ID: 1149973487

View in Genome Browser
Species Human (GRCh38)
Location 17:61242545-61242567
Sequence ATGTCCTTCTAAATGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149973487_1149973490 7 Left 1149973487 17:61242545-61242567 CCTTCTCCCATTTAGAAGGACAT 0: 1
1: 0
2: 0
3: 18
4: 264
Right 1149973490 17:61242575-61242597 TGCAAATTTGCAAAAAGCTATGG 0: 1
1: 0
2: 0
3: 21
4: 279
1149973487_1149973491 19 Left 1149973487 17:61242545-61242567 CCTTCTCCCATTTAGAAGGACAT 0: 1
1: 0
2: 0
3: 18
4: 264
Right 1149973491 17:61242587-61242609 AAAAGCTATGGCAGAACCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149973487 Original CRISPR ATGTCCTTCTAAATGGGAGA AGG (reversed) Intronic
900963182 1:5938652-5938674 TTGTTTTTCTAAATGGGAAAAGG - Intronic
901537706 1:9893348-9893370 ATGTCATTACAAATGGGTGATGG - Intronic
902025207 1:13377970-13377992 GTGTCCTTCTCAATGTCAGAAGG - Intergenic
903947455 1:26972649-26972671 ATGTCCTCAGAAATGGGAGGAGG + Intergenic
907561749 1:55397215-55397237 AGATCCTATTAAATGGGAGAGGG - Intergenic
907660260 1:56385414-56385436 ATGTGCTTCTGACTGGCAGAGGG - Intergenic
907911469 1:58830895-58830917 ATGTGCTTTGAAATAGGAGACGG + Intergenic
909132273 1:71752652-71752674 ATTTCCTTCTAATGTGGAGAAGG - Intronic
909685380 1:78342228-78342250 ATGTGGTTCTCAATGGGAGTAGG + Intronic
910052456 1:82991578-82991600 TAGTCCTTGTAAAAGGGAGATGG - Intergenic
910589232 1:88911804-88911826 TTTTCTTTCTAAATGGGAAAGGG + Intergenic
911120752 1:94293910-94293932 CTAACCTTCTAACTGGGAGAGGG - Intergenic
911253136 1:95602128-95602150 ATGTACTTCTAAATGGCACATGG - Intergenic
913698126 1:121347663-121347685 ATGTCCTTCTAGCTTGTAGATGG - Intronic
914139423 1:144932389-144932411 ATGTCCTTCTAGCTTGTAGATGG + Intronic
915954767 1:160212637-160212659 AGGTTATTCTAAATGAGAGAAGG - Intronic
916339686 1:163717902-163717924 ATGACTTACAAAATGGGAGAAGG + Intergenic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
917124526 1:171674974-171674996 ATGCCCTACTTAATGGAAGAGGG - Intergenic
917839687 1:178967744-178967766 GGGTCCTTATAAGTGGGAGAGGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919273131 1:195376836-195376858 ATATCCTTTCAAATGCGAGAAGG + Intergenic
920189960 1:204187419-204187441 ATGTCTTTTAAAATGGAAGATGG + Intergenic
920485522 1:206366313-206366335 ATGTCCTTCTAGCTTGTAGATGG - Intronic
920965811 1:210699671-210699693 ATGTCATTGAAAATTGGAGATGG - Intronic
921659834 1:217788534-217788556 AGGTCCTTAAAAATGGAAGAGGG + Intronic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1066207995 10:33208584-33208606 ATCCCATTCCAAATGGGAGAAGG + Intronic
1066359869 10:34719681-34719703 ATGTCCTTTTGGAGGGGAGAAGG - Intronic
1067268984 10:44773372-44773394 AGGTCATTTTAAGTGGGAGAGGG - Intergenic
1068498515 10:57815860-57815882 ATGTCCTTCTAATTAGAAGAAGG - Intergenic
1068800528 10:61135309-61135331 ACGTGCTTCTAAATGGGGGAGGG + Intergenic
