ID: 1149986617

View in Genome Browser
Species Human (GRCh38)
Location 17:61352532-61352554
Sequence GAGTAGAAGTGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1151
Summary {0: 1, 1: 0, 2: 9, 3: 108, 4: 1033}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149986611_1149986617 -6 Left 1149986611 17:61352515-61352537 CCTGGTTGGCCTCGGTGGAGTAG 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG 0: 1
1: 0
2: 9
3: 108
4: 1033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149986617 Original CRISPR GAGTAGAAGTGGAGGGAAGG AGG Intronic
900541854 1:3206876-3206898 GAGTAGAAAGGGATGAAAGGAGG + Intronic
900622842 1:3595294-3595316 GGGTGGAGGTGGAGGGAGGGCGG + Intronic
900830158 1:4959972-4959994 GGGGAGAAGGGAAGGGAAGGAGG + Intergenic
900915616 1:5636126-5636148 GGGGAGATGTGGAGGGTAGGGGG - Intergenic
900993243 1:6107401-6107423 GTGGAGAAATGGAGGGATGGAGG + Intronic
901429124 1:9201761-9201783 AAGGAGAGGAGGAGGGAAGGAGG - Intergenic
902079166 1:13809364-13809386 TGGTAGAAGAGGAAGGAAGGCGG + Intronic
902437536 1:16408191-16408213 GAGGAGTAGGGGATGGAAGGAGG + Intronic
902490863 1:16779439-16779461 GAGAGGAAGGGGAGGAAAGGAGG + Intronic
902597100 1:17516840-17516862 TAAGAGAAGAGGAGGGAAGGTGG - Intergenic
902610726 1:17595714-17595736 GAGGAGAGGCGGAGGGAAGGAGG + Intronic
902779855 1:18698009-18698031 GATTAGAAGGGAAGGGAAGGAGG + Intronic
902960477 1:19959705-19959727 GGGTAGAAAGGGAGGGAAGGAGG - Intergenic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
903331706 1:22600042-22600064 GAGTGGAGGAGGAAGGAAGGGGG + Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
903892298 1:26577801-26577823 ATGCAGAAGTGGGGGGAAGGAGG - Intergenic
904404193 1:30275390-30275412 GAGGACAAGTGGAGGGAGGTGGG - Intergenic
904587051 1:31586449-31586471 GAGCAGAAGAGGAGGGAACCTGG - Intronic
904676352 1:32201334-32201356 GGGTGGAAGTGGAGGGATGCCGG + Intronic
904737786 1:32648213-32648235 TAGTAGAAGTGGGAGGAAAGAGG + Intronic
905094404 1:35456841-35456863 AAGGAGAGATGGAGGGAAGGAGG + Intronic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905427724 1:37897283-37897305 GAATAGAAAGGGGGGGAAGGTGG + Intronic
905717267 1:40162273-40162295 GAGTAGAAGAGGATGGGAAGAGG + Intronic
905869674 1:41396025-41396047 CAGTTCAGGTGGAGGGAAGGTGG - Intergenic
905958021 1:42015524-42015546 GAGGAGAGCTGGAGGGAAGGAGG - Intronic
906192227 1:43905694-43905716 GAGGAAGAGTGGTGGGAAGGGGG - Intronic
906472999 1:46146668-46146690 GTGTAGAGTTGGAGGGGAGGGGG - Intronic
906779633 1:48561262-48561284 GAAGAGAAGGGAAGGGAAGGAGG - Intronic
906843559 1:49165676-49165698 GAGAAGAGATGGAGGAAAGGAGG + Intronic
906883244 1:49616069-49616091 GAGAAAAGGTGGTGGGAAGGAGG + Intronic
907216509 1:52869689-52869711 GAATAGAAAAGGAGGAAAGGTGG - Intronic
907324437 1:53627756-53627778 GAGAGGAGGTGGAGGGGAGGAGG + Intronic
907419332 1:54336370-54336392 AAGGAGAAAAGGAGGGAAGGAGG - Intronic
907745171 1:57206206-57206228 GAGGAGAAGAGGAGGGAGGCAGG + Intronic
908165605 1:61454729-61454751 AAGAATAAGTGGAGGTAAGGTGG - Intronic
908436573 1:64112732-64112754 GATTAGATGGTGAGGGAAGGAGG - Intronic
909602216 1:77472579-77472601 GAAAAGAAGAGGAGGGAGGGAGG + Intronic
909938063 1:81577306-81577328 GAGTAGAAGGGGATGAAAGCAGG - Intronic
910636016 1:89408750-89408772 TAGTAGGAGTGGAGAGGAGGAGG - Intergenic
911316382 1:96361423-96361445 GAGTAGAAGAGGAGGGAGAAAGG - Intergenic
911460493 1:98183000-98183022 GAGGACAAGAGAAGGGAAGGTGG - Intergenic
911477704 1:98393830-98393852 GTGTAGAAAGGGAGGGAAGAAGG + Intergenic
911720544 1:101186760-101186782 GAGAAAAAGAGGAGGGAGGGAGG - Intergenic
912437305 1:109670820-109670842 GAGGATAAGTGGAAGAAAGGAGG - Intronic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
913280481 1:117180787-117180809 GAGCAGAAGTGGAGAGAGGCGGG - Intronic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913493990 1:119410607-119410629 GAGTAGAAGTTGGTGGCAGGAGG - Intergenic
913575118 1:120164427-120164449 TACTAGAAGAGGAGGGAAGGAGG - Intronic
913696779 1:121334219-121334241 GACTTGAAGTGGAGAGAAGGAGG - Intronic
914140781 1:144945841-144945863 GACTTGAAGTGGAGAGAAGGAGG + Intronic
914557423 1:148780068-148780090 TACTAGAAGAGGAGGGAAGGAGG - Intergenic
914615411 1:149350162-149350184 TACTAGAAGAGGAGGGAAGGAGG + Intergenic
914912577 1:151799704-151799726 AGTGAGAAGTGGAGGGAAGGGGG - Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915298788 1:154940401-154940423 GAGAGGAAGTGGAGGGTGGGGGG + Intergenic
915399781 1:155613694-155613716 GAGAAGAGGTGGGGGTAAGGAGG - Exonic
915416938 1:155749559-155749581 GAGAAGAGGTGGGGGTAAGGAGG - Intergenic
915482402 1:156195868-156195890 GAGTAGAGGTGGAGAGGAGGAGG + Intronic
915604970 1:156944756-156944778 GGGTAGAACTGGAGGTAAGGTGG - Intronic
915841085 1:159213568-159213590 GGGAAGAAGTGGAGGGAGGAAGG + Intergenic
916048235 1:161016799-161016821 GAGTAGAGGGAGAGGAAAGGAGG + Intronic
916055284 1:161064943-161064965 GGGAAGAAGGGAAGGGAAGGGGG + Intronic
916223507 1:162466366-162466388 GAGTAGAAAGGGGGGAAAGGTGG + Intergenic
916289730 1:163151632-163151654 GAATAAAAGTGGAGTGAAGGGGG - Intronic
916522794 1:165580277-165580299 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
916851826 1:168711949-168711971 GGGCAGAAGTGGAGGGATGGGGG + Intronic
917036063 1:170748174-170748196 GAGTAGGAGGGAAGGGAGGGAGG - Intergenic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917125326 1:171682546-171682568 GAGGGGAGGGGGAGGGAAGGTGG - Intergenic
917312894 1:173695353-173695375 GAATACTAGAGGAGGGAAGGAGG - Intergenic
918344347 1:183593231-183593253 CAGGAGAAGGGGAGGGAAAGTGG - Intronic
918400900 1:184162093-184162115 GAGAGGAAGTGCAGGGAGGGAGG + Intergenic
919176720 1:194028433-194028455 GAGGGGAAGGGGAGGGGAGGGGG - Intergenic
919207670 1:194437786-194437808 GGGTGGAGGTGGGGGGAAGGGGG - Intergenic
920039743 1:203087678-203087700 GACAGGAAATGGAGGGAAGGAGG + Intergenic
920053653 1:203177986-203178008 GGTTTGAAGTGGAGGGAAGGAGG - Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920242848 1:204566177-204566199 GAGTAGAAGTGTAGGGTAAATGG + Intergenic
920304875 1:205012227-205012249 CAGAGGAAGTGGAGGAAAGGGGG + Intronic
920397549 1:205658234-205658256 GAGTGGAAGTGGGGGGAACCAGG + Exonic
920434553 1:205939609-205939631 GGCAAGAGGTGGAGGGAAGGGGG + Intronic
920484110 1:206352573-206352595 GACTTGAAGTGGAGAGAAGGAGG - Intronic
920634485 1:207686188-207686210 GAGAAGGAAAGGAGGGAAGGAGG - Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921508099 1:215998836-215998858 GAGAAGAAGTGGAAGGAATGGGG + Intronic
922112803 1:222578473-222578495 GGGTAGAAGTTGGGGGAAGTAGG - Intronic
922219686 1:223548956-223548978 GGGTAGAATTGAAGGGGAGGAGG + Intronic
922387421 1:225101496-225101518 GAGGAGTAGTGGAGAGAATGGGG - Intronic
922421183 1:225462085-225462107 GAGAAGGTGTTGAGGGAAGGAGG + Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923081009 1:230655136-230655158 GAATAGAAGTGGTGAGAAGAGGG + Intronic
923274623 1:232385530-232385552 AAGGAGAGGTGCAGGGAAGGCGG + Intergenic
923529582 1:234803097-234803119 GAGAGGAAGGGGAGGAAAGGAGG - Intergenic
923649492 1:235860506-235860528 GATTAGTGGTGGAGAGAAGGAGG - Intronic
923784103 1:237051230-237051252 GAGGGGAAGGGGAGGGAAAGGGG - Intronic
