ID: 1149979897

View in Genome Browser
Species Human (GRCh38)
Location 17:61302128-61302150
Sequence TGGCATGGCAAGAGTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149979897_1149979906 19 Left 1149979897 17:61302128-61302150 CCTGTCCCACTCTTGCCATGCCA 0: 1
1: 0
2: 4
3: 32
4: 262
Right 1149979906 17:61302170-61302192 CCCCCCTCCCCCGACTCCCAGGG 0: 1
1: 0
2: 6
3: 72
4: 807
1149979897_1149979904 18 Left 1149979897 17:61302128-61302150 CCTGTCCCACTCTTGCCATGCCA 0: 1
1: 0
2: 4
3: 32
4: 262
Right 1149979904 17:61302169-61302191 TCCCCCCTCCCCCGACTCCCAGG 0: 1
1: 0
2: 13
3: 155
4: 1097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149979897 Original CRISPR TGGCATGGCAAGAGTGGGAC AGG (reversed) Intronic
900182626 1:1319004-1319026 TGAAATGGCCAGAGTGGGACAGG - Intronic
900596273 1:3481552-3481574 TGGCACAGCAAGAGGAGGACTGG + Intergenic
904005996 1:27363616-27363638 TGGGATGTCAGGAGTGGGACAGG - Intronic
904295277 1:29516265-29516287 TGGAATGGCAGGCGTGGGGCTGG + Intergenic
904326817 1:29731916-29731938 TGGCAGGGCAGGAGTGGAACCGG - Intergenic
904335030 1:29791420-29791442 TGGAATGGCAGGTGTGGGGCTGG + Intergenic
905285821 1:36879687-36879709 AGGCAGGGCAGGAGTGGGTCAGG + Intronic
905863603 1:41365434-41365456 TGGCATGGGAAGGGTGGAATGGG + Intronic
907932672 1:59015167-59015189 TGGCAGAGCAAGCCTGGGACTGG - Intergenic
908005766 1:59727045-59727067 TGGGATGTCTAGAGGGGGACAGG - Intronic
908616964 1:65932279-65932301 TGTCATGGGAAGAGTTGGAAAGG + Intronic
908892309 1:68861462-68861484 TGCAAGGGCAAGAGTGAGACTGG + Intergenic
908896247 1:68903599-68903621 AAGCAAGGCAAGAGTGGGAGAGG + Intergenic
910609920 1:89129661-89129683 TGCCATGGCAAAACTGGGAAGGG + Intronic
911693550 1:100862442-100862464 TAGAAGGGCAAGAGTGGGACAGG - Intergenic
913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG + Intergenic
914261396 1:146002227-146002249 TGTCATGGCAAGATGGGGAGAGG + Intergenic
914977510 1:152379800-152379822 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
915999967 1:160606195-160606217 GAGCATGGCAGGAGTGAGACTGG - Intergenic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917733310 1:177897804-177897826 GGGCATGGCAGGGCTGGGACTGG - Intergenic
918127906 1:181600434-181600456 TGGCAGGGCAAGAGTGGAGGCGG + Intronic
918229428 1:182514664-182514686 TTGGAGGGCAAGAGTGAGACTGG + Intronic
920054768 1:203183904-203183926 TGGGAGGGCATGATTGGGACAGG + Intronic
920057171 1:203201258-203201280 TGGTATGGCAAGAGTGGAAGAGG + Intergenic
920610964 1:207437563-207437585 TGGCATGGTGAAAGTGAGACAGG + Intergenic
921328990 1:214016582-214016604 TGGCTTGTCAACGGTGGGACTGG - Intronic
922501072 1:226097260-226097282 TGGCATGGGAAGAGAGGGCATGG + Intergenic
923262401 1:232279655-232279677 TGGGATAACAAGAGTGGGCCTGG + Intergenic
