ID: 1149975475

View in Genome Browser
Species Human (GRCh38)
Location 17:61261504-61261526
Sequence TAACAGAAGAGTAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149975475 Original CRISPR TAACAGAAGAGTAATGAGGT TGG (reversed) Intronic
907126199 1:52053325-52053347 TAACAGAAGAGTAGAGTGTTGGG - Intronic
907411253 1:54285265-54285287 CAACAAAAGAGTTAAGAGGTTGG + Intronic
908793372 1:67805072-67805094 TAACAGGAGAGTACTGGAGTTGG - Intronic
908838473 1:68253350-68253372 AAAGAGAAGAATCATGAGGTGGG + Intergenic
909092229 1:71240622-71240644 AAACAGAATAATAATGAGATTGG + Intergenic
909148979 1:71976346-71976368 AGATAAAAGAGTAATGAGGTGGG + Intronic
910555968 1:88533137-88533159 AAATAGAAGATTAATGAGTTTGG - Intergenic
910697604 1:90037088-90037110 TGAAAGAAGAGTGATGGGGTGGG + Intergenic
911055405 1:93704313-93704335 TGACTGGAGTGTAATGAGGTGGG + Intronic
915128375 1:153680836-153680858 TCACAGAACAGAAAAGAGGTTGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916466285 1:165077341-165077363 TCACAAAAGAGTGATGGGGTAGG + Intergenic
917225467 1:172776988-172777010 AAACAGAAAAGATATGAGGTTGG + Intergenic
917652404 1:177091016-177091038 TAACAAAGGAGTGATGAGGCTGG + Intronic
918088242 1:181263604-181263626 TAAGTGATGAGGAATGAGGTAGG + Intergenic
918970536 1:191410637-191410659 GAACAGAAAAATAATGAGGAAGG + Intergenic
920069938 1:203295699-203295721 TAACAAAAGAGTATTGGGCTAGG - Intergenic
921789411 1:219272473-219272495 TAACAAAAGAGAAATGATCTGGG + Intergenic
921939792 1:220827835-220827857 AAACAAAAGAGTAATAAGGGAGG - Intergenic
923510447 1:234647678-234647700 TAAGAGAAGAGTAATCATTTAGG + Intergenic
923681787 1:236124381-236124403 CAACAGAAGAGTAGTCAGGAAGG - Intergenic
923813577 1:237347919-237347941 TAAGAGAAGTGCACTGAGGTAGG + Intronic
923830281 1:237548333-237548355 TGGAAGAACAGTAATGAGGTAGG + Intronic
923898572 1:238300855-238300877 TATTAGAAGAGTAATGGGTTTGG + Intergenic
1063997045 10:11629233-11629255 GAAAAGAAGAATAATGAGGCCGG - Intergenic
1065370846 10:24984033-24984055 TAAAATAAGAGTATCGAGGTTGG + Exonic
1066440121 10:35430613-35430635 TAACAAAAGAGGATTGAGGGTGG + Intronic
1066705515 10:38173834-38173856 TAAAAGAAGAGTAATGATAAAGG - Intergenic
1067474993 10:46558969-46558991 TGACAGAAGAGGAATGAGTGTGG + Intergenic
1068963219 10:62886289-62886311 TAAAAATAGAGTAAGGAGGTAGG + Intronic
1069007393 10:63333716-63333738 TTACAGAAGAATAATTATGTGGG - Intronic
1069333475 10:67320843-67320865 TAAAAGAAGAGAATTGAGATTGG + Intronic
1069725970 10:70578912-70578934 TTCCAGATTAGTAATGAGGTTGG + Intergenic
1070483973 10:76912156-76912178 TCACAGAACAGTAATTATGTGGG + Intronic
1071849504 10:89554311-89554333 TATCAGAAGGGAATTGAGGTGGG - Intronic
1074030141 10:109678952-109678974 TCACAGTAGGGTAATGAAGTGGG + Intergenic
1074077791 10:110144883-110144905 TAATAGAAAAGTGAAGAGGTAGG - Intergenic