923954505 1:239000275-239000297 GAGTAGAATTAGAGGGCAGGAGG + Intergenic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1063312592 10:4968569-4968591 GAGAAGAATTGGGGGTAAGGAGG + Intronic
1063315341 10:4998995-4999017 GAGAAGAATTGGGGGTAAGGAGG - Intronic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063533920 10:6863954-6863976 GAGGTGAAGGGGAAGGAAGGAGG + Intergenic
1063634485 10:7768612-7768634 GAGTAGCAGTTGAAGGAGGGAGG + Intronic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064114752 10:12568302-12568324 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1064142080 10:12799045-12799067 GAGTAGAGATGGAGGCCAGGAGG + Intronic
1064289517 10:14020859-14020881 CTGTAGAGGTGGAGGAAAGGGGG + Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064627249 10:17273870-17273892 GAGGAGAGGAGGAGGAAAGGAGG - Intergenic
1065046639 10:21752160-21752182 GGGGAGGAGTGGAGGGAGGGAGG - Intergenic
1065423987 10:25579995-25580017 GAAGAGAGGTGGAGGGTAGGGGG - Intronic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1065716592 10:28575253-28575275 TACTAGAAGGGGAGGAAAGGAGG - Intronic
1065866486 10:29919402-29919424 GAGGGTAAGAGGAGGGAAGGGGG - Intergenic
1065967036 10:30779012-30779034 AGGAAGAAGAGGAGGGAAGGAGG + Intergenic
1066214403 10:33272509-33272531 GAGGAGGAGGGGAGGCAAGGAGG + Intronic
1067508848 10:46878348-46878370 GAGAGGAGGTGGAGGGGAGGGGG + Intergenic
1067556218 10:47274875-47274897 GAGTAAAAGGGGAGGCAGGGTGG + Intergenic
1067653401 10:48173502-48173524 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1067854874 10:49783571-49783593 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1067931396 10:50565756-50565778 GAGTACTAGTGGAGGTTAGGGGG + Intronic
1068189655 10:53634895-53634917 AAATAGAATTGGAGGGGAGGGGG - Intergenic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1068927394 10:62554456-62554478 GAGAAGAAAAGGAGAGAAGGTGG - Intronic
1068937330 10:62648693-62648715 GAGCAGGAGTGCAGAGAAGGTGG - Intronic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069111525 10:64453321-64453343 GAGTACAAGTAGAAGAAAGGCGG - Intergenic
1069278994 10:66629835-66629857 AAGTATAAGTGGTGTGAAGGTGG - Intronic
1069410004 10:68143601-68143623 GGGTGGAAGTGGAAGGAGGGAGG + Intronic
1069578063 10:69544798-69544820 GAGTCGAAGGGGAGGGAGAGCGG - Intergenic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070244969 10:74722099-74722121 GAGTAGTTGTAGAGGGAAAGTGG - Intergenic
1070307592 10:75248835-75248857 GAGAAGTAGGGTAGGGAAGGGGG - Intergenic
1070597902 10:77845581-77845603 AGGGAGAAATGGAGGGAAGGAGG + Intronic
1070701955 10:78610371-78610393 GGGAAGTATTGGAGGGAAGGTGG + Intergenic
1070711868 10:78689000-78689022 GAGGAGAGGAGGAGGGAATGGGG - Intergenic
1071097480 10:81995341-81995363 GAGAAGAAGTGCAGGAAAGCAGG - Intronic
1071115195 10:82210461-82210483 AAGGAGAAGTGGAGGGCAGGGGG + Intronic
1071129902 10:82378535-82378557 GAGTAGAAGAGAAGAGAGGGAGG - Intronic
1071239758 10:83692573-83692595 AACTAGAAATGGAGGAAAGGAGG - Intergenic
1071304539 10:84286833-84286855 GAGTAGGGGTGGGAGGAAGGTGG + Intergenic
1072066049 10:91872685-91872707 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1072079249 10:92012179-92012201 GGGGAGAAGGGGAGGGGAGGGGG - Intronic
1072899091 10:99391677-99391699 GAGTCGAACTGGAGGTAACGAGG - Exonic
1073072710 10:100805101-100805123 GAATAGATATGGAGGGAAGATGG + Intronic
1073125053 10:101144020-101144042 GTGTAGAAGGTGAGGGAAGGAGG - Intergenic
1073140397 10:101243420-101243442 GAGAAGGAGTGGAGGGGATGAGG + Intergenic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1073225950 10:101919198-101919220 GAGAAGAAAGGGAGGGAAGGAGG - Intronic
1073652432 10:105375848-105375870 GAGTAGAAGTGGAGGTTGGAAGG - Intergenic
1074135802 10:110625625-110625647 GAGTCCAAGTGGAGTGAAGAGGG - Intergenic
1074242678 10:111654581-111654603 GGGAAGAAGGGAAGGGAAGGGGG - Intergenic
1074524503 10:114252336-114252358 GAGTAGAGATTGAGGGGAGGAGG + Intronic
1074706064 10:116133020-116133042 GATTAGAGGGGGAGGGGAGGGGG - Intronic
1074793243 10:116913822-116913844 GAGAAGAAGTGTGGGGAAGCTGG + Intronic
1074850077 10:117432530-117432552 GAGCAGAGGTGGAGGAATGGGGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075402757 10:122172821-122172843 GAGCAGACGGGGAGGGCAGGGGG + Intronic
1075753227 10:124791310-124791332 GAGTAGGAGGGGAGGGATGTGGG - Intronic
1075809156 10:125211868-125211890 GGCTACAAGTGGAGGGGAGGTGG - Intergenic
1076088220 10:127654658-127654680 GAGGAGTGGTAGAGGGAAGGAGG - Intergenic
1076214196 10:128679728-128679750 GGGTAGCAGTGGTGTGAAGGAGG + Intergenic
1077082061 11:728616-728638 GAGGAAAAGGGGAGGGATGGGGG + Intergenic
1077214959 11:1391346-1391368 GGGCAGGGGTGGAGGGAAGGAGG + Intronic
1077909647 11:6563146-6563168 GAGGAGCAGTGCAGGGCAGGCGG - Intronic
1078107470 11:8367578-8367600 GAGTAGTAGAGAAGGGAAAGGGG + Intergenic
1078966291 11:16348034-16348056 GAGTAGAAAGGGAGGGGAAGAGG + Intronic
1079636124 11:22743611-22743633 TTGTAGCAGTGGAGGGAGGGAGG - Intronic
1079662919 11:23064227-23064249 GAGTAGAGTGGGAGGGAAGCAGG - Intergenic
1080103760 11:28490032-28490054 GAATAGAAGGAGAGGGAAGAAGG + Intergenic
1081665982 11:44917435-44917457 GAATAAGATTGGAGGGAAGGTGG - Intronic
1081747702 11:45484537-45484559 GGGAGGAAGTGGAGGGAAAGAGG + Intergenic
1082008290 11:47433371-47433393 GAGGAGGAGTGGAGGCCAGGAGG - Intergenic
1083267520 11:61553622-61553644 GACTTGATGTGGAGGGCAGGGGG + Intronic
1083697670 11:64453530-64453552 GAGGAGATGAGGAAGGAAGGAGG + Intergenic
1084529259 11:69717453-69717475 GAGGAAAAGAGGAGGGGAGGAGG - Intergenic
1084544499 11:69807909-69807931 GAGGGGAAGGGGAGAGAAGGCGG - Intergenic
1084582527 11:70032826-70032848 GGAAAGAAGTGGAGGGAAAGAGG + Intergenic
1084596513 11:70119915-70119937 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
1084617252 11:70244794-70244816 GAGGAGGAGGAGAGGGAAGGAGG + Intergenic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085523874 11:77153339-77153361 GAGCAGGGTTGGAGGGAAGGGGG + Intronic
1085620279 11:78032655-78032677 GAGAAGATGTGGAGGAAAGAGGG - Intronic
1086122229 11:83316051-83316073 GAGTAGAAAGGGGGGAAAGGTGG - Intergenic
1086159945 11:83710787-83710809 GAGAAGAAGCTGAGGGCAGGTGG + Intronic
1086163251 11:83747088-83747110 GAGGAGAAGTGGTGGGAGGTTGG + Intronic
1087336378 11:96850120-96850142 TGGTAGAAGTGTAGGGATGGTGG + Intergenic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088415937 11:109589053-109589075 GAGGAGAAGTGAAGGGGATGAGG + Intergenic
1088524220 11:110735224-110735246 GAGAAGCAGAGGAGGGGAGGAGG + Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089111659 11:116062302-116062324 CACAAGAAGCGGAGGGAAGGAGG + Intergenic
1089180183 11:116578238-116578260 AAGAAGAAATGGAGGGAGGGAGG - Intergenic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089676176 11:120091407-120091429 GGGTAGAAGGAGAGGGAAGGTGG - Intergenic
1089749024 11:120637113-120637135 AAAGAGAAGAGGAGGGAAGGAGG + Intronic
1089780700 11:120871449-120871471 GAGTAGAAGATGATGGATGGAGG + Intronic
1090116020 11:123974849-123974871 GAGTAGACTTGAAGTGAAGGTGG - Intergenic
1090188352 11:124752367-124752389 GGGGAGAAGAGGAAGGAAGGAGG - Intergenic
1090614718 11:128504489-128504511 GATGAAAAGTGGAGAGAAGGAGG + Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090933325 11:131319400-131319422 GAGAAGGAGGGGAGGGGAGGGGG - Intergenic
