ID: 1149977887

View in Genome Browser
Species Human (GRCh38)
Location 17:61284883-61284905
Sequence TTCTGCTGTCCCTTCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149977887 Original CRISPR TTCTGCTGTCCCTTCTGAGG TGG (reversed) Intronic
902686037 1:18078256-18078278 TGCAGATGTCCCTTCTGGGGTGG + Intergenic
904947779 1:34212225-34212247 ATCTGCTGTCCCATCTGCTGTGG - Exonic
906254748 1:44339648-44339670 TTGTGCAGTCACTTCTCAGGTGG + Intronic
907538995 1:55194978-55195000 TTCTGGTGGCCCTTTGGAGGGGG - Intronic
907609385 1:55852749-55852771 TTCTGCTTTCTGTTCTCAGGAGG + Intergenic
907824696 1:58004201-58004223 TACTACTGACCCTTCTGGGGTGG - Intronic
910833768 1:91486772-91486794 TGCTGCAGTGTCTTCTGAGGAGG - Intergenic
912899367 1:113631081-113631103 TTCTGCTTTCCCTTGTGACAGGG + Intronic
913116329 1:115701030-115701052 TTCTCCTGTCCCTGCTAAGTGGG + Exonic
915048387 1:153040189-153040211 TTCTGCTGGCACTGCTGAGGTGG + Exonic
915049781 1:153056578-153056600 TTCTGCTGGCACTGCTGAGGTGG + Exonic
915050833 1:153070682-153070704 TTCTGCTGGCACTGCTGAGGTGG + Exonic
915052750 1:153093594-153093616 TTTTGCTGGCACTGCTGAGGTGG + Exonic
915054369 1:153112576-153112598 TTCTGCTGGCACTGCTGAGGTGG + Exonic
915056799 1:153140552-153140574 TTCTGCTGGCACTGCTGAGGTGG + Intergenic
915097170 1:153471315-153471337 TTCAGCTGTGCCTTTTGAGGTGG + Intergenic
916881137 1:169020309-169020331 TACTGATGTCCATTCTCAGGAGG + Intergenic
920052352 1:203171688-203171710 CTCTGCTGCCCCTCCTGAGAAGG - Intronic
923137628 1:231132395-231132417 CACTGCTTTCCATTCTGAGGGGG - Intergenic
923148023 1:231211277-231211299 TTCTGCTTTTCTTACTGAGGTGG - Intronic
1064561029 10:16595674-16595696 TTCTTCTGTGGCTTCAGAGGAGG - Intronic
1065885932 10:30076965-30076987 TTCTGCCTTCCCTTCTGGGCAGG - Intronic
1068908913 10:62357692-62357714 TACAGCTGTCCCTTTTCAGGTGG - Intergenic
1069917080 10:71793764-71793786 TTCTGGTTTCCCTCCAGAGGAGG - Intronic
1070821019 10:79354438-79354460 TGCTGCTGTCGTTTTTGAGGAGG + Exonic
1071236955 10:83660362-83660384 TTCTGATGTCCTTTCTGCTGAGG + Intergenic
1073445985 10:103580555-103580577 CTTTGCCGTCCCTTCTGCGGAGG + Intronic
1075316216 10:121455676-121455698 ATCTGCAGTCCCTTTCGAGGAGG - Intergenic
1075834413 10:125441582-125441604 TTCTACTGTGCCTTTTGAGCTGG - Intergenic
1076026335 10:127117657-127117679 TTCTGCTGTCACTTCTGGGTGGG + Intronic
1076674187 10:132139843-132139865 TTCTTCAGTCCCTTCTGCCGTGG - Intronic
1076707549 10:132309885-132309907 TTCTCCTGTTCCCTCTTAGGTGG - Intronic
1076909524 10:133379980-133380002 ATCTGCTGTCCCCTCGCAGGTGG + Exonic
1078340400 11:10494675-10494697 CTCTGCTGTTCCTTCACAGGGGG + Intronic
1079423065 11:20312618-20312640 TTCTGCTATGCCATCTGAAGGGG - Intergenic
1082220343 11:49627758-49627780 TTTTGCTCTTTCTTCTGAGGTGG + Intergenic
1084259735 11:67968184-67968206 TTCTCCTGTTTGTTCTGAGGAGG + Intergenic