1063616572 10:7605256-7605278 TGGCATGAGAAGAGGGGGATTGG - Intronic
1063906835 10:10788864-10788886 TGGCATGGAAAGATTGGAGCTGG + Intergenic
1064908170 10:20370357-20370379 GGGCATGGTGAGAGTGAGACTGG - Intergenic
1066962378 10:42234595-42234617 TGGCATGGCCAGTGCAGGACAGG + Intergenic
1067295488 10:44973149-44973171 TGGGATGGCAGGAGAGGGAGGGG - Intronic
1068310174 10:55265135-55265157 TGGAGGGGCAAGAGTGAGACTGG - Intronic
1068779102 10:60900190-60900212 TGGCAAGGTAAGAGTGGGAGAGG + Intronic
1069517813 10:69093196-69093218 TGGCAAGGCCAAATTGGGACAGG + Intronic
1069594642 10:69662882-69662904 TGGCAAGGCAAGAGTTGGTCTGG - Intergenic
1070163527 10:73880876-73880898 TGGTGTGGCCAGAGTGGGCCAGG + Intergenic
1072415185 10:95241407-95241429 AAGCATGGCAAGAGAGGGGCGGG - Intronic
1074592812 10:114829436-114829458 TGTCATGGCACTAGTGGGAGTGG + Intronic
1075556751 10:123438283-123438305 TGCCATGGGAAGACAGGGACAGG + Intergenic
1075673652 10:124281336-124281358 TAGCATGGCAAGAGGAGGTCAGG + Intergenic
1075742999 10:124707057-124707079 TGGCATGGCAGGGGTGGGCGGGG - Intronic
1076611241 10:131727138-131727160 TGGGATGGCAGGTGTGAGACAGG - Intergenic
1076813278 10:132899970-132899992 TCACATGGCAAGGGTGGGAGTGG + Intronic
1077178218 11:1200115-1200137 TGAGATGGCAAGGGTGGGGCTGG + Intronic
1077213113 11:1382630-1382652 AGGCAGGGCGGGAGTGGGACGGG + Intergenic
1077712757 11:4552742-4552764 TGAAAGGGCAAGAGTGAGACTGG - Intergenic
1079028547 11:16967957-16967979 TGGCATGGAAAGAGGGGCTCAGG + Intronic
1079059587 11:17236516-17236538 TGACATGGCAAGATTGGCAATGG + Intronic
1079863206 11:25700517-25700539 TGGCTAGGCAAGAGTAGGTCAGG + Intergenic
1080636364 11:34127297-34127319 TGGCAGGGCAAAAATGGGATGGG - Intronic
1080848232 11:36045065-36045087 TGGAGTGGCAAGAGGGGGTCAGG - Intronic
1083839584 11:65296457-65296479 TTGTTTGGCAAGAGGGGGACTGG - Intronic
1084106912 11:66986260-66986282 TGGCCTGGCTGGGGTGGGACAGG - Intergenic
1084190911 11:67498359-67498381 TTGGATGGCAGGAGTGGGTCTGG - Intronic
1085391048 11:76182423-76182445 GGGCATTGCAAGAGAGGAACAGG - Intergenic
1085982189 11:81737882-81737904 TGGCCTGGCTAGAGAGGGAAAGG - Intergenic
1087461661 11:98455043-98455065 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
1089297964 11:117481142-117481164 TGGGATGGGAAGGGTGGGGCAGG + Intronic
1089954259 11:122555893-122555915 TGGCATGGCGGGAGTGAGACTGG - Intergenic
1090349769 11:126100577-126100599 TGTGATGGCAAGAGTGAGATGGG - Intergenic
1090418482 11:126557208-126557230 TGGCAGGGAAAGAGTCGGGCAGG - Intronic
1091249023 11:134126108-134126130 TGGGAAGACAAGGGTGGGACAGG - Intronic
1091895700 12:4102457-4102479 TGGCAGGGGAAGAGAGGGAGAGG + Intergenic
1092007168 12:5079393-5079415 TGGCAGGTCAAGGGTGGGGCCGG - Intergenic