1071142803 10:82531274-82531296 ATGTCATTGGTAATGGGAGAAGG - Intronic
1071167062 10:82818810-82818832 ATGTTTTTCTAAATGGCAGGTGG - Intronic
1075689926 10:124387832-124387854 ATGTCCTGCTTCAGGGGAGAAGG - Intergenic
1078060244 11:8038694-8038716 ATGTCCTAATTAATGGGTGATGG + Exonic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078899264 11:15626315-15626337 AGGTCCTTAAAAATGGAAGAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083708120 11:64530553-64530575 GTGTCCTTCTAAGAGGGAGGTGG + Intergenic
1086536419 11:87852238-87852260 ATGACCTACTCTATGGGAGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087644332 11:100789739-100789761 ATGACCTTCTGTAAGGGAGATGG - Intronic
1087730562 11:101773829-101773851 ATGACATTCTTAATGGGACAGGG + Intronic
1088268595 11:108010475-108010497 ATCACCTTTTAAAAGGGAGAGGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090363869 11:126190523-126190545 ATGGCCTTGGAAATGGGAGGGGG - Intergenic
1090906225 11:131076833-131076855 ACATCCTTATAAGTGGGAGATGG - Intergenic
1093390938 12:18620090-18620112 ATATCCTTCTCAATTGGACATGG - Intronic
1095107288 12:38249862-38249884 AGGCCCTTAAAAATGGGAGATGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098463160 12:70756266-70756288 GTGTCTTTCTAACTGGGAGTGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102416912 12:112771451-112771473 ATGTCCATCTAAAGGGGACTGGG - Intronic
1102876044 12:116449551-116449573 ATGTCCGCCCACATGGGAGAAGG - Intergenic
1105647818 13:22339745-22339767 TTGTGTTTTTAAATGGGAGAAGG + Intergenic
1105962901 13:25358252-25358274 ATGGCATTCAAAATGGGCGAGGG + Intergenic
1107045827 13:35991106-35991128 ATGACCTGCTTCATGGGAGAAGG - Intronic
1107220673 13:37975592-37975614 ATGTACTTTTAAAAGGAAGAGGG + Intergenic
1107606641 13:42064043-42064065 ATGTCCTTATATATGCGAGATGG + Intronic
1107691784 13:42960848-42960870 AGGTCCTTAAAATTGGGAGAGGG - Intronic
1109140333 13:58706893-58706915 ATGGGCTTGTAAATAGGAGATGG - Intergenic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110372618 13:74756678-74756700 TTGCCCTTCTACATGGCAGAAGG + Intergenic
1111134897 13:84028339-84028361 ATGGCCTGCTTCATGGGAGAAGG - Intergenic
1113013863 13:105805146-105805168 CTGTCCCTCTAGATGGGGGAAGG + Intergenic
1116115669 14:40646920-40646942 ATGTCCTTCTTAACGGTACATGG + Intergenic
1116402912 14:44531048-44531070 ATGTCCTTATAAGTAGGAAAGGG + Intergenic
1117346442 14:54837512-54837534 ATGTACTTCCTAATGGTAGAAGG - Intergenic
1118255546 14:64202172-64202194 CTGTCCGTCTAAAAGGGAGGGGG - Intronic
1124016023 15:25876720-25876742 CTGTCTTTCTAAAATGGAGATGG - Intergenic
1124876579 15:33600648-33600670 TTCTCCTTCTAGATGGGAGAAGG + Intronic
1125282833 15:38061058-38061080 ATTTCACTCTAAATTGGAGACGG + Intergenic
1125468022 15:39974138-39974160 ATGGACTTCAAACTGGGAGATGG + Intronic