1074957230 10:118404038-118404060 TGACAGCAGTGTAATGAGGGTGG - Intergenic
1076295325 10:129379279-129379301 CAGCAGAAGAGTAGAGAGGTGGG - Intergenic
1077965837 11:7132057-7132079 TAACAGATTAGTTATGAGCTCGG - Intergenic
1078319910 11:10325004-10325026 TCTCAGGAGAATAATGAGGTTGG + Intronic
1079271288 11:18988310-18988332 AAAAAGAAGGGTAATGAGGATGG + Intergenic
1080366721 11:31582815-31582837 TAACAGAACAGTCAAGAGATGGG - Intronic
1081208219 11:40299825-40299847 TTACAGAAGTGTAAAGAGCTGGG + Intronic
1081251157 11:40836181-40836203 TAAGAGAAGATTGGTGAGGTTGG - Intronic
1082616637 11:55368966-55368988 TAACAGAAATGTAATCAGATAGG - Intergenic
1082699964 11:56416852-56416874 TAAAAAAAGAGCAATGAGTTAGG + Intergenic
1083863223 11:65437546-65437568 GAAAAGTAGAATAATGAGGTAGG - Intergenic
1084769506 11:71333661-71333683 TCACTGAAGTGTAATGAGCTAGG - Intergenic
1085319165 11:75563696-75563718 AAACAGAAGAGTGAAGAGGGCGG - Exonic
1086062546 11:82714768-82714790 TAACAGAAGAGGAAAGTGGGAGG + Intergenic
1087065740 11:94026461-94026483 AAACAGGAGAGAACTGAGGTAGG - Intronic
1087539234 11:99493986-99494008 TAACAGAAGATTAATAAAATCGG - Intronic
1087642878 11:100774400-100774422 TAATGAAAGAGGAATGAGGTAGG + Intronic
1089281630 11:117378959-117378981 TATAAGATGAGTAATGAAGTGGG - Intronic
1089545166 11:119218768-119218790 AAGCATAAGAGTAATGATGTCGG + Intronic
1089568466 11:119385993-119386015 TAACAGAAGAGTCCTGAGGTTGG - Intergenic
1089908355 11:122069369-122069391 TAAGAGTTGAATAATGAGGTGGG + Intergenic
1090079896 11:123605147-123605169 TTTCAGAAGAGCAATGGGGTAGG + Intronic
1090466648 11:126940760-126940782 CTACAGAGGAGTAAAGAGGTAGG - Intronic
1091175953 11:133557882-133557904 TGACTGAACAGTAATAAGGTTGG - Intergenic
1092099191 12:5869280-5869302 GCACAGAAGAGTAATGAGCAGGG - Intronic
1095918714 12:47507343-47507365 TAAGAGAAGAGTCATGGGTTTGG - Intergenic
1096005578 12:48168224-48168246 GAAAAGAAGAGCAATGAGGAGGG + Intronic
1097487299 12:60221165-60221187 TAACACAAAAGTAAAGAGATAGG - Intergenic
1098058831 12:66538546-66538568 AAGCAGAAGAGTAGTGAGATTGG + Intronic
1098239956 12:68456865-68456887 CAACAGAACAGTAATGAAGGCGG - Intergenic
1099162615 12:79262333-79262355 TCAGAGAAGAGTCATAAGGTTGG - Intronic
1100490993 12:95077708-95077730 TAACAGCAGGGCAATGAGGATGG + Exonic
1100852026 12:98722047-98722069 AAACAGAAGAGAAAAAAGGTTGG - Intronic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1106670245 13:31897520-31897542 TAAAATAAAAGTAATGAGGCTGG - Intergenic
1109904519 13:68821178-68821200 TAACAGAAGAGCACTGGGGATGG + Intergenic
1109906771 13:68853205-68853227 GATCAAAAGACTAATGAGGTTGG - Intergenic
1110109321 13:71723625-71723647 AAACAGAAGAGGATTGATGTGGG - Intronic
1111534188 13:89580285-89580307 TAACAGAAGAATATTCATGTTGG + Intergenic