1090976331 11:131683486-131683508 GAGTGGAGGTGAAGGGGAGGAGG + Intronic
1091143187 11:133253811-133253833 GAATGGAAGGGAAGGGAAGGAGG - Intronic
1091388755 12:112286-112308 GTGGGGAAGTGGGGGGAAGGGGG + Intronic
1091568416 12:1663772-1663794 GAGGAAAACAGGAGGGAAGGAGG + Intergenic
1091568427 12:1663808-1663830 GAGGAAAACAGGAGGGAAGGAGG + Intergenic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092048047 12:5446601-5446623 GAGTAGAGGTTCAGAGAAGGAGG + Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092159356 12:6307575-6307597 CAGTAAATGTGGAAGGAAGGGGG + Intergenic
1092191831 12:6526865-6526887 GAGGAGAGGGAGAGGGAAGGTGG - Intronic
1092205683 12:6613232-6613254 GAGAGGAAATGGAGGGGAGGGGG + Intergenic
1092223138 12:6729133-6729155 GAATGGGAGTGGAGGGCAGGTGG + Intronic
1092817294 12:12323030-12323052 GAGGAGAGGGGGAGGGGAGGGGG + Intergenic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1094009247 12:25789335-25789357 GAGTAGAACTGAAGGTCAGGAGG + Intergenic
1094125161 12:27015444-27015466 GATTAGATATGGAGGAAAGGGGG + Intergenic
1094209515 12:27874411-27874433 GAATAGAAGCGGGGGAAAGGTGG + Intergenic
1095301932 12:40594648-40594670 GAGTAGAAGAGTAGGGAGGAGGG - Intergenic
1095587018 12:43860712-43860734 GAGGAGAAGTGGAGGGAGGTGGG + Intronic
1096391452 12:51232314-51232336 AAGCAGAAGGGGAAGGAAGGAGG - Intergenic
1096624920 12:52888845-52888867 AAGTAGAAGTGGAGGGTACAGGG - Intergenic
1096784354 12:54008753-54008775 GAGGAGAGGGGGAGGGATGGGGG - Intronic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1097456698 12:59807188-59807210 AAGTAACAGTGCAGGGAAGGGGG + Intergenic
1097627921 12:62023219-62023241 GGTTGGAAGTGGAGGGAAAGGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1097827253 12:64186885-64186907 AAGCAGAAGTGGATGGAAAGAGG - Intronic
1097959229 12:65516180-65516202 CAGCAGAAGTGATGGGAAGGTGG - Intergenic
1097966352 12:65585659-65585681 GAGTGGAGCTGGAGGAAAGGAGG - Intergenic
1098347480 12:69521441-69521463 GAATAGAAGTGGTGGCAAGAGGG + Intronic
1098464546 12:70771396-70771418 GAGGAGAGAGGGAGGGAAGGGGG + Intronic
1098521533 12:71439673-71439695 GGGGACAAGTGGAGGGAAAGTGG + Intronic
1098825950 12:75297613-75297635 GAGAAGATGTGGATGGAATGGGG - Intronic
1099665124 12:85618918-85618940 GCATAGAACTGGATGGAAGGAGG - Intergenic
1099942054 12:89200173-89200195 GAGTAGAAGTGAATGGGAGAGGG - Intergenic
1100631961 12:96399330-96399352 GAGCGGAGGTAGAGGGAAGGTGG - Intronic
1100951114 12:99851323-99851345 GAGTTGAACTGGAGGGAATGAGG - Intronic
1101252799 12:102951785-102951807 GAGAAGAAGGAGGGGGAAGGGGG - Intronic
1101837012 12:108302919-108302941 ATGGAGAAGTGGAGGGATGGAGG + Intronic
1102194729 12:111016928-111016950 GAGAAGAAGAGAAGGGAGGGAGG - Intergenic
1102437527 12:112936915-112936937 GAGAAAAAGTGGAGTCAAGGGGG - Intergenic
1102503149 12:113366779-113366801 GAGAGGAGGAGGAGGGAAGGAGG - Intronic
1102503160 12:113366809-113366831 AAAAAGAAGGGGAGGGAAGGGGG - Intronic
1102908390 12:116694555-116694577 GGGTAGAAGCGAAGGGAGGGTGG + Intergenic
1103015019 12:117487510-117487532 GAGCAGAGGTGGAGGAAGGGTGG + Intronic
1103285360 12:119796484-119796506 GCCTAGAAGGGTAGGGAAGGTGG + Intronic
1103626680 12:122225643-122225665 GAGGAGACGTGGAGAGGAGGAGG - Intronic
1103954528 12:124568712-124568734 AAGCAGAAGAGGAGGGAGGGAGG - Intergenic
1104148889 12:126062601-126062623 TAGGAAAAGTGGAGGGAGGGGGG - Intergenic
1104167711 12:126250128-126250150 GAGTAGCAGTGGAGGGGAAGCGG - Intergenic
1104188832 12:126458415-126458437 GAGCAGCAGTGCAGGGAAGCGGG - Intergenic
1104273226 12:127301403-127301425 GTTTAGAAGTGGAGGGAACCGGG - Intergenic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104544477 12:129698674-129698696 GAGGAGATGGGGAGGGGAGGGGG + Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105285273 13:18998347-18998369 GAGGAGAAGCGGAGGGAAGGAGG - Intergenic
1105435208 13:20371295-20371317 GCCTAGAAGAGAAGGGAAGGGGG - Intergenic
1105453815 13:20523202-20523224 GAGTAGAAGTCCAGGCATGGTGG - Intronic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1105661331 13:22498544-22498566 GAGGAGACGGGGTGGGAAGGGGG + Intergenic
1106052411 13:26204011-26204033 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1106473875 13:30080804-30080826 GGCTAGTAGGGGAGGGAAGGCGG + Intergenic
1106675886 13:31957636-31957658 GAGGAGAAGAGGGGGGAAGGGGG + Intergenic
1107183325 13:37487538-37487560 GAGTAGAAGAGAAGGCAATGAGG - Intergenic
1107794445 13:44035562-44035584 GAGAAGAAAAGGAGGGAAGGAGG + Intergenic
1107835827 13:44411874-44411896 GAAGGGAAGGGGAGGGAAGGGGG + Intergenic
1108514818 13:51191120-51191142 GAATAGGAATGGAGGGAAAGGGG - Intergenic
1108790273 13:53961529-53961551 GAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1108823136 13:54378289-54378311 GAATAGAAGTTGAGGAAATGAGG - Intergenic
1108853559 13:54765643-54765665 AAGTGGAAGTGGAGGGTATGAGG + Intergenic
1109195267 13:59371726-59371748 GATTAAAATTGGAGGGAAAGAGG - Intergenic
1110211280 13:72976349-72976371 GCGAAGGAGGGGAGGGAAGGAGG + Intronic
1110264308 13:73520685-73520707 GAGAAAAAGTGGAAGGGAGGGGG + Intergenic
1110364828 13:74670029-74670051 GAGGGAAAGGGGAGGGAAGGAGG - Intergenic
1110433996 13:75458989-75459011 GAGTAGTGGAGGAGGTAAGGAGG - Intronic
1110478897 13:75950747-75950769 GAAGAGAAGTTGAAGGAAGGTGG - Intergenic
1110551711 13:76818202-76818224 GAGTGGAAGTGGAGGTACTGAGG - Intergenic
1110598935 13:77349700-77349722 TAGTGGAAGTGGAGGGAGAGGGG + Intergenic
1111006427 13:82255711-82255733 AAGGAGAGGTGGAGGGAGGGAGG - Intergenic
1111526535 13:89478096-89478118 CAGTAGAAGTGGGCTGAAGGTGG + Intergenic
1111675076 13:91376882-91376904 GAGGAGAAGTGGGAGGAAAGAGG - Intergenic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112108998 13:96273964-96273986 GAGGAGGAGGGGAGGGAGGGAGG - Intronic
1112420230 13:99242182-99242204 GAATAGAAGGGGGGGAAAGGTGG - Intronic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113647351 13:112008124-112008146 GGGTAGATGTGGAGAGAAAGAGG - Intergenic
1113891495 13:113737932-113737954 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1115440581 14:33430267-33430289 AAGAAGAACTGAAGGGAAGGCGG - Intronic
1115498274 14:34027413-34027435 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1116495696 14:45557372-45557394 GCCTTGAAGTGGAGGGAAGTGGG + Intergenic
1116788943 14:49318910-49318932 GAGGAGAAGGGAAGGGAGGGAGG + Intergenic
1116945597 14:50831849-50831871 GATCAGAAGTGTAGGGATGGGGG - Intergenic
1116954549 14:50910771-50910793 CAGGAAAAGTGGAAGGAAGGAGG - Intronic
1117277485 14:54204452-54204474 GAGTAGAAAGGGGGGAAAGGTGG + Intergenic
1117649068 14:57883039-57883061 GAGGAGAAGGGGAGGGGAGGAGG + Intronic
1118072077 14:62256510-62256532 GAGTAAAAGCAGACGGAAGGTGG - Intergenic
1118507450 14:66428984-66429006 GACTAGATGTGGAGAGAAGCAGG + Intergenic
1118610759 14:67537807-67537829 GAGTAGGATGGGTGGGAAGGTGG - Intronic
1118994337 14:70822702-70822724 GAGGAGAGGAGGAGGGAAGAAGG - Intergenic
1119032400 14:71202932-71202954 GAGGGGAAGAGAAGGGAAGGGGG + Intergenic
1119184060 14:72625202-72625224 GAGTAAATGTAGAGGGAAAGGGG - Intronic
1119382639 14:74239078-74239100 GCATAGGAGTTGAGGGAAGGAGG + Intergenic
1119600180 14:75970646-75970668 GAGGGGAAGAGGAGGGGAGGTGG - Intronic
1119854737 14:77891061-77891083 GAGGAGAGGGGGAGGGAAAGTGG + Intronic