1092940937 12:13406245-13406267 TGCCATGGCAAGATAGGGAGAGG + Intergenic
1092969700 12:13681015-13681037 TGGCATGGCCAGAGTCAGAGAGG - Intronic
1093628950 12:21385772-21385794 TGGCATGACAAGACAGGGAAAGG + Intronic
1095615120 12:44179522-44179544 TGGCAAGGGAAGAGTGAGAGTGG + Intronic
1095785718 12:46106747-46106769 TGGCATGGGAAGAGAGAGAGTGG + Intergenic
1096956328 12:55529811-55529833 TGGCATGGTGGGAGTGAGACTGG + Intergenic
1097288895 12:57897579-57897601 AGGCAAGGCAGGAGGGGGACAGG + Intergenic
1097561951 12:61218611-61218633 AGGCAGGAGAAGAGTGGGACAGG - Intergenic
1098651427 12:72975349-72975371 GGGCATGGCAAAGGTGGGAAGGG + Intergenic
1099527096 12:83729220-83729242 TGGCAGGGAAAGGATGGGACAGG - Intergenic
1101216946 12:102594837-102594859 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
1101455524 12:104826625-104826647 TGGAAAGGCAAGAGTGAGACTGG - Intronic
1102691845 12:114767314-114767336 TGGCATTGCAAGGGTGTTACTGG + Intergenic
1102787960 12:115619558-115619580 TGCAATGGCAAGGATGGGACAGG - Intergenic
1103367073 12:120391034-120391056 TGCCATGGGAAGAGGGGGGCAGG - Intergenic
1104621918 12:130320403-130320425 TGGGAGGGCCAGAGAGGGACAGG + Intergenic
1104820155 12:131672439-131672461 TGGCGTGGAAAGTGGGGGACAGG + Intergenic
1106042511 13:26106904-26106926 TTGTATGGCAAGATAGGGACAGG - Intergenic
1106917668 13:34532343-34532365 TGAAATGGGATGAGTGGGACAGG + Intergenic
1106924577 13:34600614-34600636 TGTCATGGAAGGAGTGAGACAGG + Intergenic
1108684234 13:52804849-52804871 TGGAATGGAAAGGTTGGGACTGG + Intergenic
1109924620 13:69120102-69120124 GGGCATGGCAGGAGTGAGACTGG + Intergenic
1111748538 13:92298152-92298174 GGGCACGGCAGGAGTGAGACTGG - Intronic
1111996818 13:95173593-95173615 TTGCATGGCAAGGGTTGGAAAGG + Intronic
1112880534 13:104101566-104101588 AGGGATGGAGAGAGTGGGACGGG + Intergenic
1113469173 13:110532154-110532176 TGCCAGGGCAAGAGTGGGGCTGG + Intronic
1116352069 14:43875517-43875539 TGTCATGGCACCAGTGGGAGTGG - Intergenic
1119182529 14:72614455-72614477 TGGGAAGGGAAGAGGGGGACTGG - Intergenic
1119324837 14:73753686-73753708 TGGCCAGGCAAGGGCGGGACAGG + Intronic
1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG + Intronic
1119771104 14:77221080-77221102 AGGCAGGGCATGAGTGGGAGGGG - Intronic
1120022219 14:79543594-79543616 TGGCATGACAAGGTTGGCACAGG + Intronic
1120400366 14:84023153-84023175 GGGCATGGTAAGAGTGAGACCGG - Intergenic
1121368820 14:93338298-93338320 TCACATGGCAAGAGATGGACTGG - Intronic
1124037878 15:26072984-26073006 TGTCAGGGCAAGAGTGGGGTGGG - Intergenic
1125255033 15:37753390-37753412 TGGCATGGCAAGAGGTGGAAGGG + Intergenic
1125386596 15:39143179-39143201 GGTCATGGCTAAAGTGGGACAGG + Intergenic
