ID: 1149985776

View in Genome Browser
Species Human (GRCh38)
Location 17:61345762-61345784
Sequence AGTGAAGGAGTGGCACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149985770_1149985776 -3 Left 1149985770 17:61345742-61345764 CCCCAAACACGGGGATGGGCAGT 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 263
1149985771_1149985776 -4 Left 1149985771 17:61345743-61345765 CCCAAACACGGGGATGGGCAGTG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 263
1149985767_1149985776 5 Left 1149985767 17:61345734-61345756 CCTATGAGCCCCAAACACGGGGA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 263
1149985772_1149985776 -5 Left 1149985772 17:61345744-61345766 CCAAACACGGGGATGGGCAGTGA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149985776 Original CRISPR AGTGAAGGAGTGGCACCAGG AGG Intronic
900174543 1:1285979-1286001 ACCCAAGGAGGGGCACCAGGAGG + Exonic
900425358 1:2575909-2575931 AGGGAAGGAGCGGCCCAAGGAGG - Intergenic
901484153 1:9546813-9546835 AGTGCATCAGTGTCACCAGGAGG + Intronic
901637791 1:10678395-10678417 TGTGAGGGAGAGGCAGCAGGTGG + Intronic
901917728 1:12512774-12512796 AGAGATGGAGTGACACCAGGAGG + Intergenic
902381529 1:16055027-16055049 AGTGAAGGTGTGAACCCAGGAGG - Intronic
902666530 1:17943107-17943129 AGCAAAGGATGGGCACCAGGGGG - Intergenic
904049667 1:27631706-27631728 AGTGACGGTGTGGGACCAGAGGG + Intronic
904326815 1:29731912-29731934 AGGGCAGGAGTGGAACCGGGAGG - Intergenic
906707928 1:47908567-47908589 AGTGAAGGAGAGGCACAGGAGGG - Intronic
907573842 1:55507783-55507805 AGTAAAGGAGAAGCAGCAGGAGG - Intergenic
907896144 1:58693944-58693966 AAGGAAGGAGTGGCAGCATGTGG - Intronic
908163763 1:61437281-61437303 GGGGAAGGAGTGGTACTAGGGGG + Intronic
912519123 1:110233469-110233491 AGTGAAGCAGTGACCCTAGGGGG - Exonic
913404460 1:118474111-118474133 AGTGAAAGAGAGGAGCCAGGAGG - Intergenic
914430906 1:147619722-147619744 AGTGAAGGCTGGGCACCTGGGGG + Exonic
914923728 1:151865379-151865401 CGTGAGGGAGTTGCAGCAGGAGG - Intergenic
918587988 1:186209770-186209792 AGGGAAGGAGTCTCACCAGTAGG + Intergenic
920012789 1:202881708-202881730 AATGAAAGAGGGGCACCAGCTGG + Intronic
920377415 1:205516656-205516678 ATTGAAGGAGGGGCACCTGGTGG + Intronic
922273361 1:224054892-224054914 AGAGAAGAAGTGCCAGCAGGGGG + Intergenic
922678462 1:227568904-227568926 AGTGCAGGAGCGGCAGCTGGAGG + Intronic
923359047 1:233189519-233189541 AATGAAGGAATTGCACTAGGAGG + Intronic
1067099656 10:43325368-43325390 AGAGAAGGCGGGGCAACAGGAGG - Intergenic
1067234610 10:44437218-44437240 AGTGAAGGCATGGCAGGAGGTGG - Intergenic
1069446522 10:68477724-68477746 CGTGAAGGAGTAGCAACAGATGG - Intergenic
1071121865 10:82287737-82287759 GGTGAAGGAGTGGCCACAGCTGG + Intronic
1073079957 10:100853467-100853489 AATGAAAGAGAGGGACCAGGTGG - Intergenic
1073112031 10:101068018-101068040 AGCGAAGGAGTGCCATCTGGTGG + Intronic