1085844825 11:80053059-80053081 TTTTGCTTCCCCTTATGAGGGGG - Intergenic
1086582963 11:88420701-88420723 CTTGGCTGTCCCTGCTGAGGAGG + Intergenic
1088634000 11:111801828-111801850 ATCTGCTGTCCCCTCAGAGCTGG + Intronic
1088994485 11:114984760-114984782 TTCTCCTGTCCCCTCAGAGGTGG - Intergenic
1089297904 11:117480920-117480942 TTCCACTGACCCTTCTGGGGAGG - Intronic
1090956112 11:131514137-131514159 TTCTGCTATAGCTGCTGAGGTGG + Intronic
1091057641 11:132433724-132433746 TTCTGGTGTCTCTTCTGATAAGG - Intronic
1091801860 12:3329378-3329400 TTCAGCTGACTCTTCTGATGTGG - Intergenic
1092036665 12:5341639-5341661 TTCTGCAGGCCCTTCTGACAGGG - Intergenic
1092274069 12:7046012-7046034 TTCTGCTCTCCCTTGTGAAGGGG + Intronic
1092904140 12:13086970-13086992 TTCTTCCCTGCCTTCTGAGGGGG - Intronic
1093542183 12:20300378-20300400 CTATCCTGTCCCTTCTGAGTGGG - Intergenic
1093847096 12:23985983-23986005 TTCTTCTTTCCCATTTGAGGGGG + Intergenic
1094490652 12:30958565-30958587 TTCAGCTGACTCTTCTGATGTGG + Intronic
1094547038 12:31414458-31414480 TTCTTCTGTACCTTCTTCGGTGG + Intronic
1101177340 12:102167812-102167834 TTCTGCTTCCCATGCTGAGGTGG + Intronic
1101236387 12:102794312-102794334 TTCAGTTCTCCCTTCTGTGGAGG + Intergenic
1101976521 12:109364331-109364353 TTCTGCTGTTCTTTTTGAGCAGG + Intronic
1103339959 12:120215969-120215991 TTCTGGTCTCCCTTCTGGAGTGG + Intronic
1106879779 13:34116543-34116565 TCCTGCTGTCACTTCTTTGGTGG + Intergenic
1106904898 13:34395499-34395521 TTCTGCAGGCCCATCTGAGTTGG + Intergenic
1108000452 13:45901199-45901221 TCCTGCTCTCCATTCTGTGGTGG + Intergenic
1108946771 13:56036272-56036294 TAGTGCTTTCCCTTCTGAAGTGG + Intergenic
1109921453 13:69066737-69066759 TTTTTGTTTCCCTTCTGAGGAGG + Intergenic
1113014451 13:105812478-105812500 TTCCTCTGTGCATTCTGAGGTGG + Intergenic
1113552805 13:111206216-111206238 TTCGTCTGGCCCTTCAGAGGGGG + Intronic
1116080886 14:40170310-40170332 TTTTTCTGTCACTTCTAAGGAGG - Intergenic
1116133585 14:40891666-40891688 TTGGGCTGTTGCTTCTGAGGAGG - Intergenic
1117244976 14:53875724-53875746 TTCTGCTGCCCCTTGAAAGGGGG + Intergenic
1118383908 14:65239545-65239567 TTCTGGCCTCCCTCCTGAGGAGG - Intergenic
1119594080 14:75917713-75917735 AACTGCTGTCCCTTCGAAGGCGG - Intronic
1119851559 14:77870185-77870207 TTCTGGTTTTCCATCTGAGGAGG + Intronic
1120066535 14:80047470-80047492 TCCTCGTGTGCCTTCTGAGGTGG - Intergenic
1121492751 14:94371855-94371877 TCCTGCTGTCCCTCCTCAGGAGG + Intergenic
1122714414 14:103685790-103685812 TGCTGCTGTCCTTTTTGGGGGGG + Exonic
1124701532 15:31917761-31917783 TTCCCCTCTCCCATCTGAGGTGG + Intergenic
1125094787 15:35838666-35838688 TGCTGCTCTCACTTCTGTGGGGG + Intergenic
1128154973 15:65386331-65386353 TTCTGTTGGCCTTGCTGAGGAGG + Intronic
1131510940 15:93049142-93049164 TGCTGCTCCCCCTTCTGAAGGGG + Intronic
1131877473 15:96825812-96825834 TTCTGCTGCTGCTTCTAAGGTGG + Intergenic
1134036871 16:11037690-11037712 TTCTGCTATCCTCTCTGAAGCGG + Intronic
