ID: 1149974084

View in Genome Browser
Species Human (GRCh38)
Location 17:61248577-61248599
Sequence TTTGTGCTTCCTCAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149974080_1149974084 0 Left 1149974080 17:61248554-61248576 CCATCTGGTGAGAATTTGTCTGG 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1149974084 17:61248577-61248599 TTTGTGCTTCCTCAGCAGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149974084 Original CRISPR TTTGTGCTTCCTCAGCAGGG AGG Intronic
900911446 1:5599648-5599670 TTTGTTCTCACTCAGCAGGGCGG + Intergenic
902197203 1:14806469-14806491 TTTGGGCTTTCTCAGCCGGATGG + Intronic
902603181 1:17553891-17553913 TTTTTGCCTACTCAACAGGGAGG + Intronic
903238047 1:21963570-21963592 TTTGTGCTTCCACAGCTCTGCGG - Intergenic
907884934 1:58584324-58584346 TTTGTGCTTGCTCATTTGGGTGG + Intergenic
908277830 1:62494498-62494520 TATGTGCTTCCCAAGCTGGGAGG + Intronic
911056373 1:93711791-93711813 TAGGTGCTTCCTTAGCAGTGAGG - Intronic
911561979 1:99417755-99417777 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
913615619 1:120557470-120557492 TTTGTGCTTGCTAAGTCGGGTGG + Intergenic
914574657 1:148953432-148953454 TTTGTGCTTGCTAAGTCGGGTGG - Intronic
915821734 1:159031249-159031271 TGCTTGCTTTCTCAGCAGGGAGG - Intronic
916070859 1:161168975-161168997 TCTTTGCTTCCTCTGCAGGGCGG + Exonic
916074959 1:161195339-161195361 AGTGTGCTTCCTCTGCAGTGTGG - Intronic
917106153 1:171493977-171493999 TTTTTACTTCCTCACCTGGGTGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918091445 1:181298470-181298492 TTAGAGCATCCTCAGCAGGAAGG + Intergenic
918142686 1:181732431-181732453 CATGTGCTTCCTCAGCTGGCTGG - Exonic
919757382 1:201074482-201074504 TGAGTGCTTCCTTAGCAGGAAGG - Intronic
921364569 1:214361521-214361543 TTTGTGCTTCCTTGGCTTGGGGG - Intronic
922218503 1:223539937-223539959 TCTGTGCTTTCCCAGCAGAGAGG - Intronic
922762695 1:228142477-228142499 TTACTGCTCCCTCAGGAGGGAGG + Intronic
922762836 1:228143070-228143092 TTAGCGCTCCCTCAGGAGGGAGG + Intronic
922907633 1:229186595-229186617 GTTGTGCTTCCTCAGCTCTGAGG - Intergenic
923328583 1:232901856-232901878 TCAGTGATTCCTCAGCAAGGAGG + Intergenic
924250542 1:242128702-242128724 TCTGTGCTCCCTGGGCAGGGAGG - Intronic
924691430 1:246355508-246355530 TGCCTGCTTGCTCAGCAGGGAGG + Intronic
1064428578 10:15252156-15252178 TCTGTGCTTTCTCAGCAGCTGGG + Intronic
1064868054 10:19904562-19904584 TGCTTGCTTTCTCAGCAGGGAGG - Intronic
1066335481 10:34473360-34473382 TTTGTTCTTTCTCATCAGCGTGG - Intronic
1066787650 10:39023341-39023363 TTTGTGCTGATTCAGCAGGCTGG - Intergenic
1066793693 10:39095034-39095056 TTTCTTCTTACTCAGCAGGTTGG + Intergenic
1072381807 10:94879851-94879873 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1072994803 10:100233367-100233389 TTTGTGCTATTTCTGCAGGGAGG - Exonic