1120119493 14:80661226-80661248 GAGCAGAAGAGGAGGAAAGATGG - Intronic
1120583831 14:86287085-86287107 GAAGGGAAGGGGAGGGAAGGAGG + Intergenic
1120583862 14:86287181-86287203 GAAGGGAAGGGGAGGGAAGGAGG + Intergenic
1120583881 14:86287240-86287262 GAAGAGAAGGGGAGGGAAGGAGG + Intergenic
1120764690 14:88318017-88318039 GAATAGAAGTGCAGTGAGGGTGG - Intronic
1120821244 14:88913642-88913664 GAGAGGAAGTGGAGGGCTGGAGG + Intergenic
1121475341 14:94195699-94195721 GAGTAGAGGGGAGGGGAAGGGGG + Intronic
1121597594 14:95177616-95177638 GGGTAGTAGTGGAGGGGTGGGGG - Intergenic
1121623007 14:95363172-95363194 GAGGATAGGAGGAGGGAAGGAGG - Intergenic
1121800805 14:96772611-96772633 GTGCAGAAGTTGAGAGAAGGAGG - Intergenic
1121826126 14:97010973-97010995 GAGCAGGCTTGGAGGGAAGGGGG + Intergenic
1121992533 14:98573635-98573657 GGGTAGAAGGGAAGGGAGGGTGG + Intergenic
1122224558 14:100266369-100266391 GAGTTGCAGTGGAGGGGCGGAGG + Intronic
1122426221 14:101607653-101607675 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426259 14:101607801-101607823 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426313 14:101608002-101608024 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426326 14:101608055-101608077 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426346 14:101608129-101608151 GAGGAGAGGTGGAGGACAGGAGG - Intergenic
1122889178 14:104724662-104724684 GAGTAGGGGTGGGTGGAAGGAGG - Intronic
1123432450 15:20230080-20230102 GAGGAGAAGAGAAGGGAAGAGGG + Intergenic
1123998718 15:25736738-25736760 GCTTAGGAGTGGGGGGAAGGAGG + Intronic
1124216736 15:27813348-27813370 GTGAAGAAGTGGATGGAAGTGGG - Intronic
1124357621 15:29008225-29008247 GGCTAGAAGGAGAGGGAAGGGGG + Intronic
1124720256 15:32105467-32105489 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1124720261 15:32105486-32105508 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1125178691 15:36856700-36856722 GAGGGGAGGGGGAGGGAAGGGGG - Intergenic
1125299359 15:38238055-38238077 GCCTATAGGTGGAGGGAAGGGGG + Intergenic
1125822884 15:42648760-42648782 TAATGGTAGTGGAGGGAAGGGGG - Intronic
1126321661 15:47430682-47430704 GAGTAGAAATGGGGGCAGGGTGG - Intronic
1126453157 15:48832620-48832642 GAGAAGAAGAAGAGGGAAAGGGG - Intronic
1126482598 15:49142700-49142722 GGGTAGAAGCGGAGGGAAAAAGG - Intronic
1126892036 15:53216824-53216846 GAGAACAAAAGGAGGGAAGGAGG - Intergenic
1127282120 15:57501589-57501611 GAGAAGAAGTGGGGAGCAGGAGG + Intronic
1127478242 15:59354848-59354870 GGGTAGCTGTGGAGGGAAGCTGG - Intronic
1127507548 15:59610867-59610889 GGAGAGAAGGGGAGGGAAGGAGG - Intronic
1127801383 15:62480116-62480138 GAGTAAAAGGGGAGAGCAGGTGG + Intronic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128095659 15:64952737-64952759 GAGGAGAAGAGGAAAGAAGGAGG - Intronic
1128355580 15:66924070-66924092 GAAGAGAAGGGGAGGGAAGGAGG - Intergenic
1128453822 15:67821975-67821997 GGGGAGAAGTGGAGGAAAAGGGG + Exonic
1128620589 15:69146127-69146149 GAGGAGCAGGGGAGGGAACGAGG + Intergenic
1128643003 15:69353692-69353714 GGGTAGAAATGGAGGGAGGTGGG + Intronic
1128704999 15:69832223-69832245 GAATAGGAGGGGAGGGGAGGGGG + Intergenic
1129117917 15:73375554-73375576 TTGTAGAAGTGGAGGCAGGGAGG + Intergenic
1129199914 15:73992481-73992503 GAGTAGGAGAAGAGGGGAGGAGG - Intronic
1129683637 15:77672181-77672203 GAGTCCATGTGGAGGGGAGGTGG - Intronic
1130226093 15:82059152-82059174 GAGAAGGAGAGGAGGGGAGGGGG - Intergenic
1130390104 15:83447584-83447606 GAGGCGCAGAGGAGGGAAGGAGG + Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130720951 15:86385927-86385949 GAGGAGAGGAGGAGGGGAGGGGG - Intronic
1130847155 15:87758169-87758191 GAGAAGGAAAGGAGGGAAGGAGG + Intergenic
1130866777 15:87940149-87940171 GAATAGATGTTGAGGGAGGGGGG - Intronic
1131084682 15:89566458-89566480 GAGTAGGAGTTGGGGGAAAGAGG - Intergenic
1131364488 15:91826999-91827021 GAGTGGAAGTGGTGGGTAGGGGG - Intergenic
1131515862 15:93076257-93076279 GAGTGGAAAGGGAGAGAAGGTGG - Intronic
1131823340 15:96295179-96295201 GAGAAGAAGAGGAAGGAAAGGGG - Intergenic
1131868819 15:96740511-96740533 GAGTAGAAGGGTGTGGAAGGAGG - Intergenic
1131915697 15:97263532-97263554 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1132202138 15:99962310-99962332 GGGTAGGAGAGGAGGGAACGGGG + Intergenic
1132304345 15:100800706-100800728 GAGAAGAAGTGGAGGGATGTGGG + Intergenic
1132535013 16:474452-474474 GAGTAGAAGGGGATGGACTGTGG + Intronic
1132868421 16:2104915-2104937 GAGAAAAAGGGGAGGGGAGGAGG + Intronic
1132890570 16:2202373-2202395 AAGGAGAAGTGGAGCAAAGGAGG + Intergenic
1132942492 16:2514857-2514879 GTGTGGAAGTGGAGGGAGCGGGG + Intronic
1133058413 16:3158813-3158835 GGGTAGGGGTGGAGTGAAGGCGG + Intergenic
1133299640 16:4774799-4774821 GAATAGAAAGGGGGGGAAGGTGG - Intergenic
1133520214 16:6549344-6549366 GAGGAGGGGAGGAGGGAAGGAGG + Intronic
1134471768 16:14532611-14532633 GAGTAGAAAGGGGGGAAAGGTGG - Intronic
1135063502 16:19290330-19290352 GAGGGGAAGTGGAGGGAGAGAGG - Intronic
1135130738 16:19851856-19851878 GAGGAAAAGGGGAGGGAAGCAGG - Intronic
1135187279 16:20326261-20326283 GGATAGAAGTGCAGAGAAGGTGG - Intronic
1135294715 16:21269329-21269351 GAGACGCAGTGGGGGGAAGGTGG + Intronic
1135529082 16:23237239-23237261 AAGGAGAAGGGAAGGGAAGGAGG - Intergenic
1135874327 16:26183783-26183805 GAGTATAAGGGGAGGGGAGTGGG + Intergenic
1136168199 16:28470613-28470635 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1136285523 16:29238315-29238337 GAGTGTAAGGGGAGGAAAGGAGG + Intergenic
1136343373 16:29659774-29659796 GAGTGAAAGAGGAGAGAAGGAGG - Intergenic
1136852188 16:33621057-33621079 GAGGAGAAGGGAAGGGAAGAGGG - Intergenic
1137352745 16:47727925-47727947 GAGAAGAAGTGGATGGAATCTGG + Intergenic
1137476189 16:48811551-48811573 GAGTAAAGGCGGAGTGAAGGCGG - Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137639253 16:50013925-50013947 GTGAAGCAGGGGAGGGAAGGAGG - Intergenic
1137819914 16:51434450-51434472 GAGTTGGATTGGAGGAAAGGGGG + Intergenic
1138028390 16:53539809-53539831 GAATAGAAAGGGAGGAAAGGTGG + Intergenic
1138532033 16:57639756-57639778 GAGGGGAAGGGGAGTGAAGGAGG - Intronic
1138667732 16:58586331-58586353 GAGGGGAAGGGGAGGGGAGGGGG + Intronic
1139296638 16:65907164-65907186 GAGTAGAAAGGGAGGTAGGGTGG + Intergenic
1140219620 16:73034192-73034214 GAGGAGAAATGGAGGGACAGAGG - Intronic
1140376633 16:74450170-74450192 TAATAGAAGTAGAGGGTAGGGGG - Intergenic
1140980432 16:80103916-80103938 GATTAGAAGTGGAGTGAAGATGG - Intergenic
1141046951 16:80723895-80723917 GAGGAGAAATGGGGGGAAGGAGG + Intronic
1141150968 16:81564499-81564521 GAGTTGATGTGGGGGGAAGAAGG + Intronic
1141345012 16:83236805-83236827 GAGTGGCAGGGGTGGGAAGGAGG + Intronic
1141389087 16:83649541-83649563 AAGTTGATGTGCAGGGAAGGAGG + Intronic
1141713937 16:85716355-85716377 GAGGAGGAAGGGAGGGAAGGAGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142325601 16:89412442-89412464 GAGAAGAAGAGGAAGGTAGGAGG - Intronic
1142827038 17:2519898-2519920 CAGTAGAAATTGTGGGAAGGAGG - Intergenic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1143374367 17:6458613-6458635 GCGGAGAAGTGGTGGGGAGGGGG - Intronic
1143374974 17:6462012-6462034 GAGTAGGGGTGGAGGGAAAGAGG - Intronic
1143483001 17:7238143-7238165 GAGTAGAAGGGGCCGGAGGGCGG - Intronic