1073352757 10:102831523-102831545 TGAGAAGGAGTGGCACCAGCCGG - Exonic
1073658883 10:105449913-105449935 ACTGAAGGAGTGGCAAGATGTGG - Intergenic
1073945105 10:108741105-108741127 AGTGAATGAGAGGCCCCTGGGGG - Intergenic
1074763518 10:116684579-116684601 AGATAAGCAGTGGCTCCAGGAGG + Intronic
1075169705 10:120101959-120101981 AGTGAAGGAGTGCAAAGAGGTGG + Intergenic
1076124156 10:127961491-127961513 AGGGAAGGAGGGCCCCCAGGAGG + Intronic
1077536981 11:3129178-3129200 AAGGAAGGAGGGGCAGCAGGAGG + Intronic
1077851595 11:6078647-6078669 TGTAAAGGAGTAGGACCAGGAGG - Intergenic
1077965765 11:7131440-7131462 AGGGAAAGAGTGGCAGTAGGGGG + Intergenic
1078162087 11:8849635-8849657 AGTGATGGAGTTTCACCATGTGG - Intronic
1078460934 11:11514846-11514868 AGTGAAGGATCTGGACCAGGAGG + Intronic
1078529662 11:12127238-12127260 GGTGAAAGAATGGCTCCAGGAGG - Intronic
1080719110 11:34831976-34831998 GGTGAAGGTGAGGCACCAAGAGG + Intergenic
1080884062 11:36349442-36349464 AGTGAGGGAGGGGAAACAGGAGG + Intronic
1082140650 11:48604339-48604361 GGAGAAGAAGTGGCAGCAGGAGG - Intergenic
1083341235 11:61959695-61959717 AGTGAATGACTGGCTGCAGGAGG - Intronic
1083518108 11:63279301-63279323 AGTGAATGAGAGTCACAAGGGGG - Intronic
1084496317 11:69505684-69505706 AATGAAGGTGGGGCACAAGGTGG + Intergenic
1084562162 11:69911206-69911228 AGGGAAGGAGTGGCCCCTGGTGG - Intergenic
1085171622 11:74454443-74454465 AGTCATGGAGTAGCCCCAGGAGG + Intergenic
1086326033 11:85700600-85700622 AGTGAAGAAATGTCAGCAGGTGG + Intronic
1087605513 11:100372507-100372529 AGGGAAGGAGTGCGAACAGGGGG + Intergenic
1089332747 11:117701303-117701325 ACTGAAGGAGAGGCAACTGGGGG + Intronic
1090299878 11:125626159-125626181 GGTGGAGGAATGGTACCAGGAGG + Intronic
1091141907 11:133242557-133242579 GGGCAAGGAGAGGCACCAGGAGG - Intronic
1091727288 12:2854978-2855000 AGTGAAGGAGTTGAAGGAGGTGG - Intronic
1093261221 12:16940375-16940397 AGTGGAGGAGTGGCAACCTGGGG + Intergenic
1093394605 12:18665747-18665769 AGAGAAGGAGTTTCACCATGTGG - Intergenic
1094018986 12:25894258-25894280 AGTAAAGGAGTGGAGCCATGTGG + Intergenic
1098176968 12:67802948-67802970 AGTGAATGAGAGGCACCAGCAGG - Intergenic
1098545297 12:71705154-71705176 AGTGAAGGAGTGGCAGGGCGAGG + Intergenic
1099908362 12:88799178-88799200 AGGGAAGGAGGAGCAGCAGGAGG + Intergenic
1099981357 12:89607333-89607355 AGGGAAGGAGAGGAACCAAGAGG - Intronic
1101293816 12:103400232-103400254 AGGAAAGGAGTGGCACCCAGGGG + Intronic
1101780406 12:107829720-107829742 GGTGAAGGAGAGGAAGCAGGAGG - Intergenic
1101939147 12:109086559-109086581 AGTGAAAGAGTTTCCCCAGGGGG - Exonic
1102128385 12:110504281-110504303 AGAGAAGGAGTTTCACCATGTGG - Intronic
1102469795 12:113153246-113153268 GGCGGAGGAGAGGCACCAGGCGG + Exonic
1102534381 12:113569862-113569884 TGGGAAGGAGTGGCCCCCGGCGG + Intergenic
1102607091 12:114076321-114076343 AGTCAATGAGAGGCACCAGCAGG + Intergenic