1074277150 10:112014344-112014366 TTTGTTCTTCCTCTGGAGGCAGG - Intergenic
1074858700 10:117492719-117492741 TGTGTGCTTGCTCATCAGTGAGG + Intergenic
1077959015 11:7052762-7052784 TTTTTGCTTCTTCAGGAGTGAGG + Intronic
1078489420 11:11755442-11755464 TCTGTGCTGCCTCAGCGGTGAGG + Intergenic
1078615658 11:12863281-12863303 TTTGTGCTGACTCAGCAGCCAGG - Intronic
1078928613 11:15896098-15896120 TTGGTGCTTCCCCAGTATGGGGG - Intergenic
1081469088 11:43352988-43353010 TATGTGCTTCCTCAGTAGGTGGG + Intergenic
1083225265 11:61280958-61280980 TCTGAGGTTCCCCAGCAGGGAGG + Exonic
1083274120 11:61587364-61587386 TCTGTGCAGCCTCAGCTGGGCGG - Intergenic
1083401556 11:62426633-62426655 AATGTGATGCCTCAGCAGGGAGG - Intergenic
1085975499 11:81648338-81648360 ACTGTGATTCCTCAGCGGGGAGG - Intergenic
1086743097 11:90391914-90391936 GGCTTGCTTCCTCAGCAGGGAGG + Intergenic
1090682578 11:129077366-129077388 TGCGTGTTTTCTCAGCAGGGAGG + Intronic
1090969024 11:131623734-131623756 TGTGTGCTTCCTCCCAAGGGAGG - Intronic
1091690661 12:2595105-2595127 TTGGTGCTTCTGCAGCAGGAGGG + Intronic
1093421438 12:18978906-18978928 TTCCTACTTCCTCAGCACGGGGG + Intergenic
1093431809 12:19093286-19093308 TTTGTTTCTCCTCAGCAGGGAGG - Intergenic
1094533583 12:31300887-31300909 TTTGTCCTTGCTGAGAAGGGAGG - Intronic
1094822036 12:34233582-34233604 TTTCTCCTCTCTCAGCAGGGTGG + Intergenic
1096100052 12:48965416-48965438 TTTTTCCTTCTTCAGCAGGAAGG - Exonic
1097104690 12:56615089-56615111 TTTCTGCTGCCTCATCAGGATGG + Exonic
1097302588 12:58034527-58034549 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1097607095 12:61768911-61768933 TGCCTGCTTTCTCAGCAGGGAGG + Intronic
1097828977 12:64203860-64203882 TTTTAGCTTCCTCAGCTGGAAGG - Intronic
1099526958 12:83727784-83727806 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1099827180 12:87791826-87791848 TTTATTCTTCCTTAACAGGGAGG + Intergenic
1100036441 12:90258206-90258228 TTTGTGCTTCCTAAACAAGGAGG - Intergenic
1100400365 12:94224122-94224144 TTTTTGCTTCCTCTGCATAGTGG - Intronic
1102347878 12:112171118-112171140 TTTGGCCTCCTTCAGCAGGGCGG + Exonic
1103581190 12:121916821-121916843 ACTGTGCTTCCTCAGCAGCTGGG + Exonic
1104617784 12:130284894-130284916 TTTGTGATTCCCCTGCGGGGTGG + Intergenic
1107684237 13:42880677-42880699 TTTGTGCTAGCCAAGCAGGGAGG - Intergenic
1108188907 13:47917241-47917263 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1108816891 13:54303971-54303993 TGTTTGCTTCCTCAGCATGTAGG - Intergenic
1110417835 13:75271092-75271114 TTTGTTCTTCCTGAGCCTGGAGG - Intergenic
1111225549 13:85266486-85266508 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1116045203 14:39734514-39734536 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1121340780 14:93103887-93103909 TTGCTGCTTCCTGGGCAGGGCGG - Intronic