1126378803 15:48024642-48024664 CTTTTCTTCTAAATGGGAAAGGG + Intergenic
1126561839 15:50052518-50052540 ATGTGCTTCCAAGAGGGAGAAGG + Intronic
1126945216 15:53811874-53811896 ATTTCCTTATATATGTGAGACGG + Intergenic
1127375132 15:58377280-58377302 GAGTCCTTATAAATGGAAGAAGG + Intronic
1128429730 15:67580013-67580035 ATGTCCACCTAACTTGGAGATGG - Intronic
1128645187 15:69373147-69373169 AGGTCCTTAAAAATGGAAGATGG - Intronic
1129855732 15:78823521-78823543 ATGTCCTTCTGAAGGGAGGAAGG + Intronic
1129960217 15:79677472-79677494 ATTTCCTGCCAAATGGGACATGG + Intergenic
1131115127 15:89790757-89790779 TTTTCCTTCCAAATGGGAAAAGG + Intronic
1131294775 15:91137326-91137348 GTGTGATTCTAAATGTGAGATGG + Intronic
1132152354 15:99471490-99471512 ATGCCCTTCTACATTGGGGAGGG - Intergenic
1133647785 16:7780634-7780656 ATGTCCTTAAAAAAGGAAGAAGG - Intergenic
1135097188 16:19574323-19574345 AAGTCTTCCTAAATGGGAGGGGG - Intronic
1135912489 16:26574087-26574109 AAGTCCTTGTAAGTAGGAGAGGG + Intergenic
1138825177 16:60310029-60310051 GGGTCTTTATAAATGGGAGAGGG + Intergenic
1139828314 16:69775310-69775332 ATGACCTGCTTTATGGGAGAAGG + Intronic
1140414903 16:74767542-74767564 GTGTACTTCTAAGTGGAAGATGG + Intronic
1140739662 16:77930060-77930082 AGGTCCTTCTAAAAGGGATAAGG - Intronic
1146510293 17:33441616-33441638 ATGACCTGCTTCATGGGAGAAGG - Intronic
1149973487 17:61242545-61242567 ATGTCCTTCTAAATGGGAGAAGG - Intronic
1151041520 17:70866500-70866522 GTGTGCTTCAAAATGGGAAATGG - Intergenic
1151204230 17:72493713-72493735 GAGTCCTTCCAAATTGGAGATGG - Intergenic
1151623591 17:75262327-75262349 ATGTCCTCCTACTTGGGACAAGG + Intronic
1153297413 18:3560653-3560675 ATTTTTTTCTAAATGGGAAAAGG + Intronic
1153943517 18:9997500-9997522 AAGACCCTCTACATGGGAGAAGG + Intergenic
1156854106 18:41762238-41762260 ATATCCTTTTATATGGGAAAAGG - Intergenic
1157783964 18:50465527-50465549 ATTTGCTTCTAAGTGGTAGAAGG + Intergenic
1158334650 18:56402732-56402754 ATGTCCTTATGAAACGGAGAAGG + Intergenic
1162760120 19:12884039-12884061 ACATCCAGCTAAATGGGAGATGG - Intergenic
1164422102 19:28103446-28103468 ATGTCCTTCTAGAGCTGAGATGG + Intergenic
1165327821 19:35124562-35124584 GTGCCCTTCTAGATGGGCGACGG - Exonic
928601511 2:32908493-32908515 ATGTCCATCTAGATGGGAAGGGG - Intergenic
929058851 2:37903073-37903095 ATGCCCTTCTTCATAGGAGATGG + Intergenic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
929856355 2:45641736-45641758 ATGTCCTTGAAACTAGGAGAAGG + Intergenic
930473386 2:51848983-51849005 ATGTTCTTTTAAATGGGACTAGG + Intergenic
930823724 2:55674750-55674772 ATTGCATTCCAAATGGGAGAGGG + Intronic
930885161 2:56317079-56317101 ATGTACCTGTAAATGGAAGATGG + Intronic
931843279 2:66176945-66176967 ATGGCATTCTTGATGGGAGAGGG - Intergenic
932390035 2:71380092-71380114 ATGTCTTTATAAATAGGAAAAGG + Intronic
934880503 2:97972740-97972762 ATGTCCTTAAAAGTGGAAGAGGG + Intronic