1102607181 12:114076987-114077009 AGTCAATGAGAGGCACCAGCAGG + Intergenic
1105813741 13:24015574-24015596 AGTGAAGCAGAGGGGCCAGGTGG - Intronic
1106996850 13:35494575-35494597 AGTGAAGGAATGGCAAAAGAAGG + Intronic
1107277063 13:38689261-38689283 AGTGACAGAGTGGCAGCAGCAGG + Exonic
1107769882 13:43778425-43778447 AGTGAATGAGTGGTAGCTGGGGG - Intronic
1113284813 13:108835302-108835324 AGAGAATGAGTGCCAGCAGGGGG - Intronic
1113425044 13:110200838-110200860 AGTTAAGGAGTCTCACCTGGAGG + Exonic
1113610711 13:111642904-111642926 TGGGAAGAAGAGGCACCAGGCGG + Intronic
1113611340 13:111646726-111646748 AGGGAAGGAGAGGCACCAGGAGG - Intronic
1114207374 14:20585134-20585156 AGGGAAGGAGGGGCAACAGAGGG + Intronic
1114358931 14:21948415-21948437 AGTCAAGGAGAGGCATCATGGGG + Intergenic
1114473129 14:22977427-22977449 AGGGAAGGAGTGAGAACAGGTGG + Intronic
1114552823 14:23543662-23543684 AGGGAGGGAGTGGGAACAGGAGG + Intronic
1115775425 14:36709647-36709669 AGTGAAGCAATGCCAACAGGTGG + Intronic
1117596669 14:57332756-57332778 AGAGAAGGAGGTGCTCCAGGAGG + Intergenic
1117798247 14:59416681-59416703 AGTGTAGGAGGGGCACCACCAGG - Intergenic
1118361575 14:65061785-65061807 TGTGGTGGAGTTGCACCAGGAGG + Exonic
1119663410 14:76467044-76467066 AGTGAAGAAATGGAAGCAGGTGG - Intronic
1119846108 14:77831298-77831320 AGTGAAGGAGTGGGACAGAGAGG + Intronic
1121108515 14:91296348-91296370 AGTGAAGGACTGGCAAGAGCTGG - Intronic
1121505636 14:94474616-94474638 AGAGAAGGGGTGGCCACAGGAGG - Intronic
1121837038 14:97101475-97101497 AGTGACAGAGCAGCACCAGGAGG - Intergenic
1124532180 15:30517777-30517799 AGTGAGGCTGTGGCAGCAGGAGG + Intergenic
1124766473 15:32489868-32489890 AGTGAGGCTGTGGCAGCAGGAGG - Intergenic
1125751002 15:42028590-42028612 AGAGAAGGAGTTTCACCATGTGG + Intronic
1128326233 15:66725927-66725949 AGTGAAGGGGTGGCAGGTGGGGG - Intronic
1128655948 15:69462221-69462243 AGCAAAGGCGTGGCACCTGGAGG + Intergenic
1129602980 15:77011019-77011041 AGTGAAGGAGGGGAAGCAGGCGG + Intronic
1130301234 15:82680896-82680918 CGTGGAGGAGTGGGGCCAGGTGG - Exonic
1130529470 15:84735215-84735237 AGGGAAGGAATGTCACCAAGGGG - Intergenic
1131042091 15:89279049-89279071 AGTCAATGAGTGGCAGCAGCAGG - Intronic
1132800028 16:1747440-1747462 AGCCAAGGAGTGGCCGCAGGAGG - Intronic
1133924349 16:10181731-10181753 AGTGCAGGAGGGGCACCAGGGGG - Intronic
1135734703 16:24921374-24921396 AGTGAGGGAGTGGGAGGAGGAGG + Intronic
1136040412 16:27574479-27574501 AGTGCAGGAGTGGCAACTGCAGG + Intronic
1138181868 16:54945993-54946015 AGGGAAAGAGAGGCGCCAGGAGG - Intergenic
1139950371 16:70665382-70665404 TGTGCAGTAATGGCACCAGGTGG + Intronic
1140168300 16:72577310-72577332 AGAGAAGGAGAGGCATCTGGAGG + Intergenic
1140821652 16:78668620-78668642 GGTGAAGGAGTGACAGCAGGGGG + Intronic
1141033905 16:80611925-80611947 AGAGAAGTCGTGTCACCAGGTGG - Intronic