1112268658 13:97948778-97948800 TAAAAGAAGAGAAATGGGGCCGG - Intergenic
1112593954 13:100790966-100790988 TCACAGAAGCCTAATGAGGCAGG + Intergenic
1112699149 13:101984462-101984484 TCAAAGAAGAGTAATTTGGTGGG - Intronic
1115787593 14:36843424-36843446 TAACAAAATAGAAATAAGGTAGG - Intronic
1115896248 14:38090978-38091000 CATGAGAAGAGTAATGAGTTTGG + Intergenic
1115905765 14:38201484-38201506 TGGCAGATGAGTAATGAGCTTGG - Intergenic
1117234655 14:53758886-53758908 TACCATGAGAGTAATGAGCTTGG - Intergenic
1117642782 14:57817816-57817838 TCTCAGCAGAGTATTGAGGTAGG + Intronic
1118755163 14:68837681-68837703 GAACATAAGAGTAATGACCTAGG + Intergenic
1119186587 14:72647118-72647140 TAATAGAAGAAGGATGAGGTGGG - Intronic
1120080134 14:80206851-80206873 TTGCGGAAGAGTAATTAGGTCGG + Intronic
1120188605 14:81419827-81419849 TAAGAGAAGAGAAGTGAAGTAGG + Intronic
1120757377 14:88256915-88256937 TCACAGAAGAGCAGTGAGGCCGG + Intronic
1121108916 14:91298942-91298964 TAACAGATGAGGAAACAGGTTGG - Intronic
1123766511 15:23484049-23484071 TGACACATGATTAATGAGGTTGG - Intergenic
1124547442 15:30644045-30644067 TTACAGAAGAGGTATAAGGTGGG - Intronic
1124856793 15:33396928-33396950 TACCAGAAAAATAAAGAGGTTGG - Intronic
1126432204 15:48598125-48598147 TAAGTGAAGGGTAATAAGGTTGG + Intronic
1126746942 15:51835764-51835786 CTACATAAGAATAATGAGGTTGG - Intronic
1126762515 15:51981983-51982005 TAATAAAATAGTACTGAGGTGGG + Intronic
1127405863 15:58645291-58645313 AAACATAATAGTAATAAGGTAGG - Intronic
1129806636 15:78466564-78466586 TAACATAATAGTAATTGGGTGGG - Intronic
1130697646 15:86146746-86146768 GAACAGAACAGAAATGAGGTTGG + Intronic
1132261827 15:100432663-100432685 GAACAAGAGAGTGATGAGGTAGG + Intronic
1133583066 16:7165368-7165390 TTACAGAAGAGTTATGATCTGGG - Intronic
1133812170 16:9169096-9169118 TAGAAGAAGAGAAATGAGATGGG - Intergenic
1134041547 16:11072663-11072685 CAACAGAACAGTCCTGAGGTAGG - Intronic
1135203733 16:20463965-20463987 TAACGTAAGAGTAATGACTTAGG - Intronic
1135215269 16:20560971-20560993 TAACGTAAGAGTAATGACTTAGG + Intronic
1135832959 16:25794834-25794856 TAAAAGAAGAGTAAAGAGAATGG - Intronic
1136726884 16:32364983-32365005 GAAAAGGAGAGGAATGAGGTTGG - Intergenic
1202999550 16_KI270728v1_random:152776-152798 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1203131148 16_KI270728v1_random:1689175-1689197 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1143652257 17:8270650-8270672 CAACAGAACAGTCATGAGGAAGG - Intergenic
1149687839 17:58548089-58548111 CAAAAGAAGAGTAAGGAGGAGGG - Intergenic
1149743720 17:59073751-59073773 TAACAAAACAGTATTGAGATGGG - Intronic
1149975475 17:61261504-61261526 TAACAGAAGAGTAATGAGGTTGG - Intronic
1150293262 17:63993580-63993602 TGACAGGACAGTAATGAAGTTGG - Intergenic
1150955136 17:69849631-69849653 TAACAGAAGAGCAAAGATTTAGG + Intergenic