1143508133 17:7380871-7380893 GAGCAGAGGAGAAGGGAAGGGGG + Exonic
1143627023 17:8116352-8116374 TAGTAGTAGGGGAGGGAATGGGG + Intronic
1143685741 17:8514353-8514375 GCGGCAAAGTGGAGGGAAGGAGG - Intronic
1144509253 17:15861273-15861295 AAGTAGAAGTTCAGGGAATGGGG + Intergenic
1144772799 17:17769275-17769297 GAGTAGAAGTGGATGGATGGGGG + Intronic
1144939526 17:18928376-18928398 AAGAAGAAGTGGGGGGAAAGAGG + Intronic
1145173368 17:20678917-20678939 AAGTAGAAGTTCAGGGAATGTGG + Intergenic
1145398106 17:22511918-22511940 GAGGTGAAGTGGGGGGAAGGGGG - Intergenic
1145846380 17:28042136-28042158 GGGCAAAAGTGAAGGGAAGGAGG - Exonic
1146111662 17:30095290-30095312 TAGGAGAAGTGGAGGGCCGGGGG - Intronic
1146184861 17:30718150-30718172 GAGTAGAAGTGATGGGAAGGTGG + Intergenic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146569896 17:33943239-33943261 GAGGAGAAGCGCAGGGAAGAAGG + Intronic
1146594479 17:34157102-34157124 GAGGAGGAGAGGAGGGACGGAGG - Intronic
1146625906 17:34435257-34435279 GAGAGGAAGTGGAGAGAGGGAGG - Intergenic
1146645181 17:34572502-34572524 GAGAAGAAAGGGAGGGGAGGAGG - Intergenic
1147036272 17:37683770-37683792 GAGAAGAGGAGGAGGGAGGGGGG + Intergenic
1148269525 17:46252818-46252840 GAGTAGAAAGGGGGGAAAGGTGG - Intergenic
1148435749 17:47683283-47683305 ATGTAGAAGTGGGGGGGAGGGGG + Exonic
1148689567 17:49519616-49519638 GGGTAGCAGTGGAGAGGAGGAGG - Intergenic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1148760929 17:49999636-49999658 GGGTAGAAGTGGAGAGCAGTGGG + Intergenic
1148905931 17:50912053-50912075 GAAGGGAAGGGGAGGGAAGGGGG + Intergenic
1149424931 17:56545928-56545950 GAGAGGAAGGGAAGGGAAGGAGG + Intergenic
1149596755 17:57868714-57868736 GAGGTGAGGGGGAGGGAAGGGGG + Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150578974 17:66454986-66455008 AGGCAGCAGTGGAGGGAAGGTGG + Intronic
1150947688 17:69765606-69765628 GAGAAGAGGGGGAGGGAAGAGGG - Intergenic
1151050999 17:70978550-70978572 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151051009 17:70978576-70978598 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151476853 17:74349042-74349064 TTGTGGAAGTGGAGGAAAGGAGG + Intronic
1151520970 17:74629307-74629329 AAGAAGAAGTGGTGGGGAGGGGG + Intergenic
1151718534 17:75843491-75843513 GGGGAGAAGTGGTGGGATGGAGG + Exonic
1152274695 17:79349456-79349478 GAGTAGGAGTTGGGAGAAGGAGG - Intronic
1152315493 17:79578110-79578132 GGGTAGTGGTGGAGGGAAGGGGG + Intergenic
1152796537 17:82310382-82310404 GAGGAGATGAGGAGGGGAGGAGG + Intergenic
1153376982 18:4391854-4391876 GTGTAGATGTGGAGGGAATGAGG - Intronic
1153843028 18:9024063-9024085 GAGTAGAAAGGGGGGAAAGGTGG - Intergenic
1154268337 18:12898088-12898110 GAGCAGCAGTGCAGGGAAGGAGG - Intronic
1154407060 18:14101892-14101914 GAGAAAAAGTAGAGGGCAGGAGG - Intronic
1155328375 18:24689267-24689289 AACTACAAGTGGAGCGAAGGTGG + Intergenic
1155442844 18:25880214-25880236 GACTACTAGTGGAGGGAAGGTGG + Intergenic
1156472869 18:37388431-37388453 GAGAAGAAGGAGAGAGAAGGAGG - Intronic
1156506421 18:37598185-37598207 AAGTATGAGTGGAGGGATGGCGG - Intergenic
1156551404 18:38022742-38022764 GAGAGGCAGTGGAGGGAGGGAGG - Intergenic
1156958037 18:42992143-42992165 GAGAAGAAGTGGAGGAATGGAGG - Intronic
1157096017 18:44686010-44686032 GAGGCGAAGTGGAGAGAATGAGG + Intronic
1157098777 18:44711228-44711250 GAGGAGTAGGGGAGGGAGGGAGG - Intronic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157629131 18:49079849-49079871 GAATAGAAAGGGGGGGAAGGTGG - Intronic
1157705376 18:49800446-49800468 GAGTAGAAAGGGGGGAAAGGTGG + Intronic
1158516896 18:58138322-58138344 GAGGAGGAGGGGAGGGAAGAAGG - Intronic
1158610400 18:58935198-58935220 GAGGAGAAGGAGAGGGGAGGAGG - Intronic
1159310262 18:66698469-66698491 GAGGAGAAAGGGAGGGAAGAAGG + Intergenic
1159310294 18:66698563-66698585 GAGGAGAAAGGGAGGGAAGGAGG + Intergenic
1159817811 18:73098704-73098726 GAGCAGTTGTGGAGGGAAGCTGG - Intergenic
1160047959 18:75405491-75405513 GTGTAGAGGTGGAGGGTTGGGGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160135333 18:76266468-76266490 AAGGAGAAGGGAAGGGAAGGGGG + Intergenic
1160322061 18:77905518-77905540 AGGTGGAAGGGGAGGGAAGGGGG + Intergenic
1160366446 18:78329872-78329894 GAGCAGAACTGGAGAGCAGGTGG + Intergenic
1160448581 18:78946837-78946859 GAGGAGAAGGGGAGAGGAGGAGG + Intergenic
1160614011 18:80109850-80109872 GAGTAGAGGGAGAGGGAACGGGG + Intronic
1161370607 19:3908859-3908881 GAGAGGAAGATGAGGGAAGGAGG - Intronic
1161404307 19:4083093-4083115 GAGGAGAAGTCCTGGGAAGGAGG - Intergenic
1161615279 19:5266766-5266788 GAGAAAAAGAGGAGGGAAGGTGG - Intronic
1161643082 19:5436381-5436403 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1161684825 19:5697542-5697564 GAGGAGATGGAGAGGGAAGGGGG + Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1162365770 19:10248332-10248354 GAGAAGAACTGGGGGGTAGGGGG + Intergenic
1162973920 19:14197545-14197567 GAGTAGAAGTGATGGGAAGGTGG - Intronic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163138923 19:15332930-15332952 GGGGTGAAGTGGAGGAAAGGAGG + Intergenic
1163206029 19:15803407-15803429 GAATGGAAGGGAAGGGAAGGGGG + Intergenic
1163247926 19:16108866-16108888 GAGCTGAAGTGGAAGGGAGGAGG + Intergenic
1163435531 19:17292953-17292975 GAGTGGAAGTGGAGAGATGCAGG - Intronic
1163701993 19:18790735-18790757 GAGGAGATGGGGAGGGAAGGGGG - Intronic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1163779673 19:19239785-19239807 GAGGAGGAGTGGAAGGGAGGAGG - Intronic
1164292111 19:23878324-23878346 GAGTAGAAGAGAAGGAGAGGTGG + Intergenic
1164292159 19:23878649-23878671 GAGTATAAGAGGAGAAAAGGGGG + Intergenic
1164292457 19:23880434-23880456 GAGGAGAGGAGGAGGAAAGGAGG + Intergenic
1164466940 19:28495101-28495123 AGGAAGAAGGGGAGGGAAGGAGG + Intergenic
1164506064 19:28862468-28862490 GATGAGCAGAGGAGGGAAGGAGG - Intergenic
1164744224 19:30599351-30599373 GAGGAGGAAGGGAGGGAAGGAGG - Intronic
1165060488 19:33202775-33202797 GGGTTGCAGTGGGGGGAAGGGGG - Intronic
1165383962 19:35499765-35499787 GTTTGGAAGTGGAGGGCAGGAGG - Intronic
1166008624 19:39925126-39925148 AAGAAGAAGAAGAGGGAAGGGGG + Intronic
1166139740 19:40799489-40799511 GAGTGGAGGGGGAGGGGAGGGGG + Intronic
1166154666 19:40901926-40901948 GAGTAGGAGTGAAGGAAACGAGG + Intergenic
1166173404 19:41048303-41048325 GAGTAGGAGTGAAGGAAACGAGG - Intergenic
1166177631 19:41086202-41086224 GAGGGGAAGAGGTGGGAAGGAGG - Intergenic
1166197093 19:41214245-41214267 GGGCAGGAGTAGAGGGAAGGTGG - Intergenic
1166338415 19:42122592-42122614 GAATGGAAGTGGGGTGAAGGAGG + Intronic
1166421277 19:42639248-42639270 GAGTAGAAAAGGGGGAAAGGTGG - Intronic
1166422940 19:42652673-42652695 GAGTTGATGAGGATGGAAGGAGG - Intronic
1167130542 19:47582326-47582348 GAGAGGAAGAGGAGGGAAGGAGG - Intergenic
1167268495 19:48494913-48494935 GAGCAGATGTGAAGGAAAGGAGG - Intronic
1167477876 19:49711499-49711521 GAGAAGAGGTGCAGGGCAGGTGG - Intronic
1167601970 19:50459673-50459695 GAGGAGATGAGGAGGGGAGGGGG + Intronic
1167671968 19:50858740-50858762 GAGTCAAAGAAGAGGGAAGGAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168077177 19:53987435-53987457 GAGTCAAAGGGGAAGGAAGGAGG + Exonic
1168099486 19:54133743-54133765 GAGGGGAGGTGGAGAGAAGGAGG - Intergenic
1168125654 19:54281099-54281121 GAGGAGAAATGCAGGGAAGTAGG + Exonic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168348311 19:55661366-55661388 GAGGGGAAGAGGAGGGAGGGAGG - Intronic
