ID: 1149983939

View in Genome Browser
Species Human (GRCh38)
Location 17:61333045-61333067
Sequence AAACCTACACTGCTGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149983934_1149983939 1 Left 1149983934 17:61333021-61333043 CCTTTCTAGAATACTGCCCTCCC 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 186
1149983933_1149983939 21 Left 1149983933 17:61333001-61333023 CCTGACTCTGAGTTCAGTAACCT 0: 1
1: 0
2: 4
3: 22
4: 187
Right 1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149983939 Original CRISPR AAACCTACACTGCTGCAGCC TGG Intronic
900355419 1:2259717-2259739 AAAAGCAGACTGCTGCAGCCTGG - Intronic
900623635 1:3598513-3598535 AGCCCGGCACTGCTGCAGCCTGG - Intronic
901456154 1:9364068-9364090 CAGCCCTCACTGCTGCAGCCTGG + Intronic
902391474 1:16109623-16109645 CAACCTACCCTGCTCCACCCAGG + Intergenic
904711629 1:32434562-32434584 ACACCTGAACTGCAGCAGCCAGG + Intergenic
905777587 1:40679150-40679172 CCACCAACACTGCTGGAGCCTGG + Intergenic
910049376 1:82957531-82957553 ACACCTGAACTGCAGCAGCCAGG + Intergenic
911700780 1:100949738-100949760 CGACCTGCAATGCTGCAGCCTGG - Intronic
912296470 1:108475166-108475188 ACACCTGAACTGCAGCAGCCAGG + Intergenic
913097850 1:115536446-115536468 GAATCTACATTGATGCAGCCAGG - Intergenic
916730436 1:167562037-167562059 AAATGTGAACTGCTGCAGCCAGG + Intergenic
917520912 1:175747899-175747921 AATCCTACATAGCTACAGCCAGG - Intergenic
918991515 1:191702695-191702717 AAATCTACAGTGAAGCAGCCAGG + Intergenic
920746727 1:208635858-208635880 AGACGGACCCTGCTGCAGCCAGG - Intergenic
921891475 1:220358341-220358363 AAACCTACAGTGCTCCTCCCGGG + Intergenic
922281103 1:224125155-224125177 ACACCTGCACTACTCCAGCCTGG - Intronic
924269850 1:242321174-242321196 AAATCTAAATTGATGCAGCCAGG + Intronic
924859720 1:247908633-247908655 AAATCTGCATTGATGCAGCCAGG - Intergenic
1062818950 10:519637-519659 TCACCTACACTGCCACAGCCAGG + Intronic
1063077217 10:2729390-2729412 AAACCTAGGCAGCTGTAGCCAGG + Intergenic
1064692175 10:17929520-17929542 AAATCCGCACTGATGCAGCCTGG + Intergenic
1066558980 10:36647598-36647620 CATCCTACACTAATGCAGCCGGG + Intergenic
1066779209 10:38924915-38924937 GAACCTACTTTGATGCAGCCAGG - Intergenic
1067877073 10:50016658-50016680 AAAATTAAACTGCTGCAGGCCGG + Intergenic
1068169080 10:53370498-53370520 CAACCTGCAAGGCTGCAGCCTGG + Intergenic
1070706789 10:78645646-78645668 AGACCCACACTGCTGTAACCAGG + Intergenic
1070727507 10:78802421-78802443 AGACCTGATCTGCTGCAGCCGGG - Intergenic
1071683441 10:87730547-87730569 AAATCTACATTGATACAGCCAGG - Intronic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1072426218 10:95333099-95333121 AAATCTGCATTGATGCAGCCAGG + Intronic
1075487592 10:122838256-122838278 AAACCTTGACTGCTGCACTCTGG + Intronic
1076844893 10:133065288-133065310 AAACATACAGAGCTGCAGCTGGG - Intergenic
1080170527 11:29296615-29296637 AAGCCTTCACTGGTGCAGCCAGG - Intergenic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1081752462 11:45521569-45521591 AAACCTTCCTTGCTTCAGCCAGG - Intergenic