1151931774 17:77236852-77236874 AAACAGAAGAGAAAAGAGGCTGG + Intergenic
1152666179 17:81570936-81570958 TAAAAGAAGAGGAAAGAAGTGGG + Intronic
1154196995 18:12274023-12274045 TAAGAGCAGAGTGATGACGTGGG + Intronic
1155712383 18:28898999-28899021 AAACAGTAGTGTAATGTGGTGGG + Intergenic
1156035396 18:32760921-32760943 TAACACCAGAGGAATGAAGTTGG - Intronic
1156932168 18:42658830-42658852 TCACAGAAGATGAATGAGCTTGG + Intergenic
1157398480 18:47365087-47365109 GAACAGATGAGTAATGAGTAAGG - Intergenic
1158320772 18:56260391-56260413 AAAAAGAAGAATAATGAGTTGGG + Intergenic
1159495347 18:69195521-69195543 TACCAGAAGATTAAAGAGGGAGG - Intergenic
1159510606 18:69394182-69394204 TAACAGAAATGTAGTGATGTCGG + Intergenic
1159756615 18:72373380-72373402 TTACAAAATAGTAATGAGTTGGG + Intergenic
1161402379 19:4073030-4073052 AAAAAGAAAAGTAATTAGGTCGG - Intergenic
1162582403 19:11539241-11539263 TAACAGAAGACTGATCAGGTGGG - Intronic
1164155467 19:22593941-22593963 GAACTGATGAGGAATGAGGTTGG + Intergenic
1164155472 19:22593965-22593987 GAACTGATGAGGAATGAGGTTGG + Intergenic
1164155477 19:22593989-22594011 GAACTGATGAGGAATGAGGTTGG + Intergenic
1164479847 19:28602836-28602858 TACCAGAAGAGACATGAGCTAGG + Intergenic
1165960307 19:39528689-39528711 GAAAAGAAGAGCAATGAGGGTGG + Intergenic
925514852 2:4670017-4670039 TTAGAGAAGAGTATTGAAGTGGG - Intergenic
925892549 2:8447579-8447601 CATCAGTAGAGTGATGAGGTTGG - Intergenic
926142326 2:10375090-10375112 TCACAGAAGAGAAAAGAGGCGGG + Intronic
926574504 2:14565172-14565194 CAACAGCAGAGCAATGAGGAAGG + Intergenic
928237770 2:29559695-29559717 TAAATGAAGAGTAATGAGGGTGG + Intronic
929346301 2:40888500-40888522 TAAAGGAAGAGTAACAAGGTTGG + Intergenic
929817248 2:45243079-45243101 TTACAGAAGAGTAGAGAGGATGG - Intergenic
934319093 2:91956086-91956108 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
935101749 2:100002321-100002343 TCACAGAAGATAAATGATGTAGG - Intronic
935209066 2:100922903-100922925 GAACAGAGCAGTAATGAGCTGGG + Intronic
936493231 2:112993961-112993983 TCACAGTAGAGAAAAGAGGTGGG - Intergenic
938702046 2:133888270-133888292 GAACAAAAGAGAAAAGAGGTGGG + Intergenic
938807048 2:134815799-134815821 TAATAGAAGAGGAATCAGTTGGG - Intergenic
939960610 2:148561920-148561942 TCACAGAAGAGAAATCAAGTAGG - Intergenic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
943201736 2:184835587-184835609 TTACAGTACAGTACTGAGGTAGG - Intronic
943269952 2:185787037-185787059 TAACCTAAGAGTAATAATGTAGG + Intronic
943325228 2:186489647-186489669 GTACAGAAGAGGAAAGAGGTAGG - Intronic
943579837 2:189672327-189672349 TAACAGTTGAGTAATGTGGGTGG - Intergenic
944027242 2:195185544-195185566 AAAAATAAGAGTAATGAGGACGG - Intergenic
944350699 2:198723783-198723805 TAACAGAAGAATGATGATCTGGG - Intergenic
