ID: 1149970544

View in Genome Browser
Species Human (GRCh38)
Location 17:61213911-61213933
Sequence CTATAGAAATGTAGTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149970540_1149970544 12 Left 1149970540 17:61213876-61213898 CCTTTTGTATTTGTCCCAGGGTA 0: 1
1: 0
2: 3
3: 24
4: 278
Right 1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1149970542_1149970544 -3 Left 1149970542 17:61213891-61213913 CCAGGGTAGCAGAGAAGAGACTA 0: 1
1: 0
2: 3
3: 22
4: 247
Right 1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1149970541_1149970544 -2 Left 1149970541 17:61213890-61213912 CCCAGGGTAGCAGAGAAGAGACT 0: 1
1: 0
2: 2
3: 34
4: 223
Right 1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1149970539_1149970544 13 Left 1149970539 17:61213875-61213897 CCCTTTTGTATTTGTCCCAGGGT 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1149970536_1149970544 20 Left 1149970536 17:61213868-61213890 CCTTCTGCCCTTTTGTATTTGTC 0: 1
1: 0
2: 1
3: 38
4: 439
Right 1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149970544 Original CRISPR CTATAGAAATGTAGTGCAGA GGG Intronic
900750718 1:4395416-4395438 CAATAGAAATGTATTGCTCATGG - Intergenic
902136583 1:14311478-14311500 CTATAGAGATTTAGAGAAGATGG + Intergenic
902844146 1:19096304-19096326 CTATAGAGAGGTATTGGAGAAGG + Intronic
908686862 1:66730577-66730599 CTGTTGAAATGTATTGGAGAGGG - Intronic
908965777 1:69760658-69760680 CTATAAAAATATAGAGTAGAGGG + Intronic
909353447 1:74680119-74680141 CTATAAAAATGTTTTGGAGATGG - Intergenic
911661314 1:100504733-100504755 CTACAGAAATGCAGTACAGAGGG - Intronic
912192075 1:107352264-107352286 CTCTACTAAGGTAGTGCAGAGGG - Intronic
913400826 1:118430904-118430926 TTTTAGAAATGTTGTGTAGAAGG + Intergenic
914469036 1:147957703-147957725 CTATAGAAAAGTGTTGAAGAAGG - Intronic
915665660 1:157441880-157441902 ATGTAGACATGTAGTTCAGAAGG - Intergenic
917652552 1:177093256-177093278 ATCTAGAAAGCTAGTGCAGAAGG + Intronic
918336538 1:183520628-183520650 TTATAAAAATGTACTGCAGAAGG - Intronic
919518822 1:198561639-198561661 CTAGAGAAAAGAAGTTCAGATGG + Intergenic
920597689 1:207289475-207289497 CTAGAAAACTGAAGTGCAGAGGG + Intergenic
921418934 1:214923655-214923677 ATATAGAAATGTAGAGAAGGAGG + Intergenic
922298459 1:224273110-224273132 GTATAGAAATGTATGGCAGTAGG + Intronic
923936987 1:238773136-238773158 CTATAGACAAGTAGAGCAGCAGG - Intergenic
1067037577 10:42931600-42931622 TGATAGAAATGTTATGCAGACGG + Intergenic
1069755283 10:70771056-70771078 CTAGAGAACTGAAGGGCAGATGG - Intergenic
1070488254 10:76951446-76951468 CTATTGAAATGTAGGGGAGAAGG - Intronic
1075298249 10:121297015-121297037 CGATGAAAATGTAGAGCAGATGG + Intergenic
1081002998 11:37697348-37697370 TTTTAGAAATGTAGTGTATAAGG + Intergenic
1081561718 11:44223584-44223606 TTATAGAAATGGAGGACAGATGG + Intronic
1082232657 11:49787452-49787474 CTATTGATGTGCAGTGCAGATGG - Intergenic
1083028945 11:59574561-59574583 AGCCAGAAATGTAGTGCAGATGG + Exonic
1086895166 11:92303868-92303890 CTATTCAAATGTAGTTTAGAGGG + Intergenic
1087338666 11:96875448-96875470 CTAAAGAAATGTAGTAAAGTAGG - Intergenic
1089228942 11:116952652-116952674 GTAGAGAACAGTAGTGCAGATGG - Intronic
1090621349 11:128563775-128563797 CTACTGAAATGTGGGGCAGATGG - Intronic
1091405641 12:207759-207781 GTCTAGAAATGTAGTAAAGAAGG - Intronic
1094164048 12:27423663-27423685 CTACAGTAATGTAGTGGAGTGGG + Intronic