1083084058 11:60124418-60124440 AAATCTACATTAATGCAGCCAGG + Intergenic
1086210872 11:84317106-84317128 CAAGCAACACAGCTGCAGCCGGG - Intronic
1097587585 12:61532727-61532749 AAACCTACTTCGCTGCAGTCTGG - Intergenic
1099396112 12:82142332-82142354 AAACCTACAATGCTGAAGATGGG - Intergenic
1099397616 12:82160166-82160188 GAACCAGCACTGCAGCAGCCTGG + Intergenic
1101310629 12:103575498-103575520 AAACCTCCAGTGCTGGAGCGGGG - Intergenic
1101389453 12:104287204-104287226 AGACGCACACTGCTGCACCCAGG - Intronic
1101425870 12:104587881-104587903 AAACCTAATCTCCTCCAGCCCGG - Intronic
1102627934 12:114251122-114251144 AAATCTGCATTGATGCAGCCAGG - Intergenic
1103927059 12:124429079-124429101 AAACCGGCCCTGCTCCAGCCAGG + Intronic
1104860094 12:131919088-131919110 TACCCTCCCCTGCTGCAGCCCGG - Intronic
1105005992 12:132720916-132720938 AAACCTGCAATGCTGCATCTGGG + Exonic
1107891186 13:44916240-44916262 AAAACTACACAGCTTCTGCCTGG + Intergenic
1110784803 13:79511157-79511179 AAATCTACATTGATGCAGCCAGG - Intronic
1114964370 14:27939351-27939373 CAACCTGCAAGGCTGCAGCCTGG + Intergenic
1116997373 14:51337698-51337720 AAACCTACACTTCCGGGGCCTGG + Intergenic
1118519423 14:66565338-66565360 AGCCATACACTGCTGCGGCCTGG - Intronic
1118706760 14:68487195-68487217 AAACCAAACCTGCTGGAGCCTGG - Intronic
1119167221 14:72504682-72504704 GAACCTAAACTGCTGTAACCAGG - Intronic
1119438450 14:74612577-74612599 AGACCTGCAAGGCTGCAGCCTGG - Intergenic
1119552352 14:75524148-75524170 ACACCTACACTGCAGCATCTGGG + Intronic
1120265718 14:82248389-82248411 AAATCTGCACTGAGGCAGCCAGG + Intergenic
1125469937 15:39992999-39993021 AAACTGGCACTGCTGCTGCCAGG + Intronic
1125629214 15:41133723-41133745 ACGCCTAAACTGCAGCAGCCAGG + Intergenic
1128176300 15:65559055-65559077 AAGGCTACACTCCTTCAGCCTGG + Intronic
1130180207 15:81619362-81619384 TGACAGACACTGCTGCAGCCAGG - Intergenic
1133279613 16:4657645-4657667 GACCCTGCATTGCTGCAGCCTGG - Intronic
1136252488 16:29014993-29015015 AAAAATACACTTCTGGAGCCTGG - Intergenic
1136529945 16:30861372-30861394 ACGCCTGAACTGCTGCAGCCAGG + Intronic
1137360110 16:47806639-47806661 AAAACTACAGGGCTGCAGGCTGG - Intergenic
1138817941 16:60223936-60223958 ACACTTCCACTGCTGCAGCCTGG - Intergenic
1141810657 16:86373305-86373327 AGACCCCCACTGCTGAAGCCAGG - Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1143082433 17:4391810-4391832 AAAAATACAATGCTGCAGCCGGG + Intergenic
1145021312 17:19433600-19433622 AAATCTGCACTGATGAAGCCAGG - Intergenic
1146555902 17:33823763-33823785 AAACTTCCAATGCTGAAGCCTGG - Intronic
1146691367 17:34878365-34878387 AAACATGCACTGCTCCAGGCTGG - Intergenic
1147214979 17:38893773-38893795 AACCCGTCACTGCTCCAGCCTGG - Intronic
1147722535 17:42547858-42547880 ATACCAACACTTCAGCAGCCAGG - Intergenic
1148434132 17:47668332-47668354 AAGCCATCACTGCTGCATCCCGG - Exonic
1149319562 17:55470015-55470037 ACACCTAAACTGCAGCGGCCAGG + Intergenic
1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG + Intronic
1150025845 17:61673442-61673464 CAACCTGCAAGGCTGCAGCCTGG + Intergenic