925222159 2:2150843-2150865 GAAAAGAAGGGAAGGGAAGGAGG + Intronic
925225741 2:2182883-2182905 GAGTTGCAGGGGAGAGAAGGAGG + Intronic
925235569 2:2274345-2274367 GGGTAGGAGAGAAGGGAAGGAGG + Intronic
925332392 2:3068674-3068696 GAGAAGAGTTGGAGGGAATGTGG + Intergenic
925907094 2:8546053-8546075 GCGTTGATGTGGAGGGAAGGGGG + Intergenic
926445886 2:12942455-12942477 GAATGGAAGTTGAGTGAAGGGGG + Intergenic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927471836 2:23383558-23383580 GAGCAGGAGTGGGGGGGAGGGGG - Intergenic
927517320 2:23679983-23680005 GAGGAGGAGCGGAGGGAACGGGG + Intronic
928194602 2:29206187-29206209 GAGAAGAAAGGGAGGGAGGGAGG - Intronic
928313690 2:30230943-30230965 AAGAAGAAGCGGTGGGAAGGTGG - Intergenic
928328852 2:30341847-30341869 GAATTGAAGTTTAGGGAAGGTGG + Intergenic
928494774 2:31820436-31820458 GAGCAGAAGTGGCTGGGAGGTGG + Intergenic
928559728 2:32467636-32467658 GAGAAGAGGTGGATGGAAGGCGG + Exonic
928602366 2:32915992-32916014 AAGTAGAGCAGGAGGGAAGGAGG - Intergenic
928898955 2:36297382-36297404 GAGTAGAGTTGGAGAGAATGTGG - Intergenic
929005332 2:37387942-37387964 GAGTAAAAGTGAAGGAAAGTAGG - Intergenic
929098567 2:38286972-38286994 GAGTAGACATGGAGGACAGGAGG + Intergenic
929175592 2:38972254-38972276 GATTTGAACTGGAGGTAAGGGGG + Intronic
929423441 2:41818938-41818960 GAGGAGGAGAGGAGGGGAGGAGG + Intergenic
929460484 2:42099348-42099370 GAGCAGAGGTGGGGGGATGGTGG + Intergenic
929650686 2:43677643-43677665 GAATAGAAATGGGGGAAAGGTGG - Intronic
930076862 2:47413167-47413189 GAGTAGCAGTGGCGGGCAGAAGG - Intronic
930589830 2:53314001-53314023 AAGAAGAAAAGGAGGGAAGGAGG + Intergenic
930665270 2:54095329-54095351 GAATAGAAGTGGGGGAAAGGTGG - Intronic
930752190 2:54945021-54945043 GAGTGAAGGAGGAGGGAAGGAGG - Intronic
930847776 2:55923824-55923846 GAGGAGAAAGGGAGGGAAAGGGG + Exonic
931034423 2:58221981-58222003 GAGTAGAACTGGGGAGGAGGAGG + Exonic
931307238 2:61041646-61041668 GATTAGCAGTGAATGGAAGGAGG + Intronic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
931953676 2:67394467-67394489 GATTAGAAGTGGACAGAGGGAGG - Intergenic
932206867 2:69890989-69891011 AAGAACAAGTGGAGGGAATGAGG - Intergenic
932253774 2:70266908-70266930 GAATAGAAGTGGGGGAAATGTGG - Intronic
932410171 2:71542816-71542838 GAGTAGAAAGGGAGGAAATGTGG - Intronic
932743550 2:74312165-74312187 GATTAGAAGTAAAGGGAGGGAGG - Intronic
932749010 2:74359181-74359203 GAGGTAGAGTGGAGGGAAGGAGG + Intronic
932892444 2:75608857-75608879 GAGGAGAAGGGGCGGGGAGGAGG + Intergenic
934652345 2:96099814-96099836 GAAGAGAAGGGGAGGGGAGGAGG + Intergenic
934784664 2:96996255-96996277 GAGGAGAAGGGAAGGGATGGAGG - Intronic
934903562 2:98179990-98180012 AAATAGAAAGGGAGGGAAGGAGG - Intronic
935177236 2:100660290-100660312 AAGCAGAAATGGAGAGAAGGAGG + Intergenic
935645274 2:105329531-105329553 GAGCAGGAGTGGGGGGTAGGCGG - Intronic
935680883 2:105636036-105636058 GAAGAGAAGTGGTTGGAAGGAGG + Intergenic
935924101 2:108048468-108048490 GAGTGAAGGTGGAGGGAGGGTGG - Intergenic
936311775 2:111392134-111392156 AAGGAGAAGAGGATGGAAGGAGG + Intergenic
937153885 2:119704606-119704628 AAGAAGAAGGGGAGGAAAGGAGG + Intergenic
937683898 2:124674412-124674434 GAGGAGAGGAGGAGGGAGGGAGG - Intronic
937785959 2:125898458-125898480 GAGTAGGAGTGGTGGTAAGCAGG + Intergenic
937920105 2:127122730-127122752 GAGGAGAGCTGGAGGGAGGGGGG + Intergenic
937998531 2:127713745-127713767 GAAGAGAAGTGGAGGCGAGGGGG - Exonic
938028986 2:127975770-127975792 GAGGAGAAGTGAAGGCAAAGTGG + Intronic
938094279 2:128451520-128451542 TTTTAGAAGTGGAGGGCAGGAGG + Intergenic
938589457 2:132722631-132722653 AAGTGGAAGTGGTGGGTAGGTGG - Intronic
938657309 2:133447539-133447561 GAAAGGAAGGGGAGGGAAGGGGG - Intronic
938702051 2:133888280-133888302 GAAAAGAGGTGGGGGGAAGGAGG + Intergenic
938769901 2:134492506-134492528 GGCTAGAGGTGGAGGGAGGGAGG - Intronic
939063518 2:137453761-137453783 GGCTGGAAGTGGAGGGAAGGGGG - Intronic
939126243 2:138180874-138180896 ATGCAGAAGTGGAGGGTAGGGGG + Intergenic
939746675 2:145980134-145980156 AGGAAGAAGTGGCGGGAAGGAGG - Intergenic
940299366 2:152161047-152161069 GAATAGAAGGGGGGGAAAGGTGG + Intronic
940565357 2:155353566-155353588 AAGTACGTGTGGAGGGAAGGTGG - Intergenic
940851897 2:158695445-158695467 AAGCAGAAGTGTTGGGAAGGAGG + Intergenic
941072162 2:160967553-160967575 GTGTAGAAGTGAAGGGGAGGTGG - Intergenic
941328407 2:164145339-164145361 TATTGAAAGTGGAGGGAAGGGGG - Intergenic
941786865 2:169506351-169506373 GAGTGGAGGTGGGGGGAAGGTGG + Exonic
942121844 2:172785801-172785823 AAGAAGAAGTGGAGAGAAAGGGG - Intronic
942279022 2:174342532-174342554 GACTGGAAGAGGAGGGAAAGGGG - Intergenic
942282154 2:174376494-174376516 GAATAGAAATGGAGGGCTGGAGG + Intronic
944154982 2:196598454-196598476 GAGGAGAAGGGGAGGGAAAGGGG + Intergenic
944212642 2:197222267-197222289 GAGGAGGAGGGTAGGGAAGGAGG + Intronic
944406750 2:199393253-199393275 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
944424749 2:199568695-199568717 GAGAAGCAGTGTAGGGAATGTGG + Intergenic
944782985 2:203039341-203039363 AAGGAGAAGGGGAGGGGAGGGGG - Intronic
944819020 2:203410169-203410191 AAGTAGTGGTGGAGGTAAGGAGG - Intronic
944952798 2:204771513-204771535 GAGTACTAGGGCAGGGAAGGAGG + Intronic
944963103 2:204899216-204899238 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
944977830 2:205077160-205077182 GAGTAGAGAGGGAGGGAGGGAGG + Intronic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
945123196 2:206480262-206480284 GGGTAGTATTGGGGGGAAGGAGG + Intronic
945428814 2:209740156-209740178 GAGTAGCAGTGGTGGCATGGAGG + Intergenic
945589204 2:211708655-211708677 GGTTGGAAGTGCAGGGAAGGAGG - Intronic
945973691 2:216254292-216254314 GAGTAGATGTGGGAGGAGGGAGG + Intergenic
946015881 2:216603349-216603371 GAGAGGAAGGGGAGGGGAGGAGG + Intergenic
946115790 2:217460904-217460926 TTGTAAAAGTGGAGGGAAAGAGG + Intronic
946173457 2:217908876-217908898 GACTCCAAGTGGAGAGAAGGTGG - Intronic
946199875 2:218065249-218065271 GAGTAGGAGAGGAGGGGTGGGGG + Intronic
946579743 2:221115484-221115506 GATTTGCAGTGGAGGGAATGTGG - Intergenic
946825030 2:223669023-223669045 GGTCAGAAGTGTAGGGAAGGTGG - Intergenic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947942451 2:234070151-234070173 GAGGAGAAGTCTTGGGAAGGAGG - Intronic
948230122 2:236343142-236343164 GAGTGGATGTGAGGGGAAGGAGG - Intronic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
948995479 2:241576166-241576188 GAGTAGAGCTGCAGGGAAGGAGG - Intergenic
949032846 2:241805204-241805226 GGGTTGAGGGGGAGGGAAGGTGG - Intergenic
949033778 2:241807485-241807507 GGGTTGAGGGGGAGGGAAGGTGG - Intergenic
1169150390 20:3285010-3285032 GAATGGGAGTGGAGGGCAGGAGG - Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1171030004 20:21668847-21668869 TTGTAGAAGGGGAGGGAAGGAGG + Intergenic
1171091508 20:22289868-22289890 GGCTAGAAGGGGAAGGAAGGGGG - Intergenic
1171444664 20:25195322-25195344 ATGTAGACGTGGAGGGATGGGGG + Intergenic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1171956769 20:31469893-31469915 GAATAGAAAGGGAGGAAAGGTGG - Intronic
1172028882 20:31968049-31968071 TAATTGAAGTGGAGGGGAGGAGG + Exonic