1137019558 16:35410729-35410751 TCCTGCTGTCTCTCCTGAGCTGG + Intergenic
1137922235 16:52501868-52501890 TTCTGCCTTCCCTCCTGGGGTGG + Intronic
1138824305 16:60300421-60300443 TTCTGGTGTCTCTTCTGACAAGG + Intergenic
1140406295 16:74713719-74713741 CCCTGCTGTCCCTTCTGGGGAGG - Exonic
1140944896 16:79758671-79758693 CTCTGCTCACCCTTCTCAGGTGG - Intergenic
1141467281 16:84214713-84214735 CACAGCTGTCCGTTCTGAGGCGG - Intergenic
1142551171 17:740823-740845 TTCTGCTTTTCCTTCGGAGATGG + Intronic
1143005499 17:3830515-3830537 AACTGCTGTTACTTCTGAGGAGG + Intronic
1143007672 17:3847338-3847360 GTCTGTTTTCCCATCTGAGGAGG + Intergenic
1143030665 17:3965180-3965202 TTCTCCTGGCCCTCCTGGGGCGG - Intergenic
1143538886 17:7558080-7558102 TTCTGCTGTACCTTGGGCGGAGG - Intronic
1143661041 17:8324799-8324821 TTCTGCTGGCCTGTCTAAGGGGG + Intergenic
1143892800 17:10115451-10115473 TTCTGCTGTCTTCTCTGGGGAGG - Intronic
1144402529 17:14919965-14919987 TTGAGCTGTCCCAGCTGAGGTGG + Intergenic
1145126946 17:20309254-20309276 TACTGCTGTCACTTCTGACTGGG - Intronic
1145769081 17:27479471-27479493 TCCTTTTGTTCCTTCTGAGGCGG + Intronic
1146788194 17:35735939-35735961 TGCTGCTGTCCCTTCTCCAGAGG - Intronic
1149977887 17:61284883-61284905 TTCTGCTGTCCCTTCTGAGGTGG - Intronic
1150092795 17:62343946-62343968 TTCTGCTTTCATTTCTGAGTAGG + Intergenic
1150190749 17:63235426-63235448 TTCTGATTTCCTTTCTCAGGTGG + Intronic
1150227340 17:63531172-63531194 CCCTGCTGTCCCTTCTCATGAGG + Intronic
1151111353 17:71681794-71681816 TTCTGCTGCCCTTCCTGAAGTGG + Intergenic
1151572509 17:74933927-74933949 CTCTGTTGTCCCGTCTGAGGTGG + Intergenic
1151880225 17:76890170-76890192 GACTGCAGCCCCTTCTGAGGGGG - Intronic
1152121227 17:78419947-78419969 TTCTGCTCTCCCTTCCCAGGGGG + Intronic
1152850211 17:82629414-82629436 CTCCGCTGTCCCTTCTGGGTGGG + Intronic
1153073210 18:1131131-1131153 CTATGATGTCCCTTCTGAGAGGG + Intergenic
1153323986 18:3799372-3799394 GCGTGCTGTCCCTTCTGCGGGGG + Intronic
1157172074 18:45416894-45416916 TTCTGATGTATCATCTGAGGAGG + Intronic
1157546517 18:48550405-48550427 TTCTGTTGTCCCTGCTGATTGGG + Intronic
1159602371 18:70440913-70440935 TTCTGATGTCTTTTCTTAGGAGG - Intergenic
1161164504 19:2778903-2778925 TTCTGCTGTCCAGTGTGAGCAGG + Intronic
1161374926 19:3934477-3934499 AGCTCCCGTCCCTTCTGAGGCGG - Intronic
1161437266 19:4271111-4271133 TTCTGCTGCCCCCGCCGAGGAGG - Intergenic
1161800581 19:6415142-6415164 TGCTGCTGTCCCTGCTGCGTGGG + Exonic
1164561110 19:29292859-29292881 TTCTGATGTCCCTTCTCCTGGGG - Intergenic
1164862439 19:31572806-31572828 TTCTGCTCTGTCTTCTGTGGAGG - Intergenic
1165778533 19:38418731-38418753 TGCTCCTCTCCCATCTGAGGAGG + Intronic
1165949555 19:39466461-39466483 TTCTGCTCGCCCTGCTCAGGTGG + Exonic
1167785211 19:51630300-51630322 TGCTGCTGCCCCTGCTGTGGGGG - Intronic
1167787310 19:51646724-51646746 TGCTGCTGCCCCTGCTGTGGGGG - Exonic