944774926 2:202953554-202953576 TAACAGTATAGCTATGAGGTTGG - Intronic
944842426 2:203637159-203637181 TAAAATAGGAGTAATAAGGTTGG + Intergenic
945019303 2:205555349-205555371 TAACAGTAGAGTCCTGAGGATGG - Intronic
945356217 2:208842902-208842924 GAACATAAGAGTAATGATTTAGG + Intronic
945501335 2:210579184-210579206 TAATGAAAGAGTAATGAGTTAGG - Intronic
946255597 2:218439520-218439542 TAACAGAAGTGTATTTAGGCTGG + Intronic
947574008 2:231258163-231258185 GAAAAAAAGAGTAATTAGGTGGG - Intronic
948028838 2:234800138-234800160 TAACAGCAGAGCAAGGAGGATGG + Intergenic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
949069423 2:242014914-242014936 TGACAGGAGAGTTATGAGCTAGG + Intergenic
1169297223 20:4410609-4410631 TAACAGTAGAGTGAGGAAGTGGG - Intergenic
1173852361 20:46227284-46227306 GAACAGAAAAGGAATGGGGTGGG - Intronic
1175504442 20:59471566-59471588 TGACTGAAGAGTAATCAGGCTGG - Intergenic
1175618761 20:60425230-60425252 TAAAAGAAGAGTAAAGATTTGGG - Intergenic
1178468580 21:32871346-32871368 TAACAAAAGAGTAATGACCCAGG - Intergenic
1180307274 22:11139753-11139775 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1180545794 22:16501937-16501959 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1181925488 22:26355332-26355354 GAACTGCAGAGTGATGAGGTTGG - Intronic
1183031165 22:35106253-35106275 TAAAACAAGAATAATGAGGAAGG - Intergenic
1184719455 22:46301783-46301805 AAAAATAAGAGTAATGAGGCTGG - Intronic
949629011 3:5901880-5901902 TCACGGAAAAGCAATGAGGTAGG - Intergenic
949737285 3:7188063-7188085 TAATAGAGGAGGAATGATGTGGG + Intronic
950564409 3:13758551-13758573 TAATAGAATAGTAAGGATGTGGG - Intergenic
950877522 3:16289699-16289721 TACCAGATGAGTAATGGGGGAGG - Intronic
951640668 3:24830741-24830763 TGAGAGAAGAGGAAAGAGGTAGG + Intergenic
952470653 3:33647736-33647758 TAAAAGAAGAGTAAGTAGGCCGG + Intronic
952936805 3:38405044-38405066 TAAAAGAAGAGTAAGAATGTGGG + Intronic
954677141 3:52322274-52322296 TAACAGAAGAGCAAGAAGGAGGG - Intronic
955412135 3:58662640-58662662 TAACAGTAGTGTAATAAAGTAGG + Intronic
956483959 3:69701808-69701830 TAAGAGAAGAGTGATGAGTCTGG + Intergenic
956654210 3:71533601-71533623 TCACAGAACAATAATGGGGTTGG - Intronic
956807311 3:72828238-72828260 TAACAGGGGAGCACTGAGGTGGG + Intronic
957385570 3:79491707-79491729 TACCACAAGAGAAGTGAGGTAGG + Intronic
958101256 3:89014207-89014229 TAAAAGAACACTAATGTGGTTGG - Intergenic
958553539 3:95645313-95645335 TAAAAGCAGAGTATTAAGGTGGG - Intergenic
959190953 3:103110646-103110668 TAACAGAAGACATATGAGGAAGG - Intergenic
959611331 3:108298194-108298216 TGACAGAAGAATAAGGAGGAAGG - Intronic
960206232 3:114903116-114903138 AAGCAGTAGAGTTATGAGGTAGG + Intronic
961665579 3:128491665-128491687 ACACAGAACAGTAATGAGGTGGG - Intronic
962194368 3:133348100-133348122 AAAAACAAGAGTAATGAGGGGGG + Intronic