1122320980 14:100855592-100855614 TTTCAGCTTCCTCCACAGGGTGG + Intergenic
1122762356 14:104038606-104038628 TTTGGGTGTCCTCAGCATGGTGG + Intronic
1125001107 15:34770755-34770777 TTTGTGCTCCCTCAGCACCCTGG + Intergenic
1125482830 15:40092392-40092414 TTTTTGCTGCCTCAGCAGTGTGG - Intronic
1125514643 15:40311207-40311229 TCTGTGCCTCATCAGCTGGGGGG - Intergenic
1126184873 15:45821968-45821990 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1127249573 15:57217883-57217905 TTTGTGGTCTCTCAGGAGGGAGG + Intronic
1127498133 15:59531475-59531497 TTTCTGCTTCCTCTCTAGGGTGG + Intergenic
1128663991 15:69524995-69525017 ATGGGGCTTCCTCAGCTGGGTGG + Intergenic
1129959464 15:79670008-79670030 TTTTTAATTCCTCAGGAGGGAGG + Intergenic
1131032129 15:89195247-89195269 TTTGTGCTGCCTCTGCATGGGGG + Exonic
1138796446 16:59975342-59975364 CTTGTACTTCCTCAGCACAGTGG + Intergenic
1139038289 16:62974449-62974471 TTTGTGCTCCCTCTGCCTGGGGG - Intergenic
1139159161 16:64482114-64482136 TTTGTGGTTCCACAGGAGGAAGG + Intergenic
1139955142 16:70689604-70689626 GTGGTGCATCTTCAGCAGGGAGG - Intronic
1141108800 16:81255131-81255153 TTTGTGAAACCTCAGCAGGCTGG + Intronic
1141265934 16:82497306-82497328 TCTGTGGTTCCCTAGCAGGGAGG - Intergenic
1141389992 16:83656479-83656501 TGTGTGATTCCTCAGTAGAGAGG + Intronic
1141913706 16:87078254-87078276 TTTGCACTTCCTCAGCAGGGAGG - Intergenic
1142424521 16:89994210-89994232 AACGAGCTTCCTCAGCAGGGAGG - Intergenic
1142766402 17:2066875-2066897 TTTGTGCTTCTGCACCAGGCGGG + Intronic
1143878784 17:10013917-10013939 TTTGTGTTTCATCAGCAGAGAGG - Intronic
1144445459 17:15323264-15323286 TTTCTGCTTCTGCAGCATGGAGG + Intronic
1145305324 17:21671024-21671046 CTTGTGCTTGCTCAGGTGGGTGG + Intergenic
1145363956 17:22238233-22238255 TTTGTGTTGATTCAGCAGGGTGG - Intergenic
1146363309 17:32197168-32197190 TTTGTGGTTCCTTAGAAGTGGGG + Intronic
1146581664 17:34044005-34044027 TTTGTGTGTCCTCAACAGGGAGG - Intronic
1147663856 17:42132943-42132965 ATTGTTCTTCCACAGCAGGGAGG - Intronic
1149974084 17:61248577-61248599 TTTGTGCTTCCTCAGCAGGGAGG + Intronic
1150896208 17:69213647-69213669 TGCTTGCTTTCTCAGCAGGGAGG - Intronic
1151932493 17:77241411-77241433 TTTGGGTTTGCTGAGCAGGGTGG - Intergenic
1152928492 17:83098693-83098715 GTTGAGCTTCCTCTGCTGGGAGG + Intergenic
1154506797 18:15048583-15048605 TTGCTGCTTCCTCAGAAGGGAGG + Intergenic
1155294467 18:24372424-24372446 TTTGTGCTTTCTGAGCATTGAGG - Intronic
1155352909 18:24924376-24924398 TGTATGCTTCCACAGGAGGGAGG - Intergenic
1157176841 18:45459645-45459667 TGTGTGCTTTCTGAGCAGGCTGG - Intronic
1157580310 18:48770372-48770394 TTTGGGCTTTCTCAGGAGCGGGG - Intronic
1159021582 18:63147325-63147347 TTTGTGCATCAAAAGCAGGGAGG + Intronic
1161516897 19:4701714-4701736 TCTGTGCTCCAGCAGCAGGGTGG + Intronic
1163579817 19:18131767-18131789 TTTGTTCTATCTCAGCGGGGAGG - Intronic
