ID: 1149981968

View in Genome Browser
Species Human (GRCh38)
Location 17:61317965-61317987
Sequence CTGCCAGAACAGCTTGCGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149981968_1149981973 21 Left 1149981968 17:61317965-61317987 CCATACGCAAGCTGTTCTGGCAG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1149981973 17:61318009-61318031 GTGAAAGCACAGCAAGAACAGGG 0: 1
1: 1
2: 10
3: 58
4: 517
1149981968_1149981972 20 Left 1149981968 17:61317965-61317987 CCATACGCAAGCTGTTCTGGCAG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1149981972 17:61318008-61318030 AGTGAAAGCACAGCAAGAACAGG 0: 1
1: 0
2: 0
3: 27
4: 287
1149981968_1149981970 -9 Left 1149981968 17:61317965-61317987 CCATACGCAAGCTGTTCTGGCAG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1149981970 17:61317979-61318001 TTCTGGCAGGCGTAACGCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149981968 Original CRISPR CTGCCAGAACAGCTTGCGTA TGG (reversed) Intronic
902047671 1:13538101-13538123 CTGACATAACAGCTTGGGCAAGG + Intergenic
902470340 1:16644511-16644533 CTGCCAGACCAGCTTCCGCTCGG + Intergenic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907972374 1:59395983-59396005 CTTCCAGAACAACTGGCTTAGGG - Intronic
909283273 1:73784704-73784726 CTTCCCGGACAGCTTACGTATGG + Intergenic
915084146 1:153373626-153373648 CTGCCAGAAGAGCAGGGGTAAGG + Intergenic
915473059 1:156137187-156137209 CTGCGGGAACAGCCTGCGTACGG + Exonic
919347333 1:196400974-196400996 CTGCCAGAACAACAAGCGAATGG + Intronic
924242518 1:242054844-242054866 CAGGCAAAAGAGCTTGCGTAGGG + Intergenic
1065645500 10:27829904-27829926 CTGCCTGAATACCTTGCTTAGGG - Intronic
1073544941 10:104339749-104339771 CTGCCATAACCTCTTACGTAAGG - Intergenic
1074110960 10:110422665-110422687 ATGACAGAACAGCTTGGGGAAGG + Intergenic
1074936701 10:118188975-118188997 CTACAAGAACATCTTGGGTATGG - Intergenic
1075624814 10:123954754-123954776 CAACCACAACAGCTTACGTATGG - Intergenic
1077509440 11:2948882-2948904 CTGCAAGGACTGCTTGCTTATGG + Intronic
1083674072 11:64315920-64315942 CTCCAAGAACAGCTTGTGCATGG - Exonic
1084427680 11:69094465-69094487 CTGCCAGAACGGCTTGGATTGGG + Intergenic
1085024083 11:73226512-73226534 CTGCAGGAATAGCTTGGGTACGG - Intronic
1092999702 12:13982510-13982532 CAGCCAGAAAAGCACGCGTATGG - Intergenic
1096980708 12:55727091-55727113 CTGCCAGAGCAGCTTGGTTCGGG - Intronic
1102426641 12:112849012-112849034 CTGGCAGAAGGGCTTGGGTAGGG - Intronic
1105344354 13:19560037-19560059 CTCCAAGAACAGCTTGTGCATGG + Intergenic
1105535680 13:21261537-21261559 CTCCAAGAACAGCTTGTGCATGG - Intergenic
1113576220 13:111396936-111396958 CTGCCAGAACAGGGTGGGCAGGG - Intergenic
1119035811 14:71229933-71229955 CAGGCAAAAGAGCTTGCGTAGGG + Intergenic
1119388847 14:74276556-74276578 CTGCCAGGACAGCTAGAGTGGGG + Intergenic
1122206222 14:100149304-100149326 CAGCCAGAGCAGCTTGCGGGCGG + Exonic
1124621167 15:31274896-31274918 CTCCCAGAACAGCTGGAGAAGGG + Intergenic
1134123784 16:11602408-11602430 TTTCCATAACAGCCTGCGTAGGG - Intronic
1134518671 16:14907514-14907536 CTCCCAGAACAGCTGGTCTAGGG + Intronic
1134555257 16:15158702-15158724 CTCCCAGAACAGCTGGTCTAGGG - Intergenic