926195567 2:10761741-10761763 CTCTGCTGTCCCTTCTTATATGG + Intronic
928226697 2:29455414-29455436 TTCTGCTGTCCTGTGTGCGGGGG + Intronic
929774834 2:44922964-44922986 TTCTGGTGTAACTTCTGAGAGGG - Intergenic
931187905 2:59971581-59971603 CTCTGCTCTTCCTTATGAGGAGG - Intergenic
931255915 2:60572590-60572612 TTCTGCTGTTTCTTCTGCTGGGG - Intergenic
936153240 2:110032957-110032979 TCCTGCTGTGCTTTCTGAGCAGG + Intergenic
936371762 2:111907661-111907683 TTCTGCTGTTCCCCCTCAGGGGG - Intronic
936964711 2:118116367-118116389 TTCTCCTCTCCCTTTGGAGGAGG - Intergenic
938570532 2:132558269-132558291 CTCTGTTGTCTCTTGTGAGGAGG + Intronic
942043630 2:172086637-172086659 TTCTGCTGTCCCTCCAGGGGCGG + Exonic
942541560 2:177020565-177020587 TGCTGCTGTGCATTCTGAGGAGG - Intergenic
942967556 2:181915360-181915382 TTCTCTAGTCCCTTCTGAAGAGG - Exonic
946620307 2:221554997-221555019 TCTTGCTGTTCTTTCTGAGGTGG - Intronic
947330139 2:229020391-229020413 TTGTGCTGCTCCTTCTGAAGTGG - Intronic
947633015 2:231665895-231665917 TTCTGCTGTCTCATTTGTGGAGG - Intergenic
948546169 2:238730352-238730374 GTCTGAGGTCCCTACTGAGGAGG - Intergenic
948764333 2:240211863-240211885 TTCTGCTGACCCTGCTGAAATGG + Intergenic
1170251199 20:14285092-14285114 TTTTTCTTTCCTTTCTGAGGGGG - Intronic
1170462574 20:16591036-16591058 TTCTTCTATCCCTTGTGTGGAGG - Intergenic
1172166600 20:32903307-32903329 TTCTGCCGGCCTCTCTGAGGAGG - Intronic
1172704937 20:36876153-36876175 TTCTCCTGTCCCTGCTCAGCCGG - Exonic
1174538069 20:51268001-51268023 TGCAGCTGGCCCTGCTGAGGAGG + Intergenic
1174838572 20:53880575-53880597 TTCTGCTGGGCTTTTTGAGGAGG + Intergenic
1181307838 22:21927064-21927086 TGCTCCTGTCCCAGCTGAGGTGG + Intronic
1182226502 22:28802476-28802498 TTCTGATGTGCCTTCAGATGTGG + Intergenic
1183292388 22:37010679-37010701 TCCTGCTGTCCCATGTCAGGTGG - Intergenic
1183479893 22:38057655-38057677 CACTGCTGTCCCGTATGAGGTGG + Intronic
1184047190 22:41978838-41978860 CTCTGCTTTGCCTTCTGATGTGG - Intronic
950188871 3:10962488-10962510 TTCTCCTCTCCCTTCTGTGCTGG - Intergenic
951836503 3:26989041-26989063 TGCTGCTTTCCCTTCTCAAGTGG - Intergenic
953663095 3:44905344-44905366 TTCTGCTTTACATTATGAGGTGG - Intronic
953738469 3:45516233-45516255 TTTTGCTGCCCCTCCTGAGAAGG + Exonic
956579750 3:70797044-70797066 TTCTGCCTTCCCTGCTGAAGTGG - Intergenic
957128235 3:76190278-76190300 TTCTGGTGTCCCTCCCGAAGAGG + Intronic
957580895 3:82071949-82071971 TTCTGCATTTCCTTCTTAGGTGG + Intergenic
958034024 3:88149568-88149590 TTCTGCGGCCACTTCTGAGTTGG - Intronic
958151383 3:89698473-89698495 TTCTGGTGTCACTTCTAAGAAGG - Intergenic
959475674 3:106809244-106809266 TACTGCTGTCTCTTCTCAGCGGG - Intergenic
960026019 3:113010691-113010713 TTCTGATGACTCTTCTGTGGAGG + Exonic
960121854 3:113955185-113955207 TCCTGCATCCCCTTCTGAGGAGG - Intronic
961173637 3:124816589-124816611 TTCTGCTATCCCTTCTCTTGTGG - Intronic