962219261 3:133550112-133550134 TAACAGAAGAGTGGTGGGCTGGG - Intergenic
963187264 3:142432491-142432513 TACCAGTCGAGTAATGAGTTAGG - Intronic
964348585 3:155780505-155780527 TAAAAGAAGATTATTGAGTTTGG - Intronic
965414012 3:168369625-168369647 TAAGAGAAGAGCAGTGAGGCTGG - Intergenic
965446240 3:168777723-168777745 TAAGAGAAGAGTATAGAAGTGGG + Intergenic
966364529 3:179169728-179169750 TGAAAGAAGAGTAATGAGAAGGG - Intronic
966889935 3:184399494-184399516 TAACGGAAGGGTAAGGAGGTAGG + Intronic
967975040 3:195029547-195029569 TAACAGCAGAGTCAAGATGTGGG - Intergenic
968020490 3:195383233-195383255 TATTTGAAGAGTAATAAGGTAGG + Intronic
970371612 4:15412598-15412620 TAAATGAAGAGTCTTGAGGTGGG - Intronic
970752027 4:19375483-19375505 TAAAAGAAGAGACATGAGGTAGG - Intergenic
971761562 4:30772606-30772628 GAAGAGAAGAGTCATGAGGCAGG + Intronic
973280042 4:48350354-48350376 TAGCAGAAGGGTAAGGAGGCAGG - Intronic
978937746 4:114399050-114399072 TAACATAGTAGAAATGAGGTAGG + Intergenic
979566157 4:122156307-122156329 AAATAGAAGAGAAATGAGGTTGG + Intronic
981320930 4:143390500-143390522 AGACAAAAGAGTAGTGAGGTTGG - Intronic
982025489 4:151250302-151250324 TTAAAGAACAGTAATCAGGTCGG + Intronic
983108375 4:163718828-163718850 TCAGAGAAGAGTCATGAGGTTGG - Intronic
983183459 4:164675761-164675783 TGACAGAAGTTTCATGAGGTTGG + Intergenic
983854060 4:172619444-172619466 TAACACAAGAGTCATAATGTTGG - Intronic
984005693 4:174304615-174304637 AAACAGAAGAGTAGTGATTTAGG + Intronic
984254173 4:177370570-177370592 TAATAAAAGAGTAATGAGGGAGG + Intergenic
985365515 4:189227496-189227518 TAACAGAAGACTAAAGAGAATGG - Intergenic
986502506 5:8415450-8415472 TGACAGAAGAGTTATAGGGTAGG - Intergenic
987788287 5:22530492-22530514 AAACAGAATTTTAATGAGGTAGG - Intronic
988197039 5:28016897-28016919 TAACACAAAAGTAATAAGATTGG - Intergenic
989418092 5:41204247-41204269 TAACAAAAGCTTTATGAGGTAGG - Intronic
993694751 5:91048064-91048086 TAGCAGAAGTGTAAAGAGGCAGG - Intronic
995584324 5:113631413-113631435 TAACAGAGGATTAATCAGTTTGG + Intergenic
996838070 5:127816086-127816108 TTAGAGAAAAGTAATGAGGAGGG + Intergenic
997060660 5:130498529-130498551 CAGCTGAAGAATAATGAGGTTGG - Intergenic
997782245 5:136671232-136671254 TTACAAAAGAATAGTGAGGTTGG - Intergenic
998323046 5:141250641-141250663 TGTCAGAGAAGTAATGAGGTAGG + Intergenic
998713907 5:144858993-144859015 TATCAGAAGAATAAAGAGGTTGG - Intergenic
1000413050 5:160954278-160954300 TAAAAGATGAGGAATGAGCTGGG + Intergenic
1001154453 5:169261152-169261174 TTACAGAAGAGTATGGAGGAAGG + Intronic
1001164060 5:169347481-169347503 TAAAAGATGAACAATGAGGTTGG - Intergenic
1001284244 5:170410802-170410824 TGTCAGAAGAGTTGTGAGGTTGG + Intronic
1002176893 5:177405671-177405693 TACCAGGAGAGTAATGAGGCGGG + Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003940015 6:11015446-11015468 TAACAGTGGTGTGATGAGGTAGG - Intronic