1150569508 17:66373978-66374000 AAACCCCCACTGCAGCAGCAGGG - Intronic
1151275169 17:73028820-73028842 AAAAAAACACTGCTGCAGCCGGG + Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1158022496 18:52859661-52859683 AAACCTGCATTGATGGAGCCAGG - Intronic
1158870128 18:61678409-61678431 AAATCTGCATTGATGCAGCCAGG - Intergenic
1160298653 18:77659208-77659230 ATTCCCACAGTGCTGCAGCCAGG + Intergenic
1164080797 19:21860003-21860025 ACACCTAAACCGCAGCAGCCAGG + Intergenic
1164431521 19:28193197-28193219 AAAAGTACATTGCTTCAGCCTGG - Intergenic
1165744913 19:38224757-38224779 TAACCTGCACTGCTGCTGTCAGG - Intronic
1166498016 19:43318985-43319007 ACACTTTCACTGTTGCAGCCTGG + Intergenic
927852143 2:26506133-26506155 AAAACTACACTTCTGAAGCTGGG - Intronic
929890243 2:45912692-45912714 AAATCTGCACTGGAGCAGCCAGG + Intronic
929931849 2:46263416-46263438 AAACATACACAGATGCGGCCTGG + Intergenic
930958372 2:57231105-57231127 ACACCTAAACTGCAGCCGCCAGG + Intergenic
932377559 2:71251149-71251171 CAACCTGCAAGGCTGCAGCCTGG - Intergenic
934802795 2:97183345-97183367 AATCCTACACTAGTGCAGGCAGG + Intronic
934833407 2:97557224-97557246 AATCCTACACTAGTGCAGGCGGG - Intronic
936870786 2:117132536-117132558 ACACCTAAACTGCAGCAGCCAGG + Intergenic
937132976 2:119527080-119527102 AACTCTGCACTGATGCAGCCAGG + Intergenic
938066307 2:128283713-128283735 AGACCCACACTCCAGCAGCCTGG - Intronic
938838622 2:135135882-135135904 AAACTTACACTGCTGCATAATGG + Exonic
939909401 2:147962375-147962397 CAACCTGCCCTGCTGCAGCATGG + Intronic
941540255 2:166773316-166773338 AAATCTGCATTGGTGCAGCCAGG + Intergenic
943233610 2:185290236-185290258 TGACCTGCAATGCTGCAGCCTGG + Intergenic
943952140 2:194144647-194144669 AAATCTACATTGATGCAGCCAGG + Intergenic
945376095 2:209080288-209080310 ACACCTGAACTGCAGCAGCCAGG + Intergenic
947420447 2:229937625-229937647 AAGCCAACACTGCTGAAGCAGGG - Intronic
948310987 2:236986748-236986770 TAAACTACAGTGCTACAGCCAGG + Intergenic
948781591 2:240324880-240324902 GCACCCACGCTGCTGCAGCCTGG + Intergenic
948879105 2:240847061-240847083 AAACCTGCATTGATGCAGCCAGG - Intergenic
1171148860 20:22809517-22809539 AAACCCACCCACCTGCAGCCTGG + Intergenic
1172093454 20:32449184-32449206 AAGCCTTCTCTGATGCAGCCAGG + Intronic
1175755188 20:61525215-61525237 AAACCTCCACTCTTCCAGCCTGG - Intronic
1176107278 20:63395438-63395460 AAGCAGACACGGCTGCAGCCGGG + Intergenic
1178492014 21:33058476-33058498 GAACCTACACTACTGCAGATGGG + Intergenic
1178884667 21:36475791-36475813 AATCCTACTGTGCTCCAGCCTGG - Intronic
1179659633 21:42865973-42865995 ACACCCACACTCCAGCAGCCAGG + Intronic
1179781025 21:43701127-43701149 ACACACACACAGCTGCAGCCAGG + Intergenic
1180713102 22:17853300-17853322 CAGCCCACTCTGCTGCAGCCTGG + Intronic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
1183314119 22:37127902-37127924 AAACCTCCACTGCTGCTCCCGGG - Exonic
1183644397 22:39115274-39115296 AAATCTGCATTGCTGCAGCCTGG - Intergenic
1184357976 22:43995440-43995462 ACTCCTACACAGCCGCAGCCGGG - Intronic
1185403232 22:50629306-50629328 GAATCTACACTGATGCGGCCAGG + Intergenic