1142431599 16:90031466-90031488 AGCCGAGGAGAGGCACCAGGTGG + Exonic
1142750648 17:1985460-1985482 AGTGAAGCAGTGGACCCAGGAGG - Intronic
1143444557 17:6999767-6999789 AGTGAGGAAGTGCCATCAGGTGG + Intronic
1144760791 17:17706215-17706237 AGGGAAGGAATGGCACTTGGGGG + Intronic
1145771651 17:27497518-27497540 AAGCAAGGAGTGGGACCAGGAGG + Intronic
1146139702 17:30355004-30355026 AGTGAAGGATTGGAACAAGAAGG + Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146714428 17:35072484-35072506 AATAAAGGAGTAGCACAAGGGGG + Intronic
1146817029 17:35950526-35950548 AGTGAAGGAGGGGACCCAAGGGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147170557 17:38616455-38616477 GATGAAGGCCTGGCACCAGGGGG + Intergenic
1147309135 17:39583929-39583951 AGAGAATGCTTGGCACCAGGTGG + Intergenic
1147976320 17:44250198-44250220 AGTGAAAGTGTGGCAACAGGAGG + Exonic
1148359259 17:46998370-46998392 AGTGAAGGAGGGGACCCAAGGGG + Intronic
1148795101 17:50193098-50193120 AGTAAATGAGAGGCCCCAGGAGG - Intronic
1148866356 17:50630794-50630816 TTTGCAGGAGGGGCACCAGGTGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG + Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150484902 17:65536971-65536993 AGGGAAGGAGGGGCCCCCGGCGG - Exonic
1150602854 17:66665484-66665506 AGTGTAGGAGTGGCAAGAGGGGG + Intronic
1151494785 17:74452967-74452989 AGGGAAGATGTGGCACCAGGAGG - Intergenic
1151822955 17:76506956-76506978 GGGGAAGGAATAGCACCAGGAGG - Intergenic
1153957779 18:10112790-10112812 ACTGAAGGATTGGCAGCTGGTGG - Intergenic
1156132817 18:33999048-33999070 AATGAGGGAGTTGCACTAGGTGG - Intronic
1156511494 18:37640693-37640715 AGTGATGGGGTGACAGCAGGGGG + Intergenic
1159833129 18:73303074-73303096 AGAGAAGGAGTGGCAGGATGAGG - Intergenic
1160039188 18:75330218-75330240 AAAGATGGAGTGGCAGCAGGAGG + Intergenic
1163742888 19:19027316-19027338 AGGGAAGGAGAGGTGCCAGGAGG + Intronic
1165866069 19:38939818-38939840 GGTGAAGGAGTGGCCTGAGGCGG + Intronic
1165948236 19:39458112-39458134 AGTAAAGGCCAGGCACCAGGTGG - Intronic
1166053482 19:40274896-40274918 AGTGGGGGAGGGGCAGCAGGTGG + Intronic
1166107041 19:40602550-40602572 AGAGAGGGAGTGGCAGCGGGCGG - Intronic
1167294205 19:48639868-48639890 AGTGAATGAGCTGCACCTGGGGG + Exonic
925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG + Intronic
925304750 2:2840193-2840215 GGTGAAGCAGAGGCTCCAGGAGG + Intergenic
926813656 2:16779232-16779254 AGAGAAGGAGTGACATCAGTAGG - Intergenic
927139688 2:20121342-20121364 AGAGAAGGAGGAGCTCCAGGAGG - Intergenic
927650346 2:24909197-24909219 AGTCCAGGCGTGGCACCATGAGG - Intronic
928945449 2:36767976-36767998 AAGGAAAAAGTGGCACCAGGTGG - Intronic
929073189 2:38055188-38055210 AGGGAAGGAGTGAAACTAGGCGG - Intronic
929881446 2:45840591-45840613 AGTGAGGGAGTGCCACGAGCAGG - Intronic
930540803 2:52704211-52704233 AGTAAAGGAGTGTCAACAGAAGG - Intergenic
930557330 2:52914770-52914792 AGTGGAGGAGTGGCAAGAGCTGG + Intergenic