1098485235 12:71013467-71013489 CTATATAAATGTAGTCAACAAGG - Intergenic
1099607944 12:84828945-84828967 CTCTACTAGTGTAGTGCAGAAGG + Intergenic
1099685181 12:85877122-85877144 CAAAAGAAATGTAGTATAGAGGG + Intronic
1100029933 12:90174256-90174278 CATCAGAAATGTGGTGCAGATGG - Intergenic
1101507008 12:105356237-105356259 CTGGAGAATTGTAGTGTAGATGG + Intronic
1104451490 12:128872331-128872353 CCCTATAAATGCAGTGCAGAGGG + Intronic
1106006961 13:25779637-25779659 CTATCAATATGTAGGGCAGATGG + Intronic
1107684245 13:42880742-42880764 CCATAGAAGTGAAGTGCAGGAGG + Intergenic
1108021560 13:46132968-46132990 CTAGAAAAATGTAGTTAAGATGG + Intronic
1108232811 13:48367594-48367616 CTATAGACAGGTATTGCACATGG + Exonic
1108310721 13:49187153-49187175 CAATAAATATGTAGTGGAGATGG + Exonic
1109442841 13:62397821-62397843 TTAAAGAAAAGGAGTGCAGAAGG + Intergenic
1111201847 13:84948557-84948579 GTAGAGAAATGGAGTGCTGAGGG + Intergenic
1111968642 13:94886984-94887006 ATATACAAATGTAGATCAGAAGG - Intergenic
1112154670 13:96804277-96804299 ATAGAGAAATGTGGTGCAGATGG + Intronic
1113122428 13:106938289-106938311 CTATAGAACTGCAGTGGTGATGG + Intergenic
1119986409 14:79143072-79143094 CTATGAAAATACAGTGCAGAGGG - Intronic
1121217755 14:92261830-92261852 CTATAGAAATGAAATTCAGAGGG - Intergenic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1123166109 14:106326632-106326654 CTCTTGCAATGTAGTGCTGATGG - Intergenic
1202901337 14_GL000194v1_random:42285-42307 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1123961375 15:25404941-25404963 CAATAGGAATCTAGTGTAGATGG - Intronic
1128639648 15:69326781-69326803 TTATAGAAAAATTGTGCAGAAGG + Intronic
1133426241 16:5692611-5692633 CAATAGAAAAGTAATGCAGGAGG + Intergenic
1134784560 16:16929920-16929942 CTTTAGATTTGTAGTCCAGAGGG + Intergenic
1135217638 16:20586616-20586638 ATACAGAAATGTAGTGAAAAAGG + Intergenic
1135796350 16:25446549-25446571 CTACAGAAATTTAGTTCAGATGG - Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143004712 17:3822209-3822231 CTACAGCAATGCAGTGTAGAGGG + Intronic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG + Intronic
1150515746 17:65807839-65807861 CTCTAGTAAAGCAGTGCAGAGGG + Intronic
1151180520 17:72324199-72324221 TTATAGAAATCTAGGGCATAAGG - Intergenic
1153374466 18:4359668-4359690 CTATAGTAGTCTCGTGCAGAGGG - Intronic
1153892084 18:9526656-9526678 CTTTGGAAATGTAGTGATGAGGG + Intronic
1155625442 18:27829092-27829114 CTATAGTAAAGTAGGCCAGAAGG + Intergenic
1155692795 18:28647799-28647821 CAATAGAAATCTGGAGCAGAAGG - Intergenic
1155815871 18:30308950-30308972 CTACAGAAAAATAGTGTAGATGG + Intergenic
1156044920 18:32867354-32867376 TTATAGAAAAGAAGTGCAGACGG - Intergenic
1158278085 18:55790599-55790621 CTATAGAAATAGAGAGCAGGAGG + Intergenic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1165235371 19:34416575-34416597 CTACAGAAATGTAGAGGAAATGG + Intronic
927928575 2:27029501-27029523 CAATAGAAACGTAGTACAGTGGG + Intergenic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
929969489 2:46561807-46561829 CTAAAAAAATGCGGTGCAGAGGG - Intronic
932168786 2:69534459-69534481 CAATAGAAATCTAGTGAATAAGG + Intronic
933096299 2:78186889-78186911 CTATGGAAATGTAGTAAACATGG - Intergenic
933267577 2:80198880-80198902 CTTTAGAATTGCAGTGCATAGGG + Intronic
938154918 2:128927303-128927325 TTAAATAAATGTAATGCAGATGG - Intergenic
