ID: 1149979732

View in Genome Browser
Species Human (GRCh38)
Location 17:61300444-61300466
Sequence GTAGGGCAAGTTTTAATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149979721_1149979732 30 Left 1149979721 17:61300391-61300413 CCTAAGCTCCCAGAAGGCATTAC 0: 1
1: 0
2: 2
3: 20
4: 320
Right 1149979732 17:61300444-61300466 GTAGGGCAAGTTTTAATTTAGGG 0: 1
1: 1
2: 2
3: 10
4: 159
1149979723_1149979732 22 Left 1149979723 17:61300399-61300421 CCCAGAAGGCATTACTCAGGTGA 0: 1
1: 0
2: 1
3: 9
4: 146
Right 1149979732 17:61300444-61300466 GTAGGGCAAGTTTTAATTTAGGG 0: 1
1: 1
2: 2
3: 10
4: 159
1149979724_1149979732 21 Left 1149979724 17:61300400-61300422 CCAGAAGGCATTACTCAGGTGAC 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1149979732 17:61300444-61300466 GTAGGGCAAGTTTTAATTTAGGG 0: 1
1: 1
2: 2
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149979732 Original CRISPR GTAGGGCAAGTTTTAATTTA GGG Intronic
902560911 1:17276955-17276977 GGAGGGCAAGTTTTAAAGCAGGG + Intronic
903101946 1:21037693-21037715 ATTGGGCTAGTCTTAATTTAGGG - Intronic
903304820 1:22405855-22405877 GTAGGTCTATTTTTAATTTTTGG + Intergenic
906309971 1:44746822-44746844 GTTGGTAAAGTTTGAATTTAGGG + Intronic
907173005 1:52488740-52488762 GTGTGGCAGGTTGTAATTTATGG - Intronic
908926471 1:69260891-69260913 GAAGGACAAGTTTTATTTTGTGG - Intergenic
913667503 1:121061793-121061815 GTAAGTAAAGTTTTAATCTAGGG + Intergenic
913716837 1:121543800-121543822 GTAGGGAAAGGTTTGATTTAGGG + Intergenic
914019196 1:143848936-143848958 GTAAGTAAAGTTTTAATCTAGGG + Intergenic
914657745 1:149757143-149757165 GTAAGTAAAGTTTTAATCTAGGG + Intergenic
917202117 1:172528618-172528640 ATAAGGCAAATTGTAATTTAAGG + Intergenic
917292155 1:173481520-173481542 ATAGGTCAAGTTATAAATTATGG + Intronic
917580884 1:176376709-176376731 TTGGGGCAAGTTCTGATTTATGG + Intergenic
922647069 1:227298517-227298539 GTAGGGCAAGGTTTAGGGTAAGG - Intronic
1063545557 10:6977704-6977726 GGAGGGCAACTTTTATTTAATGG - Intergenic
1065058346 10:21871054-21871076 ATAAGGCTAGTTTTAAGTTAAGG - Intronic
1067895397 10:50174194-50174216 GTAGGCCTAGTTTTAAATTAAGG - Intergenic
1067953586 10:50767784-50767806 GTAGGCCTAGTTTTAAATTAAGG + Intronic
1067963417 10:50882050-50882072 AAAGGGCATGTTTTAATTTTTGG + Intronic
1068027006 10:51658516-51658538 GTAGGCCAGGTTTGAATCTAAGG - Intronic
1069035562 10:63642659-63642681 GTAGGGAAATTTTCAGTTTAGGG - Intergenic
1069380352 10:67837861-67837883 GTATTTCAAGTTTTTATTTAAGG - Intronic
1074166401 10:110880327-110880349 GTAAGGGAAGTTTTAATGCAGGG + Intronic
1077982926 11:7319610-7319632 GTAGTGCAAGTTTGTATTAATGG + Intronic