935174918 2:100641325-100641347 GTGTCCTTCTAAGCCGGAGATGG + Intergenic
936620658 2:114093889-114093911 CTGTCCTTCCACATGGGGGAAGG - Intergenic
937661750 2:124437871-124437893 ATGTCCATATAAACTGGAGAGGG - Intronic
939021404 2:136962057-136962079 ATGTCCTTATGAGTGGAAGAGGG + Intronic
939210352 2:139166863-139166885 ATGTGCTTCTATACGGGGGATGG - Intergenic
939669612 2:144993987-144994009 GGGTACTTCTAAAGGGGAGATGG + Intergenic
939900775 2:147846601-147846623 ATGTCTGTTTAAATGGAAGAAGG + Intronic
941830404 2:169952099-169952121 AAATCCTTGTATATGGGAGAAGG + Intronic
942212351 2:173684332-173684354 ATCTGCTTATAAATGGGAAAAGG + Intergenic
942570354 2:177307933-177307955 ATATCCTTCTCCAGGGGAGAAGG + Intronic
942604338 2:177674514-177674536 ATGTCCTTATAAGAGGGAGCAGG - Intronic
942770418 2:179511313-179511335 AAGGCCTTCTAAATGGCAGATGG + Intronic
944492545 2:200272613-200272635 ATGTCCCTCTACATTGAAGAGGG + Intergenic
944919889 2:204401962-204401984 GAGTCCTTATAAATGGAAGAAGG - Intergenic
944955385 2:204801808-204801830 ATATCATACTAAATGGGAAAAGG - Intronic
945082023 2:206095681-206095703 ATGTCCTACAAAATGTGAAAAGG - Intergenic
945889631 2:215414853-215414875 ATGTACTTGGAAATGTGAGATGG + Exonic
946762647 2:223010118-223010140 TTGTCCTTCATAATGGGAGTGGG - Intergenic
946988243 2:225299201-225299223 ATGCCCTTCCAAATGGAAGCTGG - Intergenic
947641864 2:231711330-231711352 AAGTCCTTCAAAAGGGAAGAAGG - Exonic
948251979 2:236536569-236536591 ATGTCTTTCTATCTGGGGGAGGG + Intergenic
948489886 2:238305780-238305802 ATGTCCTTATAAGTGAAAGAGGG + Intergenic
1170185203 20:13581509-13581531 ATGTCCTTCAAATTGGGTAAGGG + Intronic
1170814664 20:19703416-19703438 ATGTCCTTCTATGTGTCAGATGG - Intronic
1173383796 20:42570082-42570104 ATGTCCTTCCAAAGGACAGAGGG - Intronic
1176929505 21:14791379-14791401 TTGTTACTCTAAATGGGAGAAGG + Intergenic
1177420704 21:20853143-20853165 GTGTCCTTATAAGAGGGAGACGG - Intergenic
1179034454 21:37747608-37747630 GAGTCCTTTTAAGTGGGAGAGGG + Intronic
1181811060 22:25404409-25404431 ATGTTCTTTTAATTTGGAGATGG - Intronic
1183978035 22:41524459-41524481 ATGTCTTGCTAAATGGGTGAAGG + Intronic
1184241963 22:43215781-43215803 ATGTCTTTCTGGATGGGAGCTGG + Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951449015 3:22815574-22815596 AGGGCCTTATTAATGGGAGAGGG - Intergenic
951597870 3:24337528-24337550 ATCTTATTCTAAAGGGGAGATGG + Intronic
952042348 3:29276477-29276499 ATGTCCTTCTTAAAGATAGAAGG + Intergenic
952887842 3:38022399-38022421 ATGTCCCTCTAAAGCTGAGAGGG + Intronic
955610577 3:60752486-60752508 ATGTCCTTTTCAATCAGAGAGGG - Intronic
955888384 3:63624498-63624520 ATGTCCTTAAAAGTGGAAGAGGG - Intergenic
955897636 3:63717571-63717593 ATGTTCTTATGAATGGAAGAGGG - Intergenic
956411680 3:68986058-68986080 ATTTCCTTAAAAGTGGGAGAGGG - Intronic
958665101 3:97127390-97127412 ATGACCTGCTTCATGGGAGAAGG + Intronic