1127031580 15:54870535-54870557 AGGAAAGGCAAGAGTGGGGCAGG - Intergenic
1127089948 15:55457216-55457238 TGGCATGGCCAGAGTGAGACTGG + Intronic
1127683098 15:61316490-61316512 TGCCATGACAAGAGTGGGAGGGG - Intergenic
1128048329 15:64639711-64639733 TGGCAGGGGAAGGGTGGGACAGG + Intronic
1128251269 15:66165808-66165830 TGGCCTGGCAGGACTGGGACAGG - Intronic
1128349848 15:66881497-66881519 GCGCATGGCAGGAGTGGGGCAGG + Intergenic
1130652894 15:85772383-85772405 TGGCAGGGCCAGGGTGGGGCAGG - Intronic
1131080184 15:89527860-89527882 TCTCATGGCAAGACTGGGAGAGG + Intergenic
1131603455 15:93874945-93874967 TGGCCTGTGAAGAGTGGAACAGG + Intergenic
1132138083 15:99364025-99364047 TGGCATGGAAAGAGGGGTAATGG - Intronic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1132838650 16:1967443-1967465 TGGGAGGGCAGGAGTGAGACTGG + Intronic
1133848899 16:9483407-9483429 TGGAGGGGCAAGAGTGAGACAGG + Intergenic
1134349897 16:13427109-13427131 TGGCATTGCAAGAGGGGAAAGGG + Intergenic
1137589083 16:49682442-49682464 TGGCATTGCAAGTGTGGACCGGG - Intronic
1139026298 16:62822544-62822566 TCACATGGCAAGAGAGAGACTGG - Intergenic
1139427457 16:66891645-66891667 TGGCCTGGAATGAGTGGGGCTGG + Intronic
1139794781 16:69473667-69473689 TGACATGGCACAAGTGTGACAGG - Intergenic
1141644737 16:85361449-85361471 TGGCCTGGAAAGAGGGAGACGGG - Intergenic
1203078601 16_KI270728v1_random:1135140-1135162 TGGCAGGGGAAGAGTGGACCTGG + Intergenic
1146540257 17:33687489-33687511 TGGCAGGGAAAGAGAGGGGCTGG - Intronic
1147255038 17:39176335-39176357 TGACATGGCAGGGGAGGGACTGG - Intronic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1150475677 17:65472631-65472653 TGCCCTGGCAGGACTGGGACTGG + Intergenic
1151577569 17:74960372-74960394 TGGCTTGGAAAGAGTGGGTGTGG + Intronic
1153072010 18:1116657-1116679 GGGCATGGTAGGAGTGAGACTGG - Intergenic
1154167678 18:12028246-12028268 TGACGTGGAAAGAGTGGGAGGGG + Intronic
1155786975 18:29913886-29913908 TGGAGGGGCAAGAGTGAGACTGG - Intergenic
1157563580 18:48664738-48664760 TGGCATGGCTAGAGGGGGCTGGG - Intronic
1161236746 19:3201998-3202020 TGGCATGGAGTGAGTGGGGCAGG - Intronic
1161627819 19:5337408-5337430 TGGGATGGCCGGAGAGGGACGGG - Intronic
1162189670 19:8934985-8935007 TGTCTTGGCCACAGTGGGACTGG + Exonic
1162806648 19:13140725-13140747 TGGCAGGGCAAGGGGGGTACAGG - Exonic
1163418731 19:17202516-17202538 TGGCATGGCATGGGTGGGTGTGG - Intronic
1163681292 19:18683959-18683981 TGGCACGGCCCGAGGGGGACAGG + Intronic
1166559293 19:43721043-43721065 TGGCATGGTGAGAGAGTGACTGG + Intergenic
1166676964 19:44746709-44746731 TGGGATGCCAGGAGTGGGACAGG + Intergenic
925516263 2:4686262-4686284 TGGAATGTCAAGAGTAAGACTGG + Intergenic
925829567 2:7881275-7881297 TTGCATGGAAAGAATGTGACTGG + Intergenic