1185404499 22:50639910-50639932 GAATCTACACTGATGCGGCCAGG + Intergenic
950136552 3:10585091-10585113 ACACCTGCCCTGCTGTAGCCTGG + Intronic
953219055 3:40950996-40951018 TAACCTGCAATGCTGCAGCCTGG - Intergenic
956702398 3:71969981-71970003 AAACCAGCACTGCTGCAGCTGGG - Intergenic
956848647 3:73207403-73207425 AAAATTACACTGCTGGAGGCTGG + Intergenic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
959822415 3:110752284-110752306 AAATCTTCATTGATGCAGCCAGG + Intergenic
961150105 3:124630555-124630577 TAAACTACACTACTGGAGCCGGG - Intronic
963309968 3:143699469-143699491 CATGCTACACTGCTGCTGCCAGG - Intronic
964191262 3:154003792-154003814 AAGTCTGCACTGCTGCAGCCAGG + Intergenic
964882016 3:161433287-161433309 AAGCCTACATGACTGCAGCCTGG - Intergenic
965409115 3:168307356-168307378 AAACCGTCAGTGCTGCACCCAGG + Intergenic
965934541 3:174091029-174091051 AGAAGTACAGTGCTGCAGCCAGG + Intronic
967075129 3:185994925-185994947 AAACCTACCCTGTTGCTCCCAGG - Intergenic
967844862 3:194035398-194035420 AAACCTCCACAAGTGCAGCCAGG + Intergenic
968381920 4:103693-103715 TAACATACAATTCTGCAGCCAGG + Intergenic
969398602 4:6938911-6938933 AGATCTCCACTCCTGCAGCCGGG - Intronic
971391762 4:26192698-26192720 AAACCTAAACTGGTGGGGCCAGG - Intronic
974307292 4:60157684-60157706 CAACCTACAAGGCTGCAGCCTGG + Intergenic
975744638 4:77464327-77464349 CAACCTGCATTGCAGCAGCCTGG - Intergenic
979358246 4:119730983-119731005 AAATCTGCACTGATGCAACCAGG - Intergenic
981710166 4:147701367-147701389 CAACCTAAAGTGCTGCAGCATGG + Intergenic
981716492 4:147757489-147757511 AAAGCTACACTGCCCCAGCCAGG - Intronic
982318801 4:154058493-154058515 ATGCCTAAACTGCAGCAGCCAGG + Intergenic
984141262 4:176006057-176006079 AAACCTGCATTGATGCAGCCAGG - Intergenic
985036204 4:185842474-185842496 AAACCTACAGTGTTGAAGACTGG + Intronic
986052534 5:4103508-4103530 AACCCTCCACAGCTGCAGCCTGG - Intergenic
994324867 5:98436781-98436803 ATGCCTAAACTGCAGCAGCCAGG + Intergenic
994532553 5:100987751-100987773 ACACCTGAACTGCAGCAGCCAGG - Intergenic
994833312 5:104814520-104814542 ATAACTACTGTGCTGCAGCCTGG - Intergenic
999467727 5:151823076-151823098 AAACCTAGAGTGATGCAGTCTGG - Intronic
1001473135 5:172029812-172029834 AAACCTACACTGATATAGCAAGG + Intergenic
1002621337 5:180490653-180490675 AAACCTCCTCTGCTGCAGCCTGG + Intergenic
1003900312 6:10648832-10648854 AAACATACACCTCTGCAGTCTGG + Intergenic
1006394885 6:33780824-33780846 ACACCTACAGTGCAGCAGTCAGG + Intronic
1007127783 6:39441924-39441946 AAGCCTACCATGCTTCAGCCTGG - Intronic
1015278145 6:131405025-131405047 ACACCTGAACTGCAGCAGCCAGG + Intergenic
1015945963 6:138501447-138501469 ACTCCTACGATGCTGCAGCCTGG - Intronic
1016248854 6:142018020-142018042 AAGCCTGAACTGCAGCAGCCAGG + Intergenic
1017325533 6:153137416-153137438 AAACCCTGACTGCTCCAGCCAGG + Intergenic
1018024037 6:159790046-159790068 AAACTTACACTCCTGAGGCCTGG - Intronic
1018076022 6:160214471-160214493 CAACCTACAAGGCAGCAGCCTGG - Intronic
1019753899 7:2753715-2753737 AAACATACACTTATACAGCCCGG - Intronic