932736125 2:74255971-74255993 AGTGAGGGAGTGAGAGCAGGTGG - Intronic
933942010 2:87252862-87252884 AGTGATGATGAGGCACCAGGAGG + Intergenic
936524138 2:113231545-113231567 AGTGAAGGAGTTGCAGGAGGCGG + Intronic
937986938 2:127642218-127642240 AGGGCAGGGGTGGCACCTGGGGG - Intronic
940808978 2:158221546-158221568 AGTGAGCGACTGGCAGCAGGGGG + Intronic
941737999 2:169001545-169001567 AGTGAGGGGGTGGCACAAGAGGG + Intronic
944129863 2:196336083-196336105 AGTTAAGGAGTGGCAAAAGCAGG + Intronic
945726482 2:213476678-213476700 TGGGAAGGAGTGGCACCCAGTGG + Intronic
946820770 2:223627141-223627163 GGGGAAGGAGTGGCACCATCTGG + Intergenic
947807853 2:232980986-232981008 GGAGAAGGACTGGCACCAGTAGG + Intronic
948310362 2:236981246-236981268 AGTGAAGGAGTTGCTGCATGGGG + Intergenic
1171461374 20:25299949-25299971 AGTGAAGGAGTGTAACCGCGAGG + Intronic
1172271935 20:33659807-33659829 AGTGAAGGAGCGGGCCCTGGGGG + Intronic
1172755139 20:37278465-37278487 AGAGAAGGAGTTTCACCATGTGG + Intergenic
1173643875 20:44621792-44621814 GGAGAAGCAGTGGCCCCAGGAGG - Intronic
1174067157 20:47873814-47873836 ACTGAAGAAGTGGAACCAGCAGG + Intergenic
1174223013 20:48972432-48972454 AGTGGATGAGTGTCCCCAGGTGG - Intronic
1175339777 20:58221181-58221203 AGGGAGTGAGTGGCACCATGGGG + Intronic
1175747429 20:61467936-61467958 AGGGAAGAAGTGGCACAGGGTGG + Intronic
1175777646 20:61663286-61663308 AGGAAAGGAGTGGCACCCGCAGG + Intronic
1176142896 20:63553101-63553123 GGTGAAGGAGGGGCACCTTGGGG + Intronic
1179474403 21:41634109-41634131 AGTAGAGCAGTGGCACCATGAGG - Intergenic
1179507296 21:41850296-41850318 AGTGTTGGGGGGGCACCAGGAGG - Intronic
1180736542 22:18021993-18022015 GGTGAAGTTCTGGCACCAGGTGG + Intronic
1180840014 22:18954833-18954855 AGGGAAGCAGGGGCATCAGGGGG - Intergenic
1181054388 22:20253197-20253219 AGCGAGGAAGTGGCTCCAGGTGG - Intronic
1181061886 22:20285647-20285669 AGGGAAGCAGGGGCATCAGGGGG + Intergenic
1181592343 22:23893264-23893286 AGAGAAGGTGTGACACCAGGAGG + Intronic
1182329940 22:29544439-29544461 TGGTAAGGAGTGGGACCAGGTGG - Exonic
1182438358 22:30345903-30345925 AGGGAAGGGATGGCACAAGGAGG + Intronic
1182500515 22:30743452-30743474 GGTGATGGAGTGGTACCCGGGGG - Intronic
1184021861 22:41826432-41826454 AGTGATGGCGTAGGACCAGGAGG - Intergenic
1184889954 22:47373599-47373621 AGAGAAGGCGTGGAGCCAGGAGG + Intergenic
1185317055 22:50183800-50183822 GGAGAAGGAGGGGCTCCAGGAGG + Intergenic
951658376 3:25034671-25034693 AGTCAAAGAGTGTCACAAGGAGG - Intergenic
953546915 3:43870354-43870376 GGAGGAGGAGTGGCACAAGGTGG + Intergenic
953966559 3:47311779-47311801 AGTGATGGAGTTACACAAGGGGG - Intronic
955640752 3:61081296-61081318 ATTGAAAGAATGGCAGCAGGAGG - Intronic
957912201 3:86634571-86634593 AGGGCTAGAGTGGCACCAGGGGG - Intergenic
958449768 3:94259149-94259171 AATGAGGGAGGGGCCCCAGGTGG - Intergenic