939547973 2:143577171-143577193 ATATTGAAATGTGGTGCAGATGG - Intronic
940555434 2:155221099-155221121 CTATAGAGATAAAGAGCAGAAGG + Intergenic
941498560 2:166239592-166239614 CAATGGAATTGAAGTGCAGAGGG + Intronic
944053171 2:195494552-195494574 CTATAAAAATGTAAAGCTGACGG - Intergenic
945720618 2:213414550-213414572 ATATAAAAATGTAGTGTTGAGGG + Intronic
1168937187 20:1675380-1675402 CTTTAGAAAGGTTCTGCAGATGG - Intergenic
1169770219 20:9191811-9191833 CTATAGAAATATATTCGAGATGG - Intronic
1176620712 21:9057063-9057085 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1176848330 21:13893785-13893807 CTCTACAAGTGCAGTGCAGAAGG + Intergenic
1177227288 21:18273687-18273709 CTATAGAATTCTTGCGCAGAAGG - Intronic
1178969703 21:37162208-37162230 CTATATAAATGTAATCAAGATGG - Intronic
1180900346 22:19367209-19367231 CTATGGAAAAATAGTTCAGATGG - Intronic
952190054 3:31013516-31013538 ATATATATATGTAGTGCATATGG - Intergenic
955091427 3:55755120-55755142 ATAAATAAATGAAGTGCAGATGG - Intronic
959090826 3:101900793-101900815 TCATAGAACTGTAGTTCAGAAGG + Intergenic
959999033 3:112711605-112711627 CTATAGAAAGCAGGTGCAGAAGG - Intergenic
961036090 3:123642614-123642636 CAATAGAAATGGAGGGCATAAGG - Intronic
962189896 3:133299498-133299520 CTATATAAACGTACTGCAGAAGG - Intronic
963097493 3:141560446-141560468 CCATTGAAATGTACTGTAGATGG + Intronic
965652885 3:170952130-170952152 CTACAGAAATGCAGGCCAGAAGG + Intergenic
965941838 3:174193656-174193678 CCATGGCAAAGTAGTGCAGATGG + Intronic
966587029 3:181637588-181637610 CAAGAGAAATGTAAAGCAGATGG + Intergenic
967468122 3:189831321-189831343 CTTTATAAATCTATTGCAGAGGG + Intronic
967568859 3:191003685-191003707 TAAAAGAAAAGTAGTGCAGAAGG - Intergenic
969155560 4:5206680-5206702 TTATGGAAATGTTTTGCAGATGG - Intronic
969294028 4:6258781-6258803 CTATTGAACTGAATTGCAGAAGG - Intergenic
971734993 4:30436800-30436822 CTATAGACATTTGGTGCAGCAGG + Intergenic
971752598 4:30669753-30669775 ATATATAAATGTAGTGATGAGGG - Intergenic
973119904 4:46509132-46509154 CTTTTGAAATATAGTGCATATGG + Intergenic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
975298450 4:72761838-72761860 CTATAGAAATATAATACATATGG - Intergenic
975520026 4:75290527-75290549 CTATGGAGATGTAAGGCAGAGGG - Intergenic
976073497 4:81270627-81270649 ATATAGACATATAGTGTAGAAGG - Intergenic
977061637 4:92265494-92265516 CTGAATAAATGTAATGCAGATGG - Intergenic
977289235 4:95145399-95145421 CTAGAGGAAGCTAGTGCAGAAGG + Intronic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
979252556 4:118580679-118580701 GTATAGAAATGGTGTGAAGATGG + Intergenic
979627044 4:122856878-122856900 TTATAGAAATGGAGAACAGATGG - Intronic
979827264 4:125254798-125254820 CTAGGGAAATATAATGCAGAAGG + Intergenic
980768565 4:137341015-137341037 GTACAGAAAAGTAGAGCAGAAGG - Intergenic
982038778 4:151373930-151373952 CTATAGGAATGTAGAGAAGCAGG - Intergenic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
983015552 4:162608042-162608064 CTCTACTAAGGTAGTGCAGAGGG + Intergenic
986107693 5:4675762-4675784 CTATAGAAATGAGTTGAAGAAGG + Intergenic
987632988 5:20500178-20500200 CTATAGAACTGTAGAAAAGAAGG - Intronic
989399562 5:40994209-40994231 CTATAGAAATGAACCACAGAGGG + Intergenic
990784906 5:59408457-59408479 CTCTACTAAGGTAGTGCAGAAGG + Intronic
993188828 5:84654788-84654810 CTATTGAAATGTGGTGCTGGTGG + Intergenic