1166967438 19:46538010-46538032 CTTGAGCTTCCGCAGCATGGTGG - Intronic
1167669852 19:50844479-50844501 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1168030034 19:53672289-53672311 TATGTGCTTCCTAAGGCGGGTGG + Intergenic
1168618325 19:57856050-57856072 GTTGTGGTACCTCAGCAGAGGGG + Intronic
1168625125 19:57912221-57912243 GTTGTGGTACCTCAGCAGAGGGG - Intronic
925013944 2:507705-507727 TTTGTGCTTGCAAAGCAGGCAGG - Intergenic
925441953 2:3895578-3895600 TTCTTGCTTTCTCAGCTGGGAGG - Intergenic
925622799 2:5810207-5810229 TTTCTGCCTCCTCAGCCGGGAGG + Intergenic
927353934 2:22151875-22151897 ATTGTTCTTCCTCAGCCAGGTGG + Intergenic
930422909 2:51176642-51176664 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
932702960 2:74003367-74003389 TTTTTGCTTTCTCAGCTGGATGG + Intronic
932883734 2:75528342-75528364 TGCTTGCTTTCTCAGCAGGGAGG + Intronic
932912754 2:75821882-75821904 TTTGTGCGACCTCAGCAGAAAGG + Intergenic
936789652 2:116136282-116136304 TTTGTTCTACCTCAGCTGGAAGG - Intergenic
938216689 2:129523528-129523550 TGTTTGCTTTCTCAGCTGGGAGG - Intergenic
938598318 2:132811695-132811717 TTTTTTCTTTCTCAGCTGGGTGG - Intronic
939172352 2:138710799-138710821 GTTGGGCTGCTTCAGCAGGGTGG - Intronic
939238725 2:139531880-139531902 GTTGTGCTTCCACAGCAGGTAGG + Intergenic
939941915 2:148361860-148361882 CTTGTGCTTCCCCAGTCGGGAGG - Intronic
940630280 2:156229746-156229768 TGCTTGCTTCCTCAGCAGAGAGG + Intergenic
941042196 2:160635145-160635167 TTTGTCTTTTCTAAGCAGGGTGG - Intergenic
942147929 2:173044345-173044367 TCTTTGCTACATCAGCAGGGTGG + Intronic
942635311 2:177997793-177997815 TTTCTGCTTCTTCTGGAGGGAGG + Intronic
943348689 2:186772018-186772040 TGTTTACTTTCTCAGCAGGGAGG + Intergenic
944108698 2:196107893-196107915 TTTTTATTTCCTCAGCAGGAGGG - Intergenic
944485331 2:200199629-200199651 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
948374156 2:237510168-237510190 TTTGGTCTCCTTCAGCAGGGGGG - Intronic
1169578437 20:6991961-6991983 TTTGGGCCTCCTCAGCAGCCAGG + Intergenic
1169940007 20:10926683-10926705 TTTGTGACTCCCCAGCAGGTAGG + Intergenic
1170551242 20:17479374-17479396 TGTGGGCTTCCTCAGCATTGAGG + Intronic
1171482898 20:25467454-25467476 ATTGTGCTTCTTCAACAGGAAGG - Exonic
1171522843 20:25788496-25788518 GTTGTGCTTGCTCAGGGGGGTGG + Intronic
1171530582 20:25850465-25850487 GTTGTGCTTGCTCAGGTGGGTGG + Intronic
1171553984 20:26067387-26067409 GTTGTGCTTGCTCAGGGGGGTGG - Intergenic
1171815757 20:29784765-29784787 GCTGTGCTTCCTCAGAAGGAAGG - Intergenic
1172205572 20:33160664-33160686 TTTATTCTTCCTGAGAAGGGAGG - Intergenic
1174493292 20:50919649-50919671 TTAGTTCATTCTCAGCAGGGAGG + Intronic
1175781374 20:61684332-61684354 TTGCTGCTTCCTTAGCTGGGCGG - Intronic
1177990719 21:28032851-28032873 TTGCTGCTTCCTCAGAAGGGAGG + Intergenic