926061670 2:9808551-9808573 TGGCATGCCAAGCCTGGGGCTGG - Intergenic
927143458 2:20145201-20145223 GGGCATGGCAGGAGCGGGGCTGG + Intergenic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
929533904 2:42768670-42768692 TGGGAGGGCAAGAGTGGTGCAGG - Intronic
930258497 2:49118444-49118466 TCACATGGCAGCAGTGGGACCGG + Intronic
930647626 2:53928826-53928848 TGGCATGGAAAGAGTTGGTAAGG - Intronic
932290368 2:70572092-70572114 TGACCTGGCAAGAGGGGGAGTGG + Intergenic
933755606 2:85635942-85635964 TGGCATGGCCAGAGAGGAAGGGG + Intronic
934274730 2:91566711-91566733 TGGTATGGCCAGTGTAGGACAGG + Intergenic
934572857 2:95383381-95383403 TGGACTGGCAGGGGTGGGACTGG - Intronic
937065227 2:119012374-119012396 TGGACTAGGAAGAGTGGGACGGG + Intergenic
937256095 2:120556855-120556877 GGACATGGCAGGAATGGGACTGG + Intergenic
940831941 2:158476356-158476378 GGGCTGGGCAAGAGTGAGACTGG - Intronic
943285552 2:185994318-185994340 TGGCAGAGCATGTGTGGGACTGG + Intergenic
946136173 2:217648995-217649017 AGGAATCACAAGAGTGGGACGGG + Intronic
946277980 2:218644876-218644898 TGGCAAGGGTAGAGTGGGGCCGG + Exonic
948577403 2:238963759-238963781 CGGCATGGCAGGACTGGGGCTGG - Intergenic
948869618 2:240791611-240791633 GGGCTGGGCAAGGGTGGGACAGG - Intronic
1170560411 20:17552342-17552364 CATCATGGCAAGAGTGGGGCAGG + Intronic
1170865277 20:20150038-20150060 GAGCATGGCAAGAGCGAGACTGG + Intronic
1171339994 20:24420159-24420181 GGGCCAGGGAAGAGTGGGACGGG + Intergenic
1173442832 20:43093760-43093782 GGTCAAGGGAAGAGTGGGACAGG - Intronic
1174075664 20:47934205-47934227 TGGGATGGCAATGGGGGGACAGG - Intergenic
1174145621 20:48450402-48450424 TGGCATGGGATGGGTGGGAGGGG + Intergenic
1174321064 20:49741992-49742014 TGGCAGAGGAAGAGTGGGAGAGG - Intergenic
1174506264 20:51019723-51019745 TGGCATGGAGAGAGACGGACGGG - Intronic
1174860464 20:54086473-54086495 GTGCATGCCAAGAGTGGGGCAGG - Intergenic
1175947148 20:62564271-62564293 TGCCATGGCCTGGGTGGGACGGG - Intronic
1178117339 21:29430846-29430868 GCACATGGCAAGAGTTGGACAGG + Intronic
1178470192 21:32885701-32885723 TGGGATGGCAGGAGTGGGGAGGG - Intergenic
1180999005 22:19979307-19979329 TGGCAGGGAATGGGTGGGACGGG - Intronic
1182129286 22:27839190-27839212 TGGTATGGCATGGGTGAGACAGG + Intergenic
1182619318 22:31610152-31610174 TGGCAGGCCAAGGGTGGGACTGG + Intronic
1183293970 22:37019306-37019328 TAGCGTTGCGAGAGTGGGACGGG - Exonic
1183374492 22:37455126-37455148 TGGCAAAGAAAGAGTAGGACAGG - Intergenic
1183952600 22:41359886-41359908 TGGCATGGCAAGCATGGGGGCGG + Exonic
1184590151 22:45476564-45476586 TGGCATGGAATGGGTGGGACTGG + Intergenic
949474510 3:4430845-4430867 AGGCAGGGCAGGAGTGGGAAGGG + Intronic
950632242 3:14290185-14290207 TGGCAGGGCATGAGTGGGACTGG - Intergenic
951382258 3:21998071-21998093 TGGCATGGCACTGGTGGGAGTGG - Intronic