958796787 3:98714403-98714425 ATCACCTTCTAACTGGAAGAGGG + Intergenic
958864275 3:99482928-99482950 ATGTCCTTCTTTAGGGGAAAAGG - Intergenic
958980328 3:100711437-100711459 ATGTCCTTCTGACTGGGGTACGG - Intronic
959927722 3:111942668-111942690 AAGTGCTTCTAAATGCAAGAAGG + Intronic
960338450 3:116445989-116446011 ATGTCCTGAAAGATGGGAGAAGG + Intronic
962844144 3:139260534-139260556 TTGTCCTTCTAAATCACAGAGGG + Intronic
963622490 3:147629091-147629113 ATGGCCTTCTAGATGGAAGAGGG - Intergenic
963815318 3:149824388-149824410 GTGTCCTTAAAAATGGAAGAGGG + Intronic
963936416 3:151058581-151058603 ATTGTCTTCTAAATGGGTGATGG + Intergenic
964561817 3:158005392-158005414 CTGTCCTTTTAAAGAGGAGAAGG - Intergenic
964788462 3:160426799-160426821 ATGTGCATCTTAATGGGAGAAGG + Intronic
965815871 3:172636119-172636141 ATGTCCCCCAAAATTGGAGAAGG - Intronic
966203257 3:177378915-177378937 TTGTGCTTCTGAAGGGGAGAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967512804 3:190332011-190332033 GTGTCCTTATAAATGTCAGAAGG - Intronic
967558358 3:190887178-190887200 ATGTCCTTCTCTATGGGCTAAGG + Intronic
969823615 4:9739463-9739485 ATGTGCATCTAACAGGGAGAGGG + Intergenic
969833339 4:9817123-9817145 AGGTCCTTATAAAAGGGAGGTGG - Intronic
970253787 4:14145678-14145700 TTGCCCTTCTCAATGGGAGTTGG - Intergenic
974449556 4:62035434-62035456 ATTTCCTTCTAGATGAGAAAGGG - Intronic
974821209 4:67068516-67068538 ATTTCCTTCTAATTGGGGGGAGG - Intergenic
975359038 4:73445178-73445200 GTCTCATTCTAAAAGGGAGAAGG + Intronic
975455338 4:74583908-74583930 ATGTTTTTCTAAATGGAAGTAGG - Intergenic
976530687 4:86149141-86149163 ATGAGATTCTAAATGAGAGAAGG - Intronic
976957612 4:90921153-90921175 TTGTATTTCTAAATGGTAGATGG - Intronic
977285531 4:95101494-95101516 AAGTACTTCTAAAAGGGGGAAGG - Intronic
980942570 4:139288488-139288510 AGGTCCCTATAAGTGGGAGAGGG - Intronic
984657157 4:182330479-182330501 ATGTCCTGCTTCAGGGGAGAAGG + Intronic
986846645 5:11764076-11764098 GGGTCCTTATAAATGGAAGAGGG + Intronic
986967554 5:13293122-13293144 AAGTCCTTCTAACTGGTAAATGG - Intergenic
987068837 5:14316758-14316780 ATGCCCTTCTGCATGGGAAATGG + Intronic
987473424 5:18360647-18360669 ATGGGATTATAAATGGGAGAGGG + Intergenic
987682177 5:21151221-21151243 ATGTCCTTCTTTATGAGGGATGG + Intergenic
988669647 5:33367377-33367399 ATTTCTTTCAAAATTGGAGACGG + Intergenic
988799239 5:34680738-34680760 AAGTCTTCCTAAATGGGAGCAGG - Intronic
989314501 5:40061970-40061992 ATGTCCACCTACATTGGAGAAGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990324747 5:54663569-54663591 ATGTCCTTCTAAATGCAAAGTGG + Intergenic
990868712 5:60407840-60407862 CCGCCCTTCTAAATGGGAGGAGG - Intronic
991114011 5:62932984-62933006 ATGTCCTTCAAAAAGAGACAAGG + Intergenic
992948924 5:81837740-81837762 ATCTCCTTCATACTGGGAGATGG - Intergenic
994639580 5:102390165-102390187 ATGTATTTTTGAATGGGAGAGGG - Intronic