1179789824 21:43749890-43749912 TGTGTGATTCTTCAGCTGGGGGG - Intronic
1181637686 22:24181895-24181917 ATTGTGGGTCCTCATCAGGGTGG + Intronic
1184047523 22:41980737-41980759 TTTGCCCTTCCTCACTAGGGAGG + Intronic
949450630 3:4181144-4181166 ATTGTGCTTCCTCATGATGGTGG + Intronic
949852468 3:8432986-8433008 TTTCTGCATCCTCAGCAGAAAGG - Intergenic
950569890 3:13793339-13793361 TGTGTGCTATGTCAGCAGGGAGG - Intergenic
952522459 3:34174962-34174984 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
953185250 3:40631540-40631562 TGTTTGCTTTCTCAGCTGGGAGG + Intergenic
953507157 3:43497537-43497559 CTTGTGTTCCCTCAGCAGGGTGG + Intronic
953519521 3:43628143-43628165 TTGGTGTTTACTCAGCAAGGAGG + Intronic
954039055 3:47870641-47870663 TTTGTGCCCCAGCAGCAGGGAGG - Intronic
954882376 3:53844907-53844929 TCTGGGCTTCCGCAGCAAGGCGG + Intronic
956338054 3:68186801-68186823 CTTGAGCTTCCTCAGCAGCCTGG - Intronic
957573694 3:81982302-81982324 TTTGTGCTACAACAGCAGAGTGG + Intergenic
957576178 3:82010933-82010955 TTTATGCTTCCTCTGAAGAGTGG - Intergenic
960624105 3:119663397-119663419 TATGTGCTATCTCAGCAGAGGGG + Intronic
961780734 3:129318819-129318841 TTTGTGCAGCCACCGCAGGGGGG + Intergenic
962473226 3:135732037-135732059 TTTGTGTGAACTCAGCAGGGGGG - Intergenic
964243059 3:154618474-154618496 TTTGCGCTTCCTAAACATGGAGG - Intergenic
965184514 3:165446271-165446293 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
968233369 3:197017028-197017050 CTTGTGGTCGCTCAGCAGGGTGG - Intronic
968705837 4:2077006-2077028 TTTTTTTTTCCTTAGCAGGGAGG + Intronic
971473828 4:27054001-27054023 TTTTTGCATCTTCAGCAGGGAGG - Intergenic
973135494 4:46700809-46700831 TTTCTGCTTCATCATGAGGGAGG - Intergenic
973838129 4:54831601-54831623 TTTGTGCTTCAGCAGCAGATAGG - Intergenic
973920063 4:55675354-55675376 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
973938619 4:55879405-55879427 ATTGTGCTTGCAGAGCAGGGAGG + Intronic
974165038 4:58190973-58190995 TGTTTGCTTTCTCAGCTGGGAGG + Intergenic
975151695 4:71029698-71029720 TTTTGTCTTCCTCAGCAGGTTGG + Exonic
976562840 4:86521720-86521742 TGTGTGCTTTCTCAGTGGGGAGG - Intronic
977774173 4:100897614-100897636 TGTGTGCTACCTCAGAAGGAGGG + Intergenic
977929678 4:102737310-102737332 TGTTTGCTTTCTCAGCAGGGAGG + Intronic
980519336 4:133910387-133910409 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
982049822 4:151489546-151489568 TGCTTGCTTTCTCAGCAGGGAGG + Intronic
985031441 4:185794597-185794619 ATTGGGCTTCCTCAGAGGGGTGG - Intronic
985926204 5:3020960-3020982 TTTCTGCATCCCCAGGAGGGAGG - Intergenic
986291968 5:6407254-6407276 TTTCTGCTCTCTCATCAGGGTGG + Intergenic
987434958 5:17883483-17883505 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
988230253 5:28468025-28468047 TTGGTGATTACTCAACAGGGAGG - Intergenic