951583109 3:24186418-24186440 TGGCATGGAAAGAGCGGGTGTGG + Intronic
952391237 3:32882434-32882456 TCACATGGCAAGAGTGTGACAGG - Intronic
952865198 3:37850496-37850518 TCTAAGGGCAAGAGTGGGACAGG + Intergenic
953475605 3:43203377-43203399 TAGAATGGCAAGAGTGGAGCAGG - Intergenic
954441481 3:50524679-50524701 GGGCATCTCAAGAGTGGGGCTGG - Intergenic
954451048 3:50571922-50571944 AGGAGTGGCAAGAGTGGGGCCGG + Intronic
955844451 3:63146994-63147016 TGGGATGGCAGGAATGGCACAGG + Intergenic
956754734 3:72373498-72373520 TCCCATGGCTAGAGTGTGACAGG - Exonic
959254289 3:103990619-103990641 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
959476119 3:106814343-106814365 TGCCATGGCAACAGTGGAAGTGG + Intergenic
960062469 3:113338792-113338814 TGGAGGGGCAAGAGTGAGACTGG + Intronic
961343348 3:126245215-126245237 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
961617664 3:128195787-128195809 CTTCATGGCAAGAGTGAGACTGG + Intronic
963023628 3:140897369-140897391 GGGCATGGCAAGAGTGAGACCGG - Intergenic
965296681 3:166955831-166955853 GGGCATGGTGAGAGTGAGACTGG - Intergenic
965300470 3:167000307-167000329 TTGGAGGGCAAGAGTGAGACTGG + Intergenic
965859059 3:173125117-173125139 TGGGATGGGAAGACTGAGACAGG - Intronic
967958732 3:194901196-194901218 GGGCATGGCAGGAGTGAGGCTGG - Intergenic
968963299 4:3756629-3756651 TGGCATCACAACAGTGGGATGGG - Intergenic
969317773 4:6392430-6392452 TGGCATGGGAGGGGTGGGAGGGG + Intronic
972324860 4:38005827-38005849 TGGCATGGCAGCAGTGGGACTGG - Intronic
973069176 4:45835809-45835831 TGGCATGGCTGGAATGAGACGGG - Intergenic
975386932 4:73769043-73769065 TGGAGGGGCAAGAGTGGGACTGG - Intergenic
976865629 4:89722949-89722971 GGGCAGGGCAAGAGTGCAACAGG - Intergenic
977460102 4:97314584-97314606 TGGCATTGGAAGTGTGGGAGGGG - Intronic
977905668 4:102475347-102475369 GGGCATGGCGGGAGTGAGACGGG + Intergenic
979646800 4:123079220-123079242 TGGCATGGCAGGAGGAAGACTGG - Intronic
979752169 4:124291983-124292005 TCACATGGCAAGAGAGGGAGCGG - Intergenic
980495834 4:133586908-133586930 TTGGAGGGCAAGAGTGAGACTGG - Intergenic
981442573 4:144799603-144799625 GGGCATCGCAGGAGTGAGACTGG - Intergenic
982496396 4:156098843-156098865 TCCCATGGCAAGTGTGGGGCCGG + Intergenic
988931346 5:36038573-36038595 TGGCATGGAAAGACAGGAACTGG - Intronic
992405174 5:76450257-76450279 TGGGTTGGCAAGAGTGGGTGAGG - Intronic
995840925 5:116442435-116442457 TGGCAGGGCAAGTCTGGGAAAGG - Intergenic
996762312 5:126998760-126998782 TGACAGGGAGAGAGTGGGACAGG - Intronic
996845061 5:127889839-127889861 TGGCATGGCCAGAGGAGGTCAGG - Intergenic
999231981 5:150066975-150066997 TGGCTTGGCATTGGTGGGACGGG - Intronic
999235186 5:150086363-150086385 TGGCATGGTAAGAGCAGAACGGG - Exonic