995051965 5:107717009-107717031 CTGGCCTTCTATGTGGGAGAAGG + Intergenic
996739664 5:126787334-126787356 ATTTGCTTCTAAATGGAAAATGG + Intronic
997726695 5:136126833-136126855 CTGTTCTTCTAAATGGTAGATGG + Intergenic
1000186203 5:158860597-158860619 TTGTCCTTCTAAAAGTGAAAAGG - Intronic
1000237423 5:159375691-159375713 CTGTCCTTTCAAGTGGGAGAAGG - Intergenic
1001963472 5:175894543-175894565 ATGTCCTTCCACATGGAACAAGG + Intergenic
1002423545 5:179162964-179162986 ATATGCTTCTCAGTGGGAGAAGG + Intronic
1002972426 6:2037473-2037495 ATGTCCCTCACAATGGGGGAGGG + Intronic
1004927020 6:20425698-20425720 ATTTTCTTCTAAAAGGTAGAAGG - Intronic
1005067035 6:21828465-21828487 ATGTCCTACTAAAAGGTAAAAGG - Intergenic
1006689346 6:35867434-35867456 ATATGCTTTTAAATGGGACATGG - Intronic
1009820986 6:68800871-68800893 AAGTCTATCTAAATGGGAGGAGG + Intronic
1010335585 6:74679200-74679222 TTGTTTTTCTAAATGGGAAAAGG - Intergenic
1013407097 6:109853001-109853023 ATGACCTGCTTCATGGGAGAAGG - Intergenic
1013620565 6:111884280-111884302 ATGCCCTTCTACATTAGAGAGGG + Intergenic
1014407969 6:121075061-121075083 ATGTTTTTCTAAATGTGTGATGG - Intergenic
1016368746 6:143347929-143347951 TTGTCCGTTTAAATGGTAGAGGG + Intergenic
1016486865 6:144550162-144550184 ACTTCCTTCTAAATGGCATAAGG - Intronic
1016758658 6:147714497-147714519 AGGTCCTTCTACCTGGAAGAGGG + Intronic
1017468697 6:154718908-154718930 AAGTCCTTATAAATGAAAGAGGG + Intergenic
1017611053 6:156186589-156186611 ATGGCCTGCTTAAGGGGAGAAGG - Intergenic
1018882126 6:167894494-167894516 CTGTCCTTCTAATTTGGAGAGGG + Intronic
1020801834 7:12741647-12741669 GTGTCCTTATAAAAGGGAGGTGG + Intergenic
1020817534 7:12923971-12923993 ATGTCGTTCTACCTGGGAGTGGG + Intergenic
1021379203 7:19946557-19946579 ATGTCCATCAAGATGGGACATGG - Intergenic
1021901227 7:25287841-25287863 ATGGCCTGCTTCATGGGAGAAGG + Intergenic
1022486538 7:30783230-30783252 ATGTCCTTTAAAATGGAAGAAGG - Intronic
1023109199 7:36793030-36793052 ATTTCCTTATAAGTGAGAGATGG + Intergenic
1023688260 7:42759686-42759708 TTTTTCTTCTAAATGGGAAAAGG + Intergenic
1028124235 7:87093639-87093661 ATGTAAGTCTATATGGGAGATGG - Intergenic
1028705060 7:93832502-93832524 ATTTCCTTCTATTTTGGAGATGG - Intronic
1028978211 7:96937587-96937609 ATGTCCACCTACATGGGTGAGGG + Intergenic
1029183342 7:98720459-98720481 CTGTCCTTATAAGTAGGAGACGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029859307 7:103552265-103552287 ATGTTCATCTCAATTGGAGAGGG - Intronic
1029861672 7:103579176-103579198 ATGTCCTTCTTAATGGTTGTCGG - Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031632505 7:124061699-124061721 ATGTCCTTAAAAGTGGAAGAGGG - Intergenic
1031738094 7:125392797-125392819 ATGTAGTTCTAAATGGTAGATGG + Intergenic
1032668006 7:134056506-134056528 AAAACCTTCAAAATGGGAGAAGG + Intronic
1032977996 7:137247826-137247848 ATTTCCTTTGAAATAGGAGAAGG - Intronic