1079000160 11:16746554-16746576 GTAAGGTAAGTGTTAGTTTAGGG + Intronic
1082690746 11:56301278-56301300 ATCAGGCAAGTTTTAATTGAAGG - Intergenic
1085116134 11:73933779-73933801 GAAGGGAAAGTTCTAACTTATGG - Intergenic
1085352495 11:75808549-75808571 ATCTGGCCAGTTTTAATTTACGG + Intergenic
1087643975 11:100785973-100785995 GTAGGGCAAGTTCTAGCTGATGG + Intronic
1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG + Intronic
1089648214 11:119894207-119894229 GAAAGGCAAATTTTAATTTTGGG - Intergenic
1096548763 12:52358851-52358873 ATAGGCCAACTTTCAATTTAGGG - Intergenic
1097373004 12:58807164-58807186 GAAGGGCATATTCTAATTTAGGG + Intronic
1098275203 12:68805680-68805702 GTTGGGTTAGTTTTAAGTTATGG - Intergenic
1098526291 12:71490829-71490851 GTAAGGCCAGTTTTATTTGATGG + Intronic
1099334719 12:81339965-81339987 GTTGGTTAAGTTTCAATTTATGG + Intronic
1099746048 12:86706677-86706699 CTAGGGCAATTCATAATTTAGGG - Intronic
1102770914 12:115475033-115475055 GAAGGACAAGAATTAATTTATGG - Intergenic
1105843604 13:24276086-24276108 GTAGTTCTAGTTTTAATTTTTGG - Intronic
1107390799 13:39961789-39961811 GAAGGGAAAGTTTACATTTATGG + Intergenic
1107676583 13:42804022-42804044 GTAGAGCAAGTCTTCTTTTAAGG - Intergenic
1107762409 13:43694666-43694688 GTAGGCAAAATTTTAATTTATGG + Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1110391456 13:74979833-74979855 GAAGGGCAGGATGTAATTTATGG + Intergenic
1111766483 13:92536659-92536681 GTAGGGAAATTGTTAAATTATGG + Intronic
1115063078 14:29218131-29218153 ATAGTTGAAGTTTTAATTTAAGG + Intergenic
1115732583 14:36287425-36287447 GAAAGGCAAGATTTAATTTGTGG - Intergenic
1117181129 14:53192949-53192971 GGATGGCAAGTCTAAATTTAAGG + Intergenic
1124798491 15:32806261-32806283 GTAGGGCCAGGTTTAATAAAAGG - Intronic
1126043627 15:44617632-44617654 GTAGGGCAAGTTCTTTTTCAGGG + Intronic
1126828063 15:52570958-52570980 GAAGGGGAAGTTTGAATTTCTGG + Intergenic
1128834732 15:70799991-70800013 GCAGGGCATGTTTTAACTGACGG - Intergenic
1130642219 15:85688401-85688423 GTAGGTCTAGTTTTATTGTATGG - Intronic
1131642217 15:94304748-94304770 GTATGTCAAGTTCTAATTTGTGG - Intronic
1133585538 16:7190747-7190769 GTAGAGCAAGTTTTTAATTCGGG + Intronic
1136021315 16:27442078-27442100 GAAGGGCAAGTTTCAATATGAGG - Intronic
1139115838 16:63951119-63951141 CTTGGGCAACTTTTCATTTAAGG + Intergenic
1139355676 16:66365999-66366021 GTAGGGGATGTTTGCATTTAGGG - Intergenic
1145285301 17:21501288-21501310 GAAAGGCATGTTTTAAGTTAAGG - Intergenic
1145392224 17:22464458-22464480 GAAAGGCATGTTTTAAGTTAAGG + Intergenic
1149979732 17:61300444-61300466 GTAGGGCAAGTTTTAATTTAGGG + Intronic