1003996615 6:11547996-11548018 AAACAGAAGAGAGAGGAGGTAGG + Intronic
1004920367 6:20370305-20370327 TAACAGGAGATTACTGTGGTGGG - Intergenic
1005509224 6:26497398-26497420 TAAGAGAAGTGAAATGAGGAAGG + Intergenic
1006756640 6:36421832-36421854 TAAAAGAAGAGTAAGGAGGTTGG - Intronic
1006965382 6:37978465-37978487 TAACAGAAAATTAAAGAGGAAGG - Intronic
1007813637 6:44504412-44504434 TAAAAGAAGTGTAATGAAGATGG + Intergenic
1008318986 6:50083413-50083435 AATCAGAAGAGTAAACAGGTTGG - Intergenic
1009586029 6:65603622-65603644 GAACAGAAGAGTACTTATGTAGG - Intronic
1012362181 6:98396050-98396072 AAACAGAAGGGAAATGAGATTGG + Intergenic
1012452050 6:99362985-99363007 AACCAGAAGAATAATGAGATTGG + Intergenic
1014354419 6:120387032-120387054 TGACAGAAGAGTATTCAGGCTGG - Intergenic
1014916843 6:127160849-127160871 TTAAAGATGAGTAGTGAGGTAGG - Intronic
1014990868 6:128074760-128074782 TAACAGAAGGACAATGTGGTTGG + Intronic
1015351133 6:132221380-132221402 TAATAGAAGACCACTGAGGTAGG - Intergenic
1016919236 6:149274654-149274676 TAAAAAAAGAGTAATGATTTGGG + Intronic
1016994096 6:149948547-149948569 TGACAGAGGAGGAAAGAGGTAGG + Intronic
1017043850 6:150329174-150329196 TAAGAGAGGAGTAATGATGCTGG - Intergenic
1017244395 6:152206950-152206972 TCACAGAAGAATATTGATGTTGG + Intronic
1018242351 6:161790263-161790285 GAACAGAAGAGAAATCAGGTGGG + Intronic
1018414445 6:163589159-163589181 TAACAGAAGAGAAAGGAGTAAGG + Intergenic
1018428200 6:163701863-163701885 TCACAGAAGAGTGAGGAGATGGG - Intergenic
1018747165 6:166771614-166771636 GAACAGAAGAGAAATGTGGCAGG - Intronic
1020578553 7:9965653-9965675 TAACAGAAGAGTTGAGAAGTTGG - Intergenic
1020952712 7:14700676-14700698 TAAAAGCAAAGCAATGAGGTTGG - Intronic
1024499108 7:50083556-50083578 TAACAGAAAAGCAAAGAGGAGGG + Intronic
1027181111 7:75940058-75940080 TAAAATAAGAGTAAAGAGGTGGG - Intronic
1027398319 7:77781309-77781331 AAACAGAAGATTAAATAGGTGGG - Exonic
1030659001 7:112199752-112199774 TAACAGAAGAGTAAAGATAATGG - Intronic
1030777550 7:113552953-113552975 AAACACAAGAGTAGTGATGTTGG + Intergenic
1033875627 7:145814526-145814548 TAACAGAAGAGTAGCCAGGAAGG + Intergenic
1036500315 8:9308133-9308155 CAACAGAACTGTAATGAAGTAGG - Intergenic
1037985342 8:23287585-23287607 TAACAGAGGAATAAAGAGGAAGG - Intronic
1039254619 8:35705258-35705280 TAAGAGAAGAGGCATTAGGTTGG - Intronic
1039759285 8:40557517-40557539 TACAGGAAGAGTAAAGAGGTTGG - Intronic
1040589266 8:48774326-48774348 TCACAAAAGTCTAATGAGGTTGG - Intergenic
1041874071 8:62667608-62667630 CAACAGATGAGTAATGAGGATGG - Intronic
1043615560 8:82120727-82120749 TAACAGAAGGGAAATGATGATGG - Intergenic
1043639923 8:82439222-82439244 TCACATAAGAGTAAAAAGGTGGG + Intergenic