958986988 3:100792312-100792334 AGAGAAGGAGGAGGACCAGGAGG + Intronic
962930217 3:140028882-140028904 AGTGGAGGTGTGGGACCAGAGGG - Intronic
963020065 3:140864311-140864333 AGTGGAGGAGTTGCAGGAGGTGG - Intergenic
964473056 3:157074512-157074534 AGAGCAGGTGTGGCATCAGGTGG + Intergenic
966139624 3:176741097-176741119 GGTGAAGGAGGGCCAACAGGAGG + Intergenic
968726197 4:2248899-2248921 GGTGCAGGCCTGGCACCAGGAGG - Exonic
968944869 4:3658361-3658383 AGGGGAGGGGAGGCACCAGGAGG - Intergenic
969520677 4:7676094-7676116 GGTGCAGGAGTGGTACCAGATGG + Exonic
973892243 4:55378734-55378756 AGAGAAGGAGAGGTACAAGGGGG - Intergenic
974544447 4:63282426-63282448 AAAAAAGGAGTGGAACCAGGAGG - Intergenic
982298260 4:153852413-153852435 GGTGAAGGGGTGACAGCAGGTGG + Intergenic
982506151 4:156219680-156219702 AGTGCTGGAGTGGCACCTGGTGG + Intergenic
990352641 5:54934271-54934293 AGTGATGGGGTGGCAGCAGGGGG + Intergenic
992896697 5:81252090-81252112 AGTGGAGGAGTGGCACGAGAGGG + Intronic
996753748 5:126915140-126915162 AGAGAAGGAGGGGCACCTGCTGG + Intronic
997266620 5:132498476-132498498 AGTGAAGGAGTGCCACGGAGGGG + Intergenic
1002660456 5:180787979-180788001 AGAGCAGGAGTGGCAGGAGGTGG + Intergenic
1002715748 5:181225861-181225883 TTTGAAGCAGTGGGACCAGGAGG + Intronic
1004112179 6:12729736-12729758 AGGCAAGGAGAGGCATCAGGAGG + Intronic
1007481461 6:42153080-42153102 AGAGAAGGAGGTGCTCCAGGAGG + Intergenic
1012164161 6:95927137-95927159 AGAGAAGGTATAGCACCAGGTGG - Intergenic
1016636613 6:146299613-146299635 TTTGAAGGAGTAGCACCTGGAGG - Intronic
1017061898 6:150492268-150492290 GGTGAAGAAATGACACCAGGAGG + Intergenic
1018074589 6:160200651-160200673 AGGGAATGAGGGGCAACAGGAGG - Intronic
1019666802 7:2256052-2256074 AGTGAAGGAATGGGACCAACAGG - Intronic
1020779193 7:12496995-12497017 AGTGAAAGTTTGCCACCAGGTGG - Intergenic
1024229020 7:47350089-47350111 AGGGAAGGAAAGGCACCAGTGGG - Intronic
1024620376 7:51151921-51151943 AGTTAAGGAATGGCCACAGGCGG - Intronic
1026337041 7:69403365-69403387 AGTGAAGCAGTGCCATCAGCTGG - Intergenic
1026828918 7:73600011-73600033 AGGGAAGGGGAGCCACCAGGGGG - Intronic
1028538110 7:91911901-91911923 AGTGAAGAAGTGTCTCAAGGAGG + Intergenic
1031061023 7:117051625-117051647 AGAGCAGGAGTGGAAGCAGGAGG + Intronic
1031369505 7:120947476-120947498 AGAGAAGCAGGGGCACAAGGTGG + Intergenic
1032248686 7:130234325-130234347 AGTGAGGAAGGGGCCCCAGGTGG + Intergenic
1032702863 7:134397576-134397598 AGGGAAGGAGTGAAGCCAGGTGG + Intergenic
1032934291 7:136711226-136711248 AGAGAAGGAGTGGGAGGAGGAGG + Intergenic
1034503386 7:151466588-151466610 AGTGAAGATGTGGCCACAGGAGG - Exonic
1034544209 7:151779330-151779352 AGCCCAGCAGTGGCACCAGGAGG - Intronic
1035202668 7:157277240-157277262 GGGGAAGGACAGGCACCAGGAGG - Intergenic
1035280648 7:157776171-157776193 AGTGAAGGAGAGGGAGAAGGAGG - Intronic
1036019766 8:4831606-4831628 AAAGAAAGAGTGTCACCAGGTGG - Intronic