1000391935 5:160731404-160731426 TGGCTTTGCAAGAGTTTGACTGG + Intronic
1001961700 5:175883691-175883713 TGGGGTGACAGGAGTGGGACTGG - Exonic
1001992891 5:176132853-176132875 GGGCATGGCATGGGTGGGAGTGG + Intergenic
1002474141 5:179454374-179454396 TGCCATGGAGACAGTGGGACGGG - Intergenic
1002504299 5:179668377-179668399 TGGAATGGCAACTGTGGGAGGGG - Intergenic
1003581919 6:7347729-7347751 GGGCATGGTGAGAGTGAGACAGG + Intronic
1004321799 6:14637528-14637550 TTGCATGGCAAGAGTGTGCAAGG - Intergenic
1004406589 6:15338755-15338777 TGGAAGGGAAAGAGTGAGACTGG - Intronic
1004456996 6:15800526-15800548 TGGAATGGCCAGGGTGGGAGTGG + Intergenic
1005495212 6:26382360-26382382 AGGCATGGCTGGAGTGGGAGGGG - Intergenic
1005504385 6:26457457-26457479 TGGCATGGCTGGAGCGGGAGGGG - Intergenic
1006369030 6:33633200-33633222 TGAGATGGCAGGAGTGGGATGGG + Intronic
1007369509 6:41417182-41417204 TTGCTTTGGAAGAGTGGGACAGG - Intergenic
1008548215 6:52602572-52602594 TGGGATGGTGAGAGTGGGAGAGG - Intergenic
1009032256 6:58073583-58073605 TGTCAGGGGAAGAGTGGAACCGG - Intergenic
1009356124 6:62747798-62747820 TGACATGGCAGGTATGGGACAGG - Intergenic
1010358609 6:74965789-74965811 AGGCATGGCAGGAGTGAGACTGG - Intergenic
1010801906 6:80186397-80186419 GGGCATGGCAGGAGTGAGATTGG - Intronic
1014277079 6:119399464-119399486 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
1014947441 6:127515465-127515487 GGGGATGGGAAGAGTGGGCCTGG - Intronic
1017793094 6:157818895-157818917 TGGCATGGGCAGAGAGAGACTGG - Intronic
1018481432 6:164194983-164195005 TCGCATGGCAAGAGAAGGAGAGG + Intergenic
1019042721 6:169119872-169119894 TGGAAGGGCAAGAGTGAGACTGG - Intergenic
1019475917 7:1244166-1244188 TGGGATGGCAGCAGTGGGCCCGG - Intergenic
1019595914 7:1858328-1858350 TGTCATGCCCAGAGTGGGCCAGG - Intronic
1022546529 7:31194199-31194221 TAGCATGGCAAGTGTTGGAGGGG + Intergenic
1022806080 7:33824026-33824048 TGGGATGGCAAGGTTGGGTCTGG + Intergenic
1025988275 7:66474637-66474659 GGGCCTGGCAGGAGTGGGCCGGG - Intergenic
1028831077 7:95327151-95327173 TCACATGGCAAGAGAGGGAGTGG - Intergenic
1028987180 7:97017738-97017760 TGCGATGTCAAGAGTGGGGCCGG + Intergenic
1029184226 7:98727155-98727177 TGACATGGCAGGAGTGGGCTGGG - Intergenic
1030238124 7:107289869-107289891 TGGCATAGCAAGTTTGGCACAGG - Intronic
1032273527 7:130433399-130433421 TGGTATGGAGAGAGTGGGAGAGG + Intronic
1035044129 7:155952920-155952942 TGGCCTGGCGCGAGTGGGACAGG + Intergenic
1036471091 8:9053430-9053452 TGGCATGCCCAGAGAGGGAATGG + Intronic
1036479296 8:9124034-9124056 TGGCCTGGCAAGAGTGGTATTGG - Intergenic
1037459481 8:19094581-19094603 TGGCAGGGTATGAGTGGGATAGG + Intergenic
1038150657 8:24940494-24940516 TGCCAGAGCAAGGGTGGGACAGG - Intergenic
1038199772 8:25401171-25401193 TGGCATGGAAATAGTGAGGCTGG + Intronic