1044389497 8:91632891-91632913 AAACAGAAGAGTGATGGGATGGG + Intergenic
1045665579 8:104480845-104480867 AAGCACAAGAGTAATGATGTTGG - Intergenic
1046218716 8:111183903-111183925 TGGCAGAAGAGAAATGTGGTTGG + Intergenic
1047773902 8:128053110-128053132 TAACAGCATAGTAAAGAGGAGGG + Intergenic
1048692536 8:136983796-136983818 TAAGAGGAGTGTGATGAGGTGGG - Intergenic
1050545871 9:6708258-6708280 TAAAAAAAGAGTAAGTAGGTAGG + Intergenic
1051414331 9:16822830-16822852 TTATAGAATAGTAATGATGTTGG - Intronic
1051872130 9:21750106-21750128 GAATAAAAGAGAAATGAGGTTGG - Intergenic
1052987211 9:34496406-34496428 TGACAGAAGAGCAAAGAGTTTGG - Intronic
1055073990 9:72194904-72194926 TAACAGAACAGCACTGAGTTCGG + Intronic
1055757433 9:79571566-79571588 TTAACGAAGAGGAATGAGGTTGG - Intergenic
1056667811 9:88595634-88595656 TGACACAAGAATAATGAGCTGGG + Intergenic
1059130537 9:111743603-111743625 AAGCACAAGAGTAATGAGGATGG + Intronic
1059814563 9:117897824-117897846 TCACAGAAGATAAATGACGTAGG + Intergenic
1060061110 9:120460567-120460589 TTGCAGCAGAGTAATGAGGTAGG - Exonic
1060455003 9:123784007-123784029 AAACAGAAGTATACTGAGGTAGG + Intronic
1060599227 9:124867010-124867032 GAACAGAAGAGAGATGAGGTGGG - Intronic
1061735865 9:132658214-132658236 TCACACAAGAGTAAGGAGCTTGG + Intronic
1061889563 9:133610673-133610695 AAACAGAAGAGTAAAGTGCTTGG + Intergenic
1187304012 X:18078688-18078710 TAAAAGCAGAGGAATTAGGTTGG - Intergenic
1190034343 X:47006593-47006615 AAACAGAAAAGTAATGGGCTGGG - Intronic
1190479752 X:50864353-50864375 TAAAAGAAGAGTATTTAGGCTGG - Intergenic
1192630637 X:72775512-72775534 TAAAAGAAGAATAGTGAGGGGGG + Intergenic
1192651073 X:72945292-72945314 TAAAAGAAGAATAGTGAGGGGGG - Intergenic
1192824101 X:74676789-74676811 TAAAAAAAGAGTAATGAGGAGGG - Intergenic
1193266432 X:79476454-79476476 TATCAGAAAAGTAATGAGAAAGG - Intergenic
1194497977 X:94640938-94640960 TAAAAGAAGTATAATGATGTTGG - Intergenic
1194662677 X:96644117-96644139 TTACATGAGAGTAATGAGATAGG - Intergenic
1195418286 X:104643906-104643928 TTACACAAGGGTAATGAGGTTGG + Intronic
1196092203 X:111756803-111756825 TAAATTAAGAGTAATGGGGTGGG + Intronic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1198141135 X:133804685-133804707 TAAAAGAAGAGGCATAAGGTAGG - Intronic
1199319928 X:146426235-146426257 TAACAGAAGAGACATGAGGTAGG + Intergenic
1199374900 X:147096863-147096885 TAAGAGAAGAGAAATGGGGTGGG + Intergenic
1199478437 X:148272230-148272252 CAACATAAGAGTAATGATGTAGG - Intergenic
1200336569 X:155357174-155357196 GAACAGACCAGTAATGAGTTTGG + Intergenic
1200349901 X:155484053-155484075 GAACAGACCAGTAATGAGTTTGG - Intergenic
1200692197 Y:6317637-6317659 AAACAGAAGCGTTATGAGTTGGG + Intergenic
1201043075 Y:9857090-9857112 AAACAGAAGCGTTATGAGTTGGG - Intergenic
1201186638 Y:11411163-11411185 GAAAAGGAGAGGAATGAGGTTGG + Intergenic