994100578 5:95887189-95887211 TTATAGAGTTGTAGTGCAAAAGG + Exonic
994214973 5:97127526-97127548 CCAGACAAATGAAGTGCAGAGGG + Intronic
1001430240 5:171655163-171655185 CTATAGCTATCTAGTGCAGCAGG + Intergenic
1001825189 5:174739016-174739038 CTATAGAATCTTAGGGCAGAAGG + Intergenic
1003729352 6:8803786-8803808 ATATATATATATAGTGCAGAGGG - Intergenic
1005253004 6:23969015-23969037 TTTTAGAAATGTATTTCAGAAGG - Intergenic
1006189132 6:32196876-32196898 CTATAGAGAAGTTGAGCAGATGG - Intronic
1008117601 6:47570274-47570296 CTATAGAGATTTAATGAAGAAGG + Intronic
1010109339 6:72206842-72206864 CCACTGAAAGGTAGTGCAGATGG - Intronic
1011227545 6:85124465-85124487 CTATAGTAAAGTACTCCAGAAGG + Intergenic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1014991300 6:128080406-128080428 ATATAGAAATGCAGTGAAGATGG + Intronic
1016108197 6:140188647-140188669 CTCTAGTAAGGCAGTGCAGAAGG + Intergenic
1016725197 6:147357165-147357187 CTATAGGTATGTAGTCAAGAGGG + Intronic
1017329432 6:153178353-153178375 CTATGGAAATGAAGGGCTGATGG - Intergenic
1022176478 7:27876063-27876085 CTATGCAAATGTAGACCAGAAGG - Intronic
1023203602 7:37724447-37724469 CTAAAGAAATTCACTGCAGAAGG - Intronic
1024788925 7:52940183-52940205 CTATAAATATGTATTGGAGATGG + Intergenic
1029067471 7:97866204-97866226 CTATAAAAATGTAAAGCAAAGGG + Intronic
1029333570 7:99880684-99880706 GCATAGAAATGAAATGCAGAGGG + Intronic
1031606909 7:123780287-123780309 ATAGAGCAATGTAGTGCAGTGGG - Intergenic
1034782462 7:153893124-153893146 CAATAAAACTGTAGTGAAGAGGG + Intronic
1037280180 8:17232240-17232262 ATCTTGAAATGTAGTTCAGAAGG - Intronic
1037425330 8:18749314-18749336 CTATTGAAACGTAGTTCCGATGG - Intronic
1040354612 8:46605402-46605424 CTATAAAAATGTAAAGCAAAGGG + Intergenic
1042895973 8:73668159-73668181 CTGTAGACTTGTAGTGAAGAAGG - Intronic
1045357354 8:101401615-101401637 CTTCAGAAATGCAATGCAGATGG + Intergenic
1048092830 8:131259798-131259820 TTTTAGAAATGTAAGGCAGAGGG - Intergenic
1048856915 8:138693945-138693967 CTGTAGAAATGTAGCTCAGAGGG + Intronic
1050704177 9:8377639-8377661 CTAGAGAAATGTATTTCAGTTGG - Intronic
1051755217 9:20392277-20392299 AAATAGAAATATAGTTCAGAGGG - Intronic
1052383602 9:27799027-27799049 CTATAAAAATGTACAGCAAAGGG - Intergenic
1059818368 9:117944155-117944177 ATTTAGCAATTTAGTGCAGAAGG + Intergenic
1203743922 Un_GL000218v1:27506-27528 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1203566191 Un_KI270744v1:92029-92051 CTATAAAAATGTAAAGCAAAGGG + Intergenic
1186265583 X:7830196-7830218 CTATATATATGTACTGCAGAAGG + Intergenic
1194020191 X:88679855-88679877 CTATAGAAATGTATGACAGTAGG - Intergenic
1194974787 X:100383041-100383063 CTCTAGCAATGTACTGTAGAGGG - Intronic
1195051367 X:101099723-101099745 TGATAGAAATGAAGTGGAGATGG - Intronic
1195479286 X:105324223-105324245 GAATAGAAATGGAGTACAGAGGG + Intronic
1197428993 X:126336042-126336064 ATATAGATATGCTGTGCAGAAGG + Intergenic
1198112192 X:133511463-133511485 CTCTGGAAATGTATTTCAGATGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1201157245 Y:11142491-11142513 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1202268883 Y:23050705-23050727 CTCTACAAATGTAATGCACATGG + Intergenic
1202421875 Y:24684445-24684467 CTCTACAAATGTAATGCACATGG + Intergenic
1202448911 Y:24985633-24985655 CTCTACAAATGTAATGCACATGG - Intergenic