1038366744 8:26943788-26943810 TGGGGTGGGAAGAGTGGGAGTGG - Intergenic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1039659885 8:39450002-39450024 TGGAAGGGCAAGAGTGAGACTGG - Intergenic
1043076446 8:75707372-75707394 TGGAATGGCATGTGAGGGACGGG + Intergenic
1043333854 8:79149740-79149762 TGACATGGCAAGAGAGGGGAGGG - Intergenic
1046048865 8:108996827-108996849 TAGCATGGCAACAGTAGCACTGG - Intergenic
1047937536 8:129797398-129797420 GGGCATGGTAAGAGTGAGACTGG - Intergenic
1050228006 9:3483721-3483743 TGCCACGGCAAGATTGGCACTGG - Intronic
1051579090 9:18651239-18651261 TGGCATGGTAAGGGAGGGAGGGG - Intronic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1054827871 9:69590990-69591012 AGTCATGGCAACAGTGGGAAAGG - Intronic
1054856621 9:69907113-69907135 TTGCATGGCAGGAGGGGGATGGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1058828460 9:108795160-108795182 TGGAAGGGCAAGAGTGAGACTGG - Intergenic
1059100949 9:111470814-111470836 TAGCTTGGCAAGACTGGGCCAGG + Intronic
1059631466 9:116128201-116128223 TGGCCTGGCAAGGCTGGGCCTGG - Intergenic
1060261309 9:122076352-122076374 TGGCAAGGCAAGAATCAGACTGG + Intronic
1060503960 9:124183992-124184014 AGGCAGGGCAAGACTGGGGCTGG + Intergenic
1061094401 9:128446643-128446665 TGGCATTTCAAGAGTGAGCCAGG - Intergenic
1061809335 9:133153363-133153385 CGGCATGGGAACAGTGAGACAGG - Exonic
1189414697 X:40803705-40803727 TGGAGGGGCAAGAGTGAGACGGG + Intergenic
1189419562 X:40844651-40844673 TAGCATGGCAGGAGTGTCACTGG - Intergenic
1189879213 X:45471543-45471565 AGGCATGGTGAGAGTGAGACTGG - Intergenic
1189907793 X:45779701-45779723 TCGAAAGGCAAGAGTGGAACAGG + Intergenic
1190023887 X:46904223-46904245 TGACATGGCAACAGTGGGGAGGG - Intergenic
1190326597 X:49210523-49210545 TCACATGGCAAGGGTGGGAAGGG - Intronic
1190756135 X:53403723-53403745 TGTCAGGGCAGGACTGGGACTGG - Intronic
1191148811 X:57198403-57198425 GGGCATGGTGAGAGTGAGACTGG - Intergenic
1192669913 X:73128593-73128615 TGGCATGGCAATGGAGGGAAAGG + Intergenic
1192674039 X:73175826-73175848 GGGCATGGTGAGAGTGAGACTGG - Intergenic
1197081791 X:122426628-122426650 TGGCATGGTGGGAGTGAGACTGG - Intergenic
1197714401 X:129696008-129696030 GGACATGGAAAGATTGGGACAGG - Intergenic
1199551078 X:149062011-149062033 TGGCTTGGCAGTTGTGGGACAGG + Intergenic
1199586805 X:149423486-149423508 GAGCATGGCAGGAGTGAGACTGG + Intergenic
1200044291 X:153392870-153392892 GGGCATGGCCAGAGAGGGGCGGG - Intergenic
1200054270 X:153450561-153450583 TGTCAGTGCAAGAATGGGACAGG - Intronic
1200125542 X:153812481-153812503 TGGGATGTCAAGAGGGGGATGGG + Intronic
1200829638 Y:7678388-7678410 TGGCTTGGAGAGAGTGGGGCAGG + Intergenic
1201924438 Y:19269288-19269310 TAGATAGGCAAGAGTGGGACAGG - Intergenic