988363981 5:30272151-30272173 TTTATTCTTCCTCAGCCAGGTGG - Intergenic
990243466 5:53838637-53838659 TGTGTGCTTTCTCAGCTGAGAGG + Intergenic
992023949 5:72652549-72652571 CTTGGGCTTGCTCAGCATGGGGG + Intergenic
992689343 5:79227937-79227959 CATGTTCTTCCTCAGCAAGGGGG - Intronic
994220859 5:97193256-97193278 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
994887409 5:105582444-105582466 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
995870596 5:116739861-116739883 TTTTTCCTTCCTAAGCTGGGCGG - Intergenic
996028549 5:118679452-118679474 TTTGTGCATGCTCTGCAGGATGG + Intergenic
997073130 5:130641316-130641338 GTTGTCCTTTCTCAGCAGTGAGG - Intergenic
997553034 5:134770324-134770346 TTTCTGCCTCCTCAGTAGGTAGG + Intronic
997822791 5:137081045-137081067 GTTCTGATCCCTCAGCAGGGGGG + Intronic
998180031 5:139930535-139930557 TTTGTGTTTCCTCTGCTGGTAGG + Intronic
998758563 5:145407180-145407202 TTCTTGCTTTCTCAGCAGGAAGG + Intergenic
999472021 5:151863526-151863548 TTTGTGTTTCCCAAGCAGGAAGG + Intronic
999491070 5:152052261-152052283 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1000395745 5:160773004-160773026 GTTGTGCTGACTCAGCAAGGCGG + Intronic
1001978898 5:176024014-176024036 TTTGTGGTTCCTCAAGAGAGGGG - Intronic
1002238517 5:177819752-177819774 TTTGTGGTTCCTCAAGAGAGGGG + Intergenic
1003666858 6:8119344-8119366 TTTAAGCTTCCTCACCACGGAGG + Intergenic
1004806164 6:19205712-19205734 TTTGTTCTTGCCCAGCAGAGAGG - Intergenic
1006225678 6:32534849-32534871 ACTGGGCTTCCTCAGCATGGTGG - Intergenic
1006695394 6:35926421-35926443 TTGGTGATTCCTGAGCAGGTAGG + Intergenic
1007750284 6:44067062-44067084 ATTGTCCTTCCTCAGGAGGGTGG - Intergenic
1008090462 6:47288930-47288952 TTTGTGCTTCCTCTCCTGGGTGG - Intronic
1009360329 6:62803285-62803307 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1010989060 6:82458887-82458909 TTTGTGATGACTCAGCAGTGTGG - Intergenic
1011156676 6:84341077-84341099 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1011998977 6:93629982-93630004 TTTGAGCTTCCTCCCTAGGGAGG - Intergenic
1012073321 6:94651864-94651886 ATTGTGCTTGCTGAGCATGGTGG + Intergenic
1012965570 6:105669423-105669445 TGTTTGCTTTCTCAGCGGGGAGG + Intergenic
1013492213 6:110659699-110659721 TCTGTGGTTCGACAGCAGGGAGG + Intronic
1023130339 7:36996791-36996813 ATTGTGTTCCCTCAGCAAGGAGG - Intronic
1023885090 7:44348713-44348735 TTTCTGCTTCCCCACCAGGGTGG + Intergenic
1024125401 7:46289910-46289932 TTTGTTCTTCCTCAACAAGGAGG + Intergenic
1024222159 7:47297434-47297456 TTTCTGCCTCCTCAACAGGCAGG - Intronic
1024408406 7:49009794-49009816 TCTGTGCTCCCTCAGGAGGTTGG - Intergenic
1024483712 7:49892625-49892647 TGTGTGCTCTCTCAGCTGGGTGG + Intronic
1028401551 7:90430782-90430804 TACTTGCTTTCTCAGCAGGGAGG + Intronic
1028440698 7:90856917-90856939 TGTGTTCTTTCTCAGCAGAGTGG - Intronic