1150860386 17:68795379-68795401 GTAGGTCAAGGGTTAATTTTTGG - Intergenic
1153396442 18:4627068-4627090 GTAGGGCTGTTTTTAATTCAAGG - Intergenic
1155372888 18:25121746-25121768 GCAGAGCAACCTTTAATTTAGGG - Intronic
1155946048 18:31852619-31852641 GAAGGGAAAGTTTTGCTTTAAGG - Exonic
1156742162 18:40344422-40344444 ATAGGGAAAGTATTATTTTATGG + Intergenic
1158207884 18:55013830-55013852 GTGGTGCAAGCTTTATTTTAGGG - Intergenic
1159157501 18:64602864-64602886 GTAGGGCAAGGTTTATTTTAAGG + Intergenic
1159435659 18:68413739-68413761 GTACGGCAATATTTTATTTAAGG + Intergenic
1163923782 19:20319593-20319615 GAAGGTCTAGTTTAAATTTAAGG - Intergenic
926432605 2:12804283-12804305 ATAGGCCTAGTTTTATTTTATGG + Intergenic
927129266 2:20043642-20043664 GCAGATCAAGTTTTATTTTAGGG + Intronic
932333762 2:70917636-70917658 GTATGGCATGTTTTAATATTTGG + Intronic
933332348 2:80909872-80909894 GTAGGTAAAGAATTAATTTAAGG + Intergenic
935796753 2:106649353-106649375 ATGTAGCAAGTTTTAATTTAAGG - Intergenic
938937737 2:136142146-136142168 GCAAGGCAGGTTTTAATTAATGG - Intergenic
939433312 2:142139888-142139910 CTATGACAAGTTTTCATTTAGGG + Intergenic
940792185 2:158040812-158040834 GTAGGATAAGATTTGATTTAGGG + Intronic
941473295 2:165917234-165917256 GTAGGTCAAGTTTTAATTTAAGG - Intronic
945644702 2:212476089-212476111 ATGTGGCATGTTTTAATTTATGG - Intronic
947136646 2:226982717-226982739 TTAGGGCAAATTTCAATTTCTGG - Intronic
947468528 2:230377622-230377644 GTTGGGCATGTTTTATTTTGGGG + Intronic
947764128 2:232624941-232624963 GTGGGGCAAGTTGTAATTTTAGG - Intronic
1169621878 20:7516251-7516273 ATAGGGACACTTTTAATTTAGGG - Intergenic
1173384255 20:42573531-42573553 GTAGCCCAAGTTTGAATTGAAGG + Intronic
1173656048 20:44700960-44700982 GGCAGGCAAGTTTTGATTTAGGG + Intergenic
1176935607 21:14862950-14862972 TTAGGTTAGGTTTTAATTTATGG + Intergenic
1178166498 21:29984249-29984271 ATCTGGCAAGTTTTGATTTAGGG - Intergenic
1178179886 21:30147470-30147492 ATAGTTCATGTTTTAATTTATGG + Intergenic
1180579620 22:16819574-16819596 GTAGGGTGAGTTTTATGTTAAGG - Intronic
1181536408 22:23548590-23548612 ATATGGCAAGTTGTAATGTAGGG + Intergenic
1182310427 22:29401224-29401246 TTAGGGAAACTTTGAATTTATGG - Intronic
1182690853 22:32161113-32161135 TTAGGGAAACTTTGAATTTATGG + Intergenic
1183581456 22:38728968-38728990 CTAGGGCAAGTGTTAACTCAGGG - Intronic
949280185 3:2336953-2336975 GTGGGTCAAGTATTAATTGATGG + Intronic
951622703 3:24623612-24623634 ATATGGCAAATTTTAATTCAAGG - Intergenic
951626234 3:24666836-24666858 GAAGGGCAAAATTTAATTTAAGG - Intergenic
955868774 3:63415310-63415332 ATAAAGCAAATTTTAATTTATGG - Intronic