1033707521 7:143903484-143903506 AGGTCCTTCTAAGTGAAAGAAGG - Intergenic
1035796753 8:2364580-2364602 ATGTTCTTCTACATGGCAGCAGG - Intergenic
1035913205 8:3592499-3592521 TTGTCCTTGTAAAATGGAGATGG + Intronic
1036098651 8:5753279-5753301 ATGTCCTGGTAAATTGGATAAGG - Intergenic
1041013942 8:53571938-53571960 TTGTATTTCGAAATGGGAGAAGG + Intergenic
1041961408 8:63621173-63621195 TTTTCCTTCTTAATGGGGGATGG + Intergenic
1042613161 8:70619829-70619851 AAGTCCTTCTAATTTGGGGAAGG - Intronic
1043310783 8:78856931-78856953 ATGTCCTTCAGAAAGGCAGATGG + Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044543193 8:93430555-93430577 AGTTCCTTCAAAAAGGGAGAAGG + Intergenic
1044801664 8:95963485-95963507 ATCTACTTTTAAATGGGAGATGG - Intergenic
1045542016 8:103095538-103095560 ATGGCCTGCTTCATGGGAGAAGG + Intergenic
1046261105 8:111768850-111768872 ATGACTTTCTGAATGAGAGAAGG + Intergenic
1046974864 8:120263082-120263104 ATATTTTTCTAAATGGGATAAGG - Intronic
1047867163 8:129038338-129038360 ATGTCCTTCAAAAGGTGAGCAGG + Intergenic
1049920187 9:355942-355964 ATTTTTTTCTAAATGGGGGAAGG - Intronic
1050042755 9:1513233-1513255 AGGTCCTTCCAAATGGGCGTCGG + Intergenic
1050506213 9:6352051-6352073 ATGACCTGCTTGATGGGAGAAGG - Intergenic
1050514260 9:6426394-6426416 ATGTGCTCCTAAATGGGGAAAGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050773426 9:9232950-9232972 TTGTTCTTCTATATAGGAGATGG + Intronic
1052280600 9:26729174-26729196 ATGTCCTTTTAAGAGGGAGTTGG - Intergenic
1052472922 9:28922929-28922951 ATGTCTTTATAAAAGGGAGGTGG + Intergenic
1052621340 9:30913691-30913713 ATCTCCTACTAAATTGGAGTGGG - Intergenic
1053119999 9:35539197-35539219 TTGTCTTTCCAAAAGGGAGAGGG + Intronic
1054978392 9:71174981-71175003 ATGTCCTTATAACTGTGGGAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057608322 9:96518026-96518048 CTGCCCTTCCAAATGGGAGGAGG - Intronic
1059378447 9:113904853-113904875 GGGTCCTTCTAAGTGGAAGAGGG - Intronic
1060478254 9:124000683-124000705 AAATCCTTCTAAATTGGAGGAGG - Intergenic
1186131429 X:6470151-6470173 GGGTCCTTCATAATGGGAGAGGG + Intergenic
1189791735 X:44611463-44611485 ATGTCTTGCAAAATGGCAGATGG + Intergenic
1191862709 X:65678966-65678988 ATGCCATTCTAAATGGGAAAAGG - Intronic
1194804595 X:98311754-98311776 ATGTCCTGTAAAATGGAAGAGGG + Intergenic
1194819866 X:98491981-98492003 CTTTCCTTCCAAATGGAAGATGG - Intergenic
1194918518 X:99734429-99734451 ATGTTTTTCTGAAAGGGAGAAGG - Intergenic
1196249168 X:113438386-113438408 ATCTCCTTTTAAATGGGTAAAGG + Intergenic
1196628778 X:117910728-117910750 ATGTCTTTCTTAAGGGCAGAGGG + Intronic
1197609319 X:128621489-128621511 ATGTAGGTCAAAATGGGAGAAGG - Intergenic
1197957963 X:131973431-131973453 ATGTCCTTGAATAGGGGAGAGGG + Intergenic
1198131969 X:133704717-133704739 ATGACCTGCTTCATGGGAGAAGG + Intronic
1198947216 X:142028395-142028417 TTGTCCTTTGAAATGTGAGAAGG + Intergenic