1028647923 7:93119390-93119412 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1030043249 7:105470976-105470998 TTTGCGCTTCCTCAGATGAGTGG - Intronic
1030172672 7:106619730-106619752 TTTGTGCTTGAGCAGCTGGGAGG - Intergenic
1031378306 7:121054142-121054164 TTTGAGCTCTCTCAGCAGAGAGG + Intronic
1032696881 7:134344827-134344849 CTTGTCCTTCCAAAGCAGGGAGG - Intergenic
1034468385 7:151243072-151243094 CTTGTGTTTCATCATCAGGGAGG + Intronic
1036565504 8:9934646-9934668 TTTGTGTTTCCACAGCGGGGAGG + Intergenic
1036763291 8:11527987-11528009 TTTTTGCTCCCTGAGCAAGGAGG + Intronic
1038412945 8:27372445-27372467 TTCCTTCTTACTCAGCAGGGGGG + Intronic
1040529419 8:48254223-48254245 TATTTGCTTTCTCAGCAGGGAGG - Intergenic
1041831997 8:62164704-62164726 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1041897092 8:62937769-62937791 TGCTTGCTTTCTCAGCAGGGAGG + Intronic
1049296883 8:141845493-141845515 TTTGGGCTTCCTCAGGGGTGGGG - Intergenic
1053611824 9:39721589-39721611 GTTGTCTTTCCTCAGGAGGGAGG - Intergenic
1055057744 9:72039229-72039251 TTAGCGCGTTCTCAGCAGGGAGG + Intergenic
1055090902 9:72364533-72364555 TTTGTGCTTCCTGGGCTGGCGGG + Exonic
1057070030 9:92089381-92089403 TTTGTTCTTCCTGAGCAGGCTGG - Intronic
1057949551 9:99359012-99359034 TTCTTGCCTGCTCAGCAGGGCGG - Intergenic
1059876714 9:118643472-118643494 TTTCTTCTTCCTCAGCAGGAAGG - Intergenic
1060249810 9:121977035-121977057 TTTGTACTTTCTCAGCCTGGTGG + Intronic
1060748234 9:126151767-126151789 ATTGTGCCTCCCCAGGAGGGAGG - Intergenic
1060934507 9:127507397-127507419 GTTGTGCTTCCTCTGCACCGCGG + Exonic
1060974116 9:127754808-127754830 TTTCTGCCTCCTCCGCAGGAGGG - Intronic
1061856239 9:133443361-133443383 TGTCTCCTTCCTCAGCTGGGCGG + Exonic
1187840292 X:23479910-23479932 TTTGTGACTCCTAAGCAGGAGGG - Intergenic
1189198197 X:39169176-39169198 TCTGTGGTCCCTCAGCAAGGTGG - Intergenic
1190432025 X:50387408-50387430 TTAGACCTTCCTCATCAGGGAGG + Intronic
1190626011 X:52339416-52339438 TTTATGCTTCCTTGCCAGGGTGG - Intergenic
1191211681 X:57891597-57891619 TCTGTGCTTCCTCCACAGAGAGG + Intergenic
1192691260 X:73367089-73367111 TTCTTGCTTCCTCAGCTGGGAGG - Intergenic
1195343884 X:103929163-103929185 TTTGTCCTTGCTCAACAGGTTGG - Intronic
1195363104 X:104104169-104104191 TTTGTCCTTGCTCAACAGGTTGG + Exonic
1195499004 X:105572188-105572210 TTTGTGGTTCCAGAGCATGGAGG - Intronic
1195705764 X:107737097-107737119 TCTGTGCCTTCACAGCAGGGTGG - Intronic
1197364254 X:125544711-125544733 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1199586792 X:149423394-149423416 TGCTTGCTTTCTCAGCAGGGTGG + Intergenic
1199851515 X:151727476-151727498 TTTGTCCTTTCCCAGGAGGGTGG + Intergenic
1200082015 X:153581927-153581949 TAGGGGCTTCCTCAGGAGGGTGG - Exonic
1200156960 X:153981961-153981983 TTTCTGCTGGCTCAGCCGGGAGG + Exonic