1172808886 20:37633133-37633155 GAGGAGATGGGGAGGGAGGGGGG + Intergenic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1172946317 20:38692473-38692495 GAGGAGAAAGGGAGGGAAAGGGG - Intergenic
1172974590 20:38896281-38896303 AAGCAGAAAAGGAGGGAAGGAGG - Intronic
1173002035 20:39111618-39111640 GAGGAGAGGAGGAGGGAAAGGGG + Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173404339 20:42752037-42752059 GAGTATAAGAAGAGGGAGGGAGG - Intronic
1173929008 20:46803000-46803022 GAGTAGAAGTGGGGGAGGGGTGG - Intergenic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174688887 20:52482891-52482913 GAGGAGAAGTGGTAGGAAAGTGG + Intergenic
1174885093 20:54325125-54325147 GAGAAAAAGTGGAGGGAGAGTGG + Intergenic
1174926595 20:54766896-54766918 CAGTAGATTTGGAAGGAAGGAGG - Intergenic
1174960522 20:55151769-55151791 GAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175316766 20:58054140-58054162 GAGTAGAGAGGGAGGGAGGGAGG + Intergenic
1175383588 20:58580161-58580183 GATTACAAGGGGAGGAAAGGCGG + Intergenic
1175657819 20:60787077-60787099 GGGTAGAGGAGGAGGGAAGAGGG - Intergenic
1176125522 20:63472965-63472987 GAGTGGAGGGGGAGGGGAGGGGG + Intergenic
1176229927 20:64027248-64027270 GAGGAGATGTGGAGGGCTGGGGG + Intronic
1177097937 21:16861630-16861652 GAGTAGAAGAGAAGGGAGTGTGG - Intergenic
1177633086 21:23751779-23751801 AAGTAGAAGAGGAGGAAAGCAGG + Intergenic
1177758317 21:25373721-25373743 GAGGAGGAGGGGAGGGGAGGGGG - Intergenic
1178170534 21:30035080-30035102 GAGGAGAAGAGGAGGGAAGGAGG - Intergenic
1178882936 21:36462984-36463006 GGGAAGAAGAGGAGGGAGGGAGG + Intronic
1179166528 21:38939392-38939414 GAGAAGGAATGAAGGGAAGGGGG + Intergenic
1179488687 21:41726958-41726980 GAGTAGAAGAGGTTAGAAGGTGG + Intergenic
1179714655 21:43280695-43280717 GAGGGGAGGTGGAGGGGAGGTGG + Intergenic
1179714693 21:43280782-43280804 GAGGTGGAGGGGAGGGAAGGTGG + Intergenic
1179799132 21:43802757-43802779 GGGAAGAAGTGGAGGGAAGAAGG - Intronic
1179983458 21:44908246-44908268 GAGAAGAAGGGGAGGGCAGCAGG - Intronic
1179997428 21:44980465-44980487 GAGAAGAAGGGGAGGGCCGGGGG - Intergenic
1180156154 21:45978125-45978147 GAGGGGGAGAGGAGGGAAGGGGG + Intergenic
1180706412 22:17812976-17812998 GAGTAGAAGTGGGGTGCGGGAGG + Intronic
1180714188 22:17860336-17860358 AAATGGAAGTGGAGAGAAGGCGG + Intronic
1180802316 22:18637654-18637676 GAGTAGCAATGAAGGGGAGGAGG + Intergenic
1180853551 22:19033206-19033228 GAGTAGCAATGAAGGGGAGGAGG + Intergenic
1181054653 22:20255042-20255064 GAGTAGAAGCTGAGGAAATGTGG + Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1181171941 22:21014899-21014921 GAGTGGAGGTGGTGGGAGGGTGG - Intronic
1181219410 22:21357607-21357629 GAGTAGCAATGAAGGGGAGGAGG - Intergenic
1181508443 22:23377556-23377578 GAGGAGAAGTGGAGAAAAAGAGG + Intergenic
1181597369 22:23925103-23925125 GATTAGAGCTGGTGGGAAGGGGG - Intergenic
1181799257 22:25333682-25333704 GAGTAGCAGGGGAGGTGAGGAGG + Intergenic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1182555688 22:31127260-31127282 GAGGAGATGTGGGTGGAAGGTGG - Intronic
1182916429 22:34037003-34037025 GAGAAGAAGTGAATGGAGGGTGG - Intergenic
1183089205 22:35509785-35509807 GAGCAGAAGTGGAGGGGCTGGGG - Intergenic
1183090170 22:35516980-35517002 GAGAAGAAGAGGAGGGACGGTGG - Intergenic
1183115633 22:35690547-35690569 GAGGAGAAGGGGAGGGAAGAGGG + Intergenic
1183153085 22:36053511-36053533 GAGAAGCAGGGAAGGGAAGGGGG - Intergenic
1183252094 22:36737420-36737442 GAGGAGAAGCAGAGAGAAGGAGG + Intergenic
1183313537 22:37124745-37124767 GAGGAGAGGTGGGGGGAGGGGGG - Intergenic
1183440315 22:37819179-37819201 GAGCGGAGGTGGAGGGAAGGAGG - Intergenic
1183775353 22:39960506-39960528 GAGTATTTGTGGAAGGAAGGAGG + Intronic
1183782400 22:40007275-40007297 GAGGAGGAGAGGAGGAAAGGAGG - Intronic
1183874910 22:40771716-40771738 GAGTAGTGGCGGGGGGAAGGTGG + Intronic
1184092896 22:42301668-42301690 GAGCAGCAAGGGAGGGAAGGTGG + Intronic
1184398331 22:44258880-44258902 GAGTAGGCGTGGAGGGTTGGGGG + Intronic
1184515617 22:44960264-44960286 AGGTAGCTGTGGAGGGAAGGGGG - Intronic
1184748400 22:46469977-46469999 GAGGAGGAGGGGAGGGAGGGAGG + Intronic
1185218570 22:49617359-49617381 GGGTAGAGAAGGAGGGAAGGAGG - Intronic
949269258 3:2195064-2195086 GACTGCAAGTGTAGGGAAGGAGG - Intronic
949755068 3:7399760-7399782 GATTACAAGTGGTGGGGAGGAGG - Intronic
950254888 3:11496406-11496428 GAGTAGAAAGGAAGGGAGGGAGG - Intronic
950365452 3:12480331-12480353 GAGGAGAGGAGGAGGGCAGGTGG - Intergenic
950655507 3:14433882-14433904 GAGTAGAAGGGAAGGGTTGGTGG + Intronic
950806978 3:15613545-15613567 GGGGAGAAGGGGAGGAAAGGAGG - Intronic
950811784 3:15656248-15656270 GATTAGAACTGATGGGAAGGGGG - Intergenic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951188670 3:19743796-19743818 GAGTTGCAGTGGGGAGAAGGAGG + Intergenic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951753844 3:26067280-26067302 GAGTGGAAGTGGAGGTTAAGAGG + Intergenic
952173558 3:30836194-30836216 GAGTAGAAGTGTAGGGTATGAGG - Intronic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952676665 3:36039590-36039612 TAGTAAAAGTGGAGAAAAGGAGG - Intergenic
953193504 3:40711518-40711540 GAGTAGGGGTAGAGGAAAGGGGG - Intergenic
953427864 3:42810563-42810585 AAGAAAAAGTGGAGGGAAAGGGG - Intronic
953449660 3:42995728-42995750 GAGAAGAAGGGGAGGGGAGCAGG - Intronic
953786275 3:45914144-45914166 GATTAGAATTTGAGGAAAGGAGG - Intronic
954002118 3:47566017-47566039 GAGGAGCAGAGGAGGGAAAGAGG + Intronic
954274526 3:49533493-49533515 GAGTGGAGGTGGAGGGAGCGAGG + Exonic
954674728 3:52309486-52309508 GGGTAGTAGGGGAGGGTAGGAGG - Intergenic
955131329 3:56171933-56171955 GTGTGGAGGTGGATGGAAGGGGG + Intronic
955472697 3:59302501-59302523 GAGTAGAACTGGGGGGATGGGGG - Intergenic
955579286 3:60401588-60401610 GACTAACAGTGGAGGGAAGCTGG - Intronic
956402177 3:68891716-68891738 GAGTGGAAGGGTAGGGATGGGGG + Intronic
956440930 3:69279765-69279787 GAGGAGAGGAGGAGGGGAGGAGG - Intronic
956540001 3:70326135-70326157 AAGGAGAAAGGGAGGGAAGGAGG - Intergenic
956643670 3:71435961-71435983 GAGGAAAAAAGGAGGGAAGGAGG + Intronic
957037058 3:75303130-75303152 GAGTAGGGGTGGAGGAAAGGGGG + Intergenic
957506036 3:81122345-81122367 AAGTAAAAGTGGAAGGAGGGAGG - Intergenic
957789355 3:84919069-84919091 GAATAGAAAAGGAGGAAAGGTGG + Intergenic
958513868 3:95086878-95086900 GAGGTGAAGTGGGAGGAAGGTGG - Intergenic
958982904 3:100745246-100745268 ATGGAGAGGTGGAGGGAAGGGGG - Intronic
960371988 3:116852180-116852202 GAGGAAAAGTGGAGAAAAGGAGG - Intronic
960803728 3:121563190-121563212 GAGGAGAAAGGGAGGGAAGGAGG + Intergenic
960817049 3:121684517-121684539 GGGGAGAAAGGGAGGGAAGGTGG + Intronic
960822902 3:121753029-121753051 GGGAAGAAGAAGAGGGAAGGTGG + Intergenic
960990926 3:123310648-123310670 GCATAGAAGTCAAGGGAAGGAGG + Intronic
961558292 3:127711579-127711601 AATTAGAATTGGACGGAAGGTGG + Intronic
961619114 3:128209385-128209407 GAGTAGAGGGGGAGTGTAGGAGG + Intronic
961639038 3:128353446-128353468 GAGGAGGAGAGGAGGGAAAGAGG - Intronic
961919429 3:130410470-130410492 GGGTAGAAGTGGACAGAAAGGGG + Exonic
962072257 3:132044786-132044808 GAGGAGAGGGGGAGGGGAGGGGG + Intronic
962319608 3:134379290-134379312 GAGTAATCCTGGAGGGAAGGAGG + Intergenic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
962559535 3:136591264-136591286 GAGGAGGGGAGGAGGGAAGGCGG + Intronic
962586115 3:136844019-136844041 GAGTAGAAGTGATTGGGAGGTGG + Intronic