956272694 3:67464733-67464755 GTAGGGCATCTGTTAATATATGG - Intronic
958816223 3:98919100-98919122 ATAGGGCAAGTGTGAATTGAAGG + Intergenic
959867140 3:111283708-111283730 GAAGGGTAAGTCTTAATTTGGGG + Intergenic
960350883 3:116591243-116591265 GTGGGGGTAGTTTTTATTTAAGG - Intronic
961764658 3:129200004-129200026 GTAGAGCTACTTTTAATTTCTGG + Intergenic
961960835 3:130853564-130853586 GGAGGGCAAGTTGTAAGTAAAGG - Intronic
962128888 3:132651597-132651619 GTAGGTCAAGTATTGATTGAAGG - Intronic
962276522 3:134018684-134018706 CAAGGGCAAGTTTTATTTTAAGG + Intronic
965780786 3:172283817-172283839 GTATGTCAACTTTTGATTTATGG + Intronic
967951207 3:194842287-194842309 GAAGTGAAAGTTTTAATTTTGGG + Intergenic
969864906 4:10068918-10068940 GTGGGTCAAGTATTCATTTAGGG + Intergenic
970059132 4:12010723-12010745 GTGGGTCTAGTTTTAAATTATGG - Intergenic
970181352 4:13398866-13398888 GTAGGGCTAATTATAATATATGG - Intronic
970922778 4:21414533-21414555 GTAGTTCTAGTTTTAATTTTTGG - Intronic
976028158 4:80716973-80716995 GTTGTGCAGGTTTAAATTTAGGG - Intronic
976272943 4:83248662-83248684 GTAGGGACAGTTTGCATTTATGG - Intergenic
978235102 4:106448111-106448133 ATAGGGCAAATTTTCATTCAGGG + Intergenic
978727555 4:111987234-111987256 GTAAGAGAAGTTTAAATTTAAGG + Intergenic
978993547 4:115119405-115119427 GTAGGGGAAATGTTAATTTCTGG - Intergenic
979290056 4:118969528-118969550 GAAGGCCAACTTTTCATTTATGG + Intronic
981013200 4:139947599-139947621 GGAGGGCTGATTTTAATTTATGG + Intronic
981836448 4:149059978-149060000 GTAGTGCTATTTTTAATTTTTGG + Intergenic
986528110 5:8702944-8702966 GTAGAGCAAGTTTAAATACATGG + Intergenic
989852874 5:46237713-46237735 GAAAGGAAAGTTTTAACTTAAGG + Intergenic
989961721 5:50423961-50423983 ATAGGGAAAGGTTTGATTTAGGG - Intronic
990689743 5:58350243-58350265 GTAGGTAAAGTTTGAATTTAAGG + Intergenic
992938662 5:81739207-81739229 CTAGGTCAAGTTGTCATTTAAGG + Intronic
995292040 5:110468457-110468479 TTAAGGCAAGCTTTTATTTAGGG - Intronic
996176560 5:120366709-120366731 GTAGGGCAACTTTCATTTAAAGG - Intergenic
996320728 5:122212200-122212222 CTGGGGTAAGTTTTAAATTAGGG + Intergenic
997265314 5:132491488-132491510 GTAGGGCTACTATTATTTTATGG - Intergenic
1003759054 6:9154088-9154110 GTAGAGCCATTTTTATTTTAGGG + Intergenic
1004020382 6:11771148-11771170 GTAAAGCAAGTTTTTATTGATGG - Intronic
1004661706 6:17716450-17716472 GGAGGGCAAATTTTAAATTCTGG + Intergenic
1010527267 6:76917342-76917364 GCAGGGCAAGGTGTAATTCAAGG + Intergenic
1014232203 6:118916394-118916416 ATAGGGATAGTTTTATTTTATGG - Intronic
1017240074 6:152158056-152158078 ATAGAGCAACTTTTAATGTAGGG + Intronic
1018395710 6:163376656-163376678 GTAGAGCAAGTTTTAAACTTAGG + Intergenic