1039879145 8:41612931-41612953 AGTGAAGGATCGCCACCTGGTGG + Exonic
1040060550 8:43099884-43099906 AGTGAAGGTGGGGGAACAGGTGG + Intronic
1041670076 8:60483057-60483079 AGTCAGGGAGTGGCACCCTGTGG - Intergenic
1041894046 8:62903591-62903613 ACTGAAGAAGAGGCAGCAGGTGG - Intronic
1042564784 8:70100774-70100796 AGTGAAGGTGGGGCAGGAGGGGG - Intergenic
1043157339 8:76800139-76800161 AGTGAAGGAGTCGCACAATTAGG + Intronic
1044290046 8:90457646-90457668 ACTAAAGCAGTGGTACCAGGTGG - Intergenic
1044348676 8:91137257-91137279 ATAGAAGAAGTGGCACCAGAAGG - Intronic
1045547558 8:103141486-103141508 AGGGAGAGAGGGGCACCAGGTGG - Intronic
1048949724 8:139485936-139485958 AGCAAAGGACTGGCACCAGTAGG + Intergenic
1049286432 8:141777944-141777966 GGTGGAGAAGTGGAACCAGGAGG + Intergenic
1049382070 8:142321156-142321178 AGTCAAGGAAGGGCAGCAGGCGG + Intronic
1049454844 8:142681601-142681623 AGTGGAGGAGTGGCAGATGGAGG - Intronic
1049622512 8:143605029-143605051 AGTGCTGGGGTGGCACCAGGTGG - Exonic
1050550528 9:6744995-6745017 AGGGAAGGAGAGGGACCAGGAGG - Intronic
1053576065 9:39358074-39358096 TGTCAAGGTGTGGCCCCAGGAGG - Exonic
1053840581 9:42186011-42186033 TGTCAAGGTGTGGCCCCAGGAGG - Exonic
1054097637 9:60916765-60916787 TGTCAAGGTGTGGCCCCAGGAGG - Intergenic
1054119039 9:61192395-61192417 TGTCAAGGTGTGGCCCCAGGAGG - Exonic
1054588713 9:66990167-66990189 TGTCAAGGTGTGGCCCCAGGAGG + Intergenic
1055110259 9:72552312-72552334 AGTCAGGGAGTGACAGCAGGGGG - Intronic
1055766058 9:79664702-79664724 AGGGAAGAAGTGGCAGCGGGAGG - Intronic
1057383733 9:94590290-94590312 AGCCAAGGAGAGGCTCCAGGCGG + Intronic
1057424292 9:94935958-94935980 AGTGAAGGAGAGGCAGGAGCTGG - Intronic
1057861452 9:98644064-98644086 AGTGAGGGAGAGACAACAGGTGG - Intronic
1058180311 9:101790373-101790395 ATTGAAGGGGTGGCAGGAGGAGG + Intergenic
1058790892 9:108444535-108444557 TGAGATTGAGTGGCACCAGGTGG - Intergenic
1059414481 9:114154818-114154840 CGTGAACGAGTGGCAAGAGGTGG + Intergenic
1060148772 9:121273162-121273184 AGTGAAGGGGTCGCACCAGTGGG + Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062477495 9:136736049-136736071 AGGGAGGGAGGGGCAGCAGGAGG - Intergenic
1062683149 9:137794927-137794949 AATGAATGAGGGGCACCAGATGG + Intronic
1187963737 X:24590537-24590559 AGAGAAGGAGAGGAACCAAGAGG + Intronic
1192224403 X:69218342-69218364 AGTGAAGGAGTGGCCCCCAAGGG + Intergenic
1192573421 X:72224314-72224336 AGTAAAGGAGTGGGACAATGAGG - Intronic
1193565101 X:83066103-83066125 AGAGAAGAAGTGGGACCAGGGGG + Intergenic
1194143581 X:90235364-90235386 AGTAAAGGAGTGGGACAATGGGG - Intergenic
1194320320 X:92438673-92438695 AGAGAAGGAGTTGAACCAGCAGG + Intronic
1195006063 X:100687101-100687123 TGTGAAGGAGTGCCATCAGCTGG - Exonic
1200489334 Y:3804681-3804703 AGTAAAGGAGTGGGACAATGGGG - Intergenic
1200628438 Y:5551803-5551825 AGAGAAGGAGTTGAACCAGCAGG + Intronic