1020774143 7:12432076-12432098 CAACCTGCAAGGCTGCAGCCTGG - Intergenic
1021770396 7:23995000-23995022 AAACCTACTCTTCTGCAAACTGG - Intergenic
1026688851 7:72535174-72535196 TAAACTACACTACTGCAGGCCGG + Intergenic
1026724084 7:72857070-72857092 TAAACTACACTACTGCAGGCCGG + Intergenic
1028589919 7:92483286-92483308 ACACCTGAACTGCAGCAGCCAGG - Intergenic
1029939792 7:104468124-104468146 AAACTGCCACTGCTGCAACCCGG + Intronic
1029992091 7:104971880-104971902 ACACATACAGTTCTGCAGCCAGG - Intergenic
1031004660 7:116457696-116457718 ACACCTGAACTGCAGCAGCCAGG + Intronic
1032246684 7:130219327-130219349 AACCTTTCTCTGCTGCAGCCTGG + Intergenic
1032250686 7:130254771-130254793 CGACCTACAAGGCTGCAGCCAGG - Intergenic
1033339824 7:140483311-140483333 AAATCTACACTGAGGCAGCCCGG + Intergenic
1034076433 7:148235978-148236000 AAAGCTGCACAGCTGTAGCCAGG - Intronic
1034987677 7:155527276-155527298 AAACCTGCATAGCTGCTGCCTGG + Intronic
1035030149 7:155851605-155851627 AATGCTAAGCTGCTGCAGCCGGG + Intergenic
1038634671 8:29276080-29276102 AACCCAAGACAGCTGCAGCCAGG + Intergenic
1039447742 8:37646229-37646251 AAATCCACACGCCTGCAGCCTGG + Intergenic
1040633822 8:49248585-49248607 CAACTGACACTTCTGCAGCCTGG - Intergenic
1041103646 8:54420679-54420701 AAAACTCCTGTGCTGCAGCCTGG + Intergenic
1041539562 8:58967580-58967602 AAACCTCCTCAGCTCCAGCCAGG - Intronic
1046265639 8:111825733-111825755 AAAACTCCTCTGCTGCAACCTGG + Intergenic
1048330190 8:133465850-133465872 AAGCCTACCGTGCTGCACCCAGG - Intronic
1048616339 8:136079609-136079631 AAACCTTCAATGCTGCAGAAGGG + Intergenic
1051629737 9:19130286-19130308 AAATCTGCATTGATGCAGCCAGG + Intronic
1055914948 9:81391483-81391505 AAACATACAAAGCTACAGCCCGG + Intergenic
1056348464 9:85723419-85723441 CAACCTGCAATGCTGCAGCTTGG - Intronic
1057504123 9:95618522-95618544 AAGCCACCACTGCTCCAGCCTGG - Intergenic
1060269452 9:122130595-122130617 AACACCACACTGCTCCAGCCTGG - Intergenic
1060783939 9:126434254-126434276 AAATCTTCAATCCTGCAGCCTGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1203582650 Un_KI270746v1:26273-26295 AAGCCTACACTAGTGCAGGCAGG + Intergenic
1186725695 X:12356160-12356182 AAATCTGCACTGATGCACCCAGG - Intronic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1187152589 X:16694590-16694612 AAACCTCCAGTGCTGCATGCAGG - Intronic
1192160414 X:68782218-68782240 GAATCTGCACTGATGCAGCCAGG - Intergenic
1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG + Intergenic
1193106888 X:77686418-77686440 AACACTGCACTACTGCAGCCGGG + Intronic
1194665003 X:96667712-96667734 AAACCAACCCTGCTGATGCCTGG - Intergenic
1195016961 X:100789916-100789938 ACACCTGAACTGCAGCAGCCAGG - Intergenic
1195529084 X:105931337-105931359 TGACCTAAGCTGCTGCAGCCTGG - Intronic
1196366237 X:114927443-114927465 GAATCTACATTGATGCAGCCAGG - Intergenic
1196525484 X:116724448-116724470 ACACCTAAACTGCAGCGGCCAGG - Intergenic
1200371393 X:155728536-155728558 CAACCTGCAAGGCTGCAGCCTGG - Intergenic
1201938701 Y:19435300-19435322 CAACCTGCAAGGCTGCAGCCTGG + Intergenic