGTGG - Intronic
1054829349 9:69606449-69606471 CAAGGTTGACACAGTGAGTGAGG + Intronic
1057205538 9:93170019-93170041 AAAAGTTGAGCCAGGCAAGGTGG + Intergenic
1058874853 9:109235315-109235337 CTAAGTTTACAAAGGGAAAGGGG - Intronic
1061134849 9:128727908-128727930 CAAGGTTGCCACAGTAAAGGAGG - Intergenic
1061764628 9:132873996-132874018 CAAATCAGACACGGGGAAGGGGG + Intronic
1061927633 9:133813749-133813771 CAAAGTTGGCAGAGGGCAGATGG + Intronic
1062102422 9:134735430-134735452 CAAAATTGACCCAGCGAAAGAGG - Intronic
1186636386 X:11409492-11409514 CCAAGGTGACACTGTGAAGGTGG + Intronic
1186727322 X:12371147-12371169 CAAAGTTCAAATAGAGAAGGGGG - Intronic
1188138989 X:26525453-26525475 AAAAGCTGACACAGTGAAGGGGG + Intergenic
1192219264 X:69186123-69186145 CAATGTTGTCAGAGGGGAGGAGG + Intergenic
1193057446 X:77168581-77168603 AAAAGTTCACACAGGGAATGGGG + Intergenic
1194105107 X:89759047-89759069 CCAGCTTGACATAGGGAAGGAGG + Intergenic
1194336058 X:92647537-92647559 AAAATTGTACACAGGGAAGGAGG - Intergenic
1194699500 X:97096498-97096520 CACAGTTGCCACATGGAAGCTGG - Intronic
1195254739 X:103080793-103080815 CAAAGGTGAGAGAGGGATGGAGG - Intronic
1196239942 X:113331665-113331687 CATAGTTAACCCAGGGAATGGGG - Intergenic
1196811027 X:119629148-119629170 CAAAGGTGCCACAGGGATGCTGG + Intronic
1197003328 X:121466107-121466129 CAAAAATGAAACAGGGAAAGTGG - Intergenic
1197497257 X:127200190-127200212 CAAAGTTGACACAGGCAATGGGG - Intergenic
1200057830 X:153470770-153470792 CAGGGCGGACACAGGGAAGGGGG + Intronic
1200644490 Y:5764280-5764302 AAAATTGTACACAGGGAAGGAGG - Intergenic