1019833858 7:3360834-3360856 GTGGGGGGAGTTATAATTTAGGG + Intronic
1020889034 7:13855666-13855688 GTAGCTCAATTTTTAATTTTTGG + Intergenic
1021041696 7:15870891-15870913 GTATGACAAGTCTTTATTTAAGG - Intergenic
1021538385 7:21730076-21730098 GTAGCTCAATTTTTAATTTGAGG - Intronic
1026531879 7:71206633-71206655 GTAGGGGAAGTTTTATTGTCAGG + Intronic
1028727447 7:94103685-94103707 GTAGGGCAGGTTTTATGTTTAGG + Intergenic
1029221079 7:98991013-98991035 ATTGGGCATGTTTTAGTTTAAGG - Intronic
1029854497 7:103501532-103501554 GTATGGCATATTTTAATATAAGG - Intronic
1031659954 7:124410986-124411008 TTAGGGCATGCTTTAAATTAAGG + Intergenic
1033934183 7:146562357-146562379 TTAGCACAAGTTTTAATTAATGG - Intronic
1036295358 8:7530382-7530404 TGAGGTCAAGTTTTAATTTCTGG + Intergenic
1036327212 8:7790636-7790658 TGAGGTCAAGTTTTAATTTCTGG - Intergenic
1036497464 8:9282529-9282551 GCAGGAAAAGTTATAATTTAAGG - Intergenic
1036657672 8:10688311-10688333 GTTGGGCCAGTTTTAATAAATGG + Intronic
1037120913 8:15286099-15286121 GTAGGGCAAGATAAACTTTAAGG + Intergenic
1040128974 8:43772147-43772169 GTAAAGAAAGTTTTAATTTTGGG - Intergenic
1042399302 8:68327948-68327970 GTAGGGCAAGGTTTTAGTTCAGG - Intronic
1044559681 8:93600783-93600805 GTAGAACAAATTTTAATATATGG - Intergenic
1048020956 8:130538530-130538552 GCAGGGGAAGGTTTAACTTAGGG + Intergenic
1052419351 9:28222492-28222514 CTAAGTCAAGTTTTAATTTAAGG - Intronic
1053032286 9:34791000-34791022 GTAGGCCAAGTTTAAACTTGGGG + Intergenic
1056311421 9:85345421-85345443 GAAGGGTAAGGTTTATTTTAGGG + Intergenic
1059012815 9:110481020-110481042 GTAGGACAAGATTCAGTTTAAGG - Intronic
1185813019 X:3128225-3128247 GTGCGGCAAGTTTTAATCAAAGG - Intergenic
1186251157 X:7668314-7668336 GTTGGTCTAATTTTAATTTAGGG - Intergenic
1186636908 X:11416109-11416131 GGAGGGCACATTTTTATTTAAGG - Intronic
1188246280 X:27839837-27839859 GTAGGGCAGATTGTAAGTTAGGG - Intergenic
1188491144 X:30740015-30740037 CTAGGGCAAGTTTTAATTTTGGG + Intergenic
1188647164 X:32583512-32583534 TTATGACAAGTTTTAATATATGG - Intronic
1188658428 X:32729323-32729345 TTGGGGCAAGTTTTATTATAGGG + Intronic
1188943932 X:36273987-36274009 GTAGTTCACGTTTTAATTGAAGG - Intronic
1189958455 X:46301638-46301660 ATAAGGCAAGTTTAAAATTATGG - Intergenic
1195380690 X:104268164-104268186 GTAGAGCTAGTTTTCATTTCTGG + Intergenic
1196068892 X:111497440-111497462 GTAGGCCAAGCTTATATTTAGGG - Intergenic
1198139907 X:133792171-133792193 ATAAGGCAAATTTAAATTTATGG - Intronic
1200366371 X:155669620-155669642 GTAGGGCATGTTCAAAATTAGGG + Intronic
1201268585 Y:12232366-12232388 GTGTGGCAAGTTTTAATTAAAGG + Intergenic