968137119 3:196227642-196227664 TGCTCCTGCCCCTTCTGAGCAGG + Exonic
968442489 4:630960-630982 TTCAGCTGTCCCAGCTGAGGTGG - Intronic
969150569 4:5165561-5165583 GCCTGCTGTCTCTTCTGAGAAGG + Intronic
969730823 4:8956634-8956656 CTCTGCTGTCTGTCCTGAGGAGG - Intergenic
970260519 4:14219623-14219645 TTCTGCTTTCCATGCTGAGTTGG + Intergenic
971572890 4:28236051-28236073 TTCTGCTCTGTCTTCTGAAGAGG + Intergenic
972807440 4:42544714-42544736 TTCTGCCCTCAGTTCTGAGGAGG - Intronic
973331424 4:48913600-48913622 TTCTGCTTTCCCTTATGAGCTGG + Intergenic
973686837 4:53378246-53378268 TTTTTCTGTCGATTCTGAGGTGG + Intronic
975329777 4:73099983-73100005 TATTGGTGCCCCTTCTGAGGAGG - Intronic
976018934 4:80595810-80595832 TTCTGGTGTGTTTTCTGAGGTGG + Intronic
976767952 4:88618108-88618130 TTCTCCTTTCCCTTCAGATGAGG + Intronic
976987466 4:91319788-91319810 TTCTGCTGTGCCTTGTGAGAGGG - Intronic
980589875 4:134872046-134872068 TTCCTCTGTCCATTCTGAAGAGG + Intergenic
981583766 4:146276964-146276986 TTCTGCTGTCCCTTTTTCAGTGG - Intronic
986710815 5:10486778-10486800 CTCTGCTGTCTCTTCAGAGGAGG + Intergenic
990749028 5:58991953-58991975 TTCTCCTTTTCCTTCTGAGTTGG + Exonic
991125109 5:63061008-63061030 CTCTGTTGTCTCTTCTTAGGAGG - Intergenic
992363931 5:76072161-76072183 TTCTGCAGTGCCTTCTTTGGAGG - Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
994971851 5:106749206-106749228 TTCTGCTGTCCCTGCGAGGGAGG - Intergenic
996530771 5:124524663-124524685 TACAACTGTACCTTCTGAGGCGG + Intergenic
997077623 5:130698925-130698947 TGCTGCTTCCCATTCTGAGGTGG - Intergenic
997355279 5:133258794-133258816 TATTTCTTTCCCTTCTGAGGGGG - Intronic
1001255129 5:170177395-170177417 TTCTGCAGTCCTTTCTGTGCTGG - Intergenic
1001314481 5:170632687-170632709 TCCTGCTGTGCCTTCTCTGGGGG + Intronic
1001854802 5:175001664-175001686 TTCTACTGTACCTTCTAAGCAGG + Intergenic
1002080893 5:176736741-176736763 TTCTCCTGTCCTCCCTGAGGAGG + Intergenic
1005681555 6:28213682-28213704 TTCTTCTTTCCTTTCTCAGGAGG - Intergenic
1006180570 6:32151341-32151363 CTCTGCTGTTCCTTCAGTGGGGG + Intronic
1006752028 6:36384365-36384387 TTCTGTGGGCCCTTCTGAGATGG - Intronic
1007227488 6:40325302-40325324 TCCTGCTCTCCTTTCTGGGGAGG - Intergenic
1007337014 6:41161423-41161445 GGCTGCTGTCCTTCCTGAGGAGG - Exonic
1007780872 6:44253885-44253907 TTCTGCTTTCCCTTGTGAAGTGG + Intronic
1011091126 6:83601283-83601305 TACTGCTGTCACTGCTGAAGTGG - Exonic
1012896810 6:104958080-104958102 TTGTCCTGTTCCTTCTCAGGCGG + Exonic
1017549600 6:155491965-155491987 TTCTGCTGCCACTTTGGAGGAGG + Intergenic
1018593738 6:165455413-165455435 TTCTTCTGTCCCTTCCTACGTGG - Intronic
1018756958 6:166858203-166858225 TTCTGCAGTGTCTTCTGTGGTGG + Exonic
1018972580 6:168538955-168538977 TTCTGTTGTCCCATCCCAGGTGG + Intronic
1022258333 7:28681067-28681089 TTCTGCCATCCCTGCTGTGGGGG + Intronic
1022513978 7:30963951-30963973 CTCTGCTTCCCCTTCTCAGGTGG - Intronic