1134706342 16:16306167-16306189 CTCCCAGAACAGCTGGTCTAGGG + Intergenic
1134961198 16:18405943-18405965 CTCCCAGAACAGCTGGTCTAGGG - Intergenic
1134965500 16:18488546-18488568 CTCCCAGAACAGCTGGTCTAGGG - Intronic
1135691046 16:24538299-24538321 CTGCCAGAAAAGCCTTCCTAAGG - Intronic
1144106712 17:11992692-11992714 CTGCCTGAAAAGCTGGCGTGCGG + Exonic
1149981968 17:61317965-61317987 CTGCCAGAACAGCTTGCGTATGG - Intronic
1153230288 18:2928590-2928612 ATTCCAGAAGAGCTTGCCTAAGG - Exonic
1155525070 18:26707586-26707608 CTGCCTGAACAGCTTGGGCTTGG - Intergenic
1156113462 18:33756933-33756955 TTTCCAGAACAGCTTGCATATGG + Intergenic
1161545159 19:4876017-4876039 CTTCCAGAACCCCTGGCGTAAGG + Intergenic
1161910251 19:7188066-7188088 CACCCAGAACAGCTTGTGCAAGG - Intronic
1166768534 19:45266435-45266457 CTGCCACAAAAGCTTGGGAAAGG - Intronic
925832570 2:7910533-7910555 CTGCCAGCACAGCTTACCCAAGG + Intergenic
932401640 2:71484840-71484862 GAGCCAGAACAGCCTGCGTGTGG - Intronic
1171019825 20:21574938-21574960 GTGCCACAAGAGCTTGTGTAGGG - Intergenic
1175236791 20:57519243-57519265 CTGCCTGAAAACCTTCCGTACGG - Exonic
1180709583 22:17830800-17830822 CCGCGAGAACAGCTGGCGTCAGG - Intronic
952206494 3:31185714-31185736 CTCCCAGCACTGCTTGCATATGG + Intergenic
953605278 3:44409723-44409745 CTGCCAGGACAGCCTGGGCAGGG - Intergenic
954299082 3:49689719-49689741 CTGCCAGACCAGCTTCCGCTCGG - Intronic
962437330 3:135379228-135379250 CTGCCAGAGCAGCTTCCTTGGGG + Intergenic
970885575 4:20984373-20984395 CTGCCTGAGAAGCTTGCGAATGG + Intronic
974893623 4:67911791-67911813 CTTGGAGAACAGCTTGCGTGAGG - Intronic
994569707 5:101500457-101500479 CTAGCAAAACAGCTTGCATATGG - Intergenic
996252847 5:121358707-121358729 CTGACATAACAGATTGTGTATGG - Intergenic
1003493740 6:6645931-6645953 TTGCCAGAACAGATTGGGAAGGG + Intronic
1007468928 6:42075508-42075530 CTGACAGGACAGCTGGCCTAGGG - Intronic
1014662354 6:124188904-124188926 CTCCCATAACAGCTTGATTAGGG + Intronic
1015876118 6:137824538-137824560 CTGCCAGAAGATGTTGCATATGG + Intergenic
1018234584 6:161711718-161711740 CTGCCAGCACAGCTAGAATAAGG + Intronic
1024182485 7:46909964-46909986 CTGTCAGCACAGCTTGGGTGAGG + Intergenic
1024212324 7:47216594-47216616 CTCCCAGAACAGACTGAGTATGG - Intergenic
1026862932 7:73804948-73804970 CTGCCACAACAGTTTATGTATGG + Intronic
1031795801 7:126173172-126173194 ATGCCAGACCAGCTTGGTTAGGG - Intergenic
1039596815 8:38797828-38797850 CTGCCAGAATAGGTTGGGGATGG + Intronic
1041928308 8:63260560-63260582 GTGCCAGAACAGGTTGGGGACGG + Intergenic
1042012072 8:64257933-64257955 GTGGCAGAAAAGCTTGAGTAAGG - Intergenic
1047427341 8:124758617-124758639 CTGCCAGTTCAGCTTGGGGATGG + Intergenic
1047696006 8:127404444-127404466 CTGCCAGCCCAGCATGCATATGG + Intergenic
1049275627 8:141718776-141718798 CTGCCAGAGCATCTTGGGTGGGG - Intergenic
1051657709 9:19398546-19398568 CGGCCAGAACTGCTTTCTTAAGG + Intergenic
1058751843 9:108046812-108046834 CTGCCAGTACAGTTTGTGTAGGG + Intergenic
1060401120 9:123350116-123350138 CTGGCAAAACAGCTTGGGGAGGG - Intergenic
1193213993 X:78840635-78840657 CTGGCAGAACATCTTGAGTCAGG - Intergenic