1024729724 7:52240727-52240749 TTGTGCTGTGGCTTCTGAGTTGG + Intergenic
1024764419 7:52640288-52640310 TACTGCAGTCTCCTCTGAGGTGG + Intergenic
1024814278 7:53249921-53249943 TTCTCCTATGCATTCTGAGGTGG + Intergenic
1028469756 7:91192508-91192530 GTCTGCAATCCCTTCTGAGAGGG + Intronic
1031691266 7:124790818-124790840 TTCTGCTTTCACTTCAGAGTTGG - Intergenic
1031874111 7:127118997-127119019 TGCTACTGTTCCTTCTGGGGAGG + Intronic
1032544177 7:132728084-132728106 TTCTCCTGTCTCTTTTGAAGAGG - Exonic
1033097642 7:138444703-138444725 TTCTACTCTCCCTGATGAGGGGG + Intergenic
1034258218 7:149736073-149736095 TTCTCCTTTCCCTTCTAAGCAGG + Intergenic
1034350414 7:150411509-150411531 TTCTGATGTTCATTCTGGGGAGG - Intronic
1034594549 7:152177361-152177383 TTCTGATGACCCTTCTGTGAAGG - Exonic
1036204142 8:6793154-6793176 TTCTGCTTGATCTTCTGAGGTGG + Intergenic
1037733056 8:21545301-21545323 TTCTGTTCTCCCTTCTGATTTGG - Intergenic
1037824227 8:22151447-22151469 TTCTGCTGGCCCTTGCTAGGGGG - Intronic
1039563541 8:38532072-38532094 CTCTGCTGTCCACTCTGTGGTGG - Intergenic
1041359077 8:57031141-57031163 TTCTACTCACCCTTGTGAGGTGG - Intergenic
1042831723 8:73036602-73036624 TTCTGGTATCCCTGCTGTGGGGG - Intronic
1043549022 8:81348040-81348062 TTCTGCTGTATTTTCAGAGGGGG - Intergenic
1046714229 8:117549681-117549703 TTCTTCTGTCCCTTCAGAAGTGG - Intergenic
1049304492 8:141893722-141893744 ATCTGCTGGCTCCTCTGAGGGGG - Intergenic
1049835222 8:144730948-144730970 TGCTGCTGTCTCCTCTGAGGGGG - Intronic
1050893582 9:10856318-10856340 TTCTGCTGACCATTCTGGTGAGG - Intergenic
1051050714 9:12928859-12928881 TGCTGCTGTGCTTTCAGAGGTGG + Intergenic
1054903192 9:70390931-70390953 TTCTCCACTCCCTTCTGATGTGG + Intronic
1057445428 9:95111264-95111286 TTCTCCTGTCCCCACCGAGGTGG - Intronic
1059049530 9:110908823-110908845 TTCTCGTGTCCCTTCTGAAATGG - Intronic
1060046588 9:120346347-120346369 CCCTGCTGTCCCCTCTGAGGAGG - Intergenic
1061893715 9:133636134-133636156 GGATGCTGTCCCTTCTGAGATGG - Intergenic
1061935110 9:133853222-133853244 TTCTGCTGCCCCTGCAGATGTGG + Intronic
1187298645 X:18027025-18027047 TTCTGCTGTTCGGTCTCAGGGGG - Intergenic
1187447622 X:19372999-19373021 TTCTGCTCTCCCTCCTGCTGTGG - Intronic
1187884684 X:23878412-23878434 TTCTTCAGTGCCATCTGAGGAGG - Intronic
1188056852 X:25551420-25551442 TTCTGGTGGACTTTCTGAGGAGG + Intergenic
1190257309 X:48773312-48773334 TTGTGATGTCCCTATTGAGGAGG + Exonic
1193384352 X:80853048-80853070 TTCAGCTCTCCCTTTTGAGAAGG - Intergenic
1194966382 X:100293337-100293359 TTCTGATGTCCCTTTTAAGGAGG - Exonic
1195083474 X:101392030-101392052 TTATCCTTTCCCTTCTGAAGAGG + Intronic
1195934553 X:110112405-110112427 TTCCGCCCTCCCTTCTGAGGTGG + Intronic
1197870652 X:131059466-131059488 TTCCTCTGTCCCTTCACAGGCGG + Intronic
1198762894 X:140052164-140052186 TTATGCAGTCTCTTCTCAGGAGG + Intergenic
1202135102 Y:21653091-21653113 TACAGCTGTCCTTTCTCAGGTGG - Intergenic