962745700 3:138396090-138396112 GTGGAGAAGGGGAGGGAAGGGGG + Intronic
963184179 3:142394478-142394500 AAGTTGAAGTAGAGTGAAGGAGG - Intronic
963230464 3:142904413-142904435 GAGCAGGAGAGGAGAGAAGGAGG + Intergenic
963244330 3:143046763-143046785 GAATAGAAGGGGGGGAAAGGTGG - Intronic
963248798 3:143086060-143086082 GAATAGAAGGGGGGGAAAGGTGG - Intergenic
963509619 3:146230631-146230653 GAGCAGAAGAGGTGGGAAAGTGG + Intronic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964445428 3:156752720-156752742 GAGGAGGAGTGGAGCGGAGGTGG + Intergenic
965322441 3:167266426-167266448 GATTAGAACTGACGGGAAGGGGG - Intronic
965323484 3:167274639-167274661 GATTAGAACTGACGGGAAGGGGG - Intronic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965486028 3:169279447-169279469 GAGGAAAAGAGGAGGGAAAGCGG + Intronic
965551268 3:169967074-169967096 GAGCAGCAGGGGAAGGAAGGAGG + Intronic
965630380 3:170726706-170726728 GTGTAGAAGAGGAGGGAAACTGG - Intronic
965768746 3:172158855-172158877 GAGGAAGAGGGGAGGGAAGGAGG - Intronic
965834995 3:172841343-172841365 CGGTAGAAGTGGACAGAAGGGGG - Intergenic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
966339369 3:178908219-178908241 GCTTAGGAGTGGAGGGAAGCTGG - Intergenic
967000605 3:185330559-185330581 GAGAAGGAGTGGAGGGCTGGGGG + Intronic
967228221 3:187313182-187313204 GAGGAGAAGAGGAGTGAAGCAGG - Intergenic
967237726 3:187403424-187403446 GATGTGAAGTGGAGGGCAGGAGG - Intergenic
967348083 3:188480948-188480970 GATTAGAAGAAGGGGGAAGGAGG - Intronic
967591062 3:191274128-191274150 AAGATGAAGTGGAGGGTAGGAGG - Intronic
967670279 3:192225577-192225599 GAGTAGAAGTGTTGGTAATGTGG - Intronic
967726732 3:192869291-192869313 GAGGAGGGGAGGAGGGAAGGAGG + Intronic
967873508 3:194251164-194251186 GACTTGAGGTGGAGGGAGGGAGG - Intergenic
968292671 3:197550740-197550762 GGGTGGAGGTGGAGGGAGGGAGG + Intronic
968299455 3:197602180-197602202 GAATAGAAATGGGGGAAAGGTGG - Intergenic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
968970620 4:3791682-3791704 GAGTGGAGGTGCAGGGATGGAGG - Intergenic
969076586 4:4583664-4583686 GAGTAAAAGGGGAAGAAAGGTGG - Intergenic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
969627672 4:8316071-8316093 GGGCTGAACTGGAGGGAAGGCGG - Intergenic
969663943 4:8546138-8546160 GTGAACAAGTGAAGGGAAGGGGG + Intergenic
970448349 4:16142524-16142546 GAGCAGAAGTGCAGAAAAGGGGG + Intergenic
971218081 4:24680543-24680565 GAAGAGAAGAAGAGGGAAGGAGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971448554 4:26778434-26778456 AAAGAGAAGGGGAGGGAAGGGGG + Intergenic
971514344 4:27467917-27467939 GAGGAGATGAGGAGGGGAGGAGG - Intergenic
971630333 4:28984791-28984813 GAGTAGAAGAGGAGGGAGAAAGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972412632 4:38808229-38808251 GAATAGAAAGGGAGGAAAGGTGG + Intronic
972789469 4:42357255-42357277 GAGGAGAGGGGGAGGGAGGGAGG + Intergenic
973335803 4:48955389-48955411 GAGGAGAAGGGAAGGGAAGGAGG - Intergenic
974473884 4:62355153-62355175 GAGAGGAAATGGAGGGAGGGAGG - Intergenic
974716167 4:65670538-65670560 GGGAAGAGGAGGAGGGAAGGAGG - Intergenic
974737820 4:65961567-65961589 AAGTAGAAGTGGAGGGACGATGG + Intergenic
974833356 4:67216363-67216385 GAAGAGAAGGGGAGGGGAGGGGG + Intergenic
975068941 4:70107969-70107991 GAGAAAAATTCGAGGGAAGGTGG - Intergenic
975257091 4:72250157-72250179 AAGTAGAAGAGGAGGAAAGAAGG - Intergenic
975599363 4:76083233-76083255 GAGTGGAAATTGAGGAAAGGTGG - Intronic
975913958 4:79300388-79300410 CAATAGAAGTGCAGGGTAGGGGG - Intronic
976212946 4:82690484-82690506 GAGTAGAAATGGAGTGGAAGGGG - Intronic
976703812 4:88000960-88000982 GAATACAAGAGGAGGGAGGGAGG + Intergenic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
978811544 4:112854866-112854888 GAGTAGAATGGGAGGGAGGGTGG + Intronic
980296775 4:130929315-130929337 GAGGAGAGGTGGAAGGAAGGAGG + Intergenic
980320508 4:131266937-131266959 GTTTAGCAGTAGAGGGAAGGTGG - Intergenic
980975584 4:139607122-139607144 GAATAGAAGTGGCAAGAAGGGGG + Intergenic
980975861 4:139609742-139609764 GAATAGAAGTGGCAAGAAGGGGG + Intergenic
982162203 4:152581516-152581538 GAGAAGGAGTGGAAGGAAAGTGG - Intergenic
982522030 4:156430004-156430026 GAGTATAGATGCAGGGAAGGGGG + Intergenic
982884939 4:160766474-160766496 GAAGAGAAGGGAAGGGAAGGGGG + Intergenic
983217954 4:165019654-165019676 GAGTAGAAAGGGGGGAAAGGTGG - Intergenic
983273659 4:165592084-165592106 GAGAAGGAATGGAGGGATGGAGG - Intergenic
983644323 4:169974273-169974295 GAGAAAAAGTGGAGGCAAGAGGG - Intergenic
983945991 4:173585958-173585980 GAGAAGATGCCGAGGGAAGGCGG - Intergenic
984537105 4:180989974-180989996 GAGCAGAATTGGGCGGAAGGAGG - Intergenic
984856798 4:184202419-184202441 GAGTGGAACAGGAGGGGAGGAGG + Intronic
984911476 4:184677027-184677049 GGGGAGAAGGGAAGGGAAGGGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985046570 4:185946998-185947020 GAGTAGAAATTGATGGGAGGAGG - Intronic
985069408 4:186153182-186153204 TGATAGAAATGGAGGGAAGGTGG + Intronic
985117438 4:186605555-186605577 GAGAAGAGGTGGAGGGAGGGGGG + Intronic
985247261 4:187991377-187991399 GAATAGAAGGGGGGGAAAGGTGG - Intergenic
985420828 4:189783770-189783792 GAGAAGAAAGGGAGAGAAGGAGG + Intergenic
985965805 5:3338211-3338233 AGGCAGAAGAGGAGGGAAGGCGG + Intergenic
986009625 5:3700589-3700611 GAGGAGGAGTGGAGGAAGGGGGG - Intergenic
986067111 5:4245420-4245442 AAGCAGAGGTGGAAGGAAGGAGG - Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986142416 5:5043428-5043450 GAGGGGAAGGGAAGGGAAGGAGG + Intergenic
986309433 5:6541244-6541266 AAATGGAAGTGGAGGGAAAGTGG + Intergenic
986725200 5:10590763-10590785 GAGCAGTAGTGAAGGGTAGGAGG - Intronic
987074066 5:14364442-14364464 GAGTAGAAATGGATGGGATGTGG + Intronic
987529372 5:19097628-19097650 GAGGAGAGGAGGAGAGAAGGGGG - Intergenic
987766704 5:22240949-22240971 GAGGAGAAGGGCAAGGAAGGAGG + Intronic
987938444 5:24500901-24500923 GAGAAGAAGTGGAGAGAGGAGGG + Intronic
987961071 5:24809766-24809788 GATTAGAAGAGCAGGGCAGGCGG - Intergenic
988609832 5:32713439-32713461 GGGTAGAATCTGAGGGAAGGCGG + Intronic
989066110 5:37463528-37463550 GAGTAGAAGTGGAAGGGAATGGG - Intronic
989196474 5:38721563-38721585 GAGTAGAAGGGAAAGTAAGGAGG + Intergenic
990047889 5:51457168-51457190 GAGGGGCAGTGGAGGGAGGGAGG - Intergenic
990110597 5:52318321-52318343 GGGTAGAAAAGAAGGGAAGGAGG - Intergenic
990388360 5:55291475-55291497 GTGCATAAGTGGAGGGATGGTGG - Intronic
991970323 5:72134821-72134843 GAGTAGAAAAGGAAGGCAGGCGG + Intronic
992193104 5:74313328-74313350 AACTGGAAGTGGAGGGCAGGGGG - Intergenic
992655775 5:78908271-78908293 GAGTGGAAGTCGGGGGAGGGGGG - Intronic
992659605 5:78945463-78945485 GAGTAAAGGCAGAGGGAAGGTGG - Intronic
993201260 5:84818197-84818219 GGAGAGAAGGGGAGGGAAGGGGG - Intergenic
993204609 5:84863402-84863424 GAGGGGAAGAGGAGGGAGGGAGG - Intergenic
993301902 5:86221589-86221611 GAGTACAAGTGCAGAGAAAGTGG + Intergenic
994419639 5:99516079-99516101 GAGTAGAAGTGGAAGGGAGTGGG - Intergenic
994487569 5:100399062-100399084 GAGTAGAAGTGGAAGGGAGTGGG + Intergenic
994736077 5:103558168-103558190 TAGTAGAAATGGAGGAAAGAGGG - Intronic
995455692 5:112349381-112349403 GAATAGAGGTGAAGGGAAGGAGG + Intronic
995462064 5:112413929-112413951 AAGGAGAAGAGGAGGAAAGGTGG + Intronic
995531510 5:113096033-113096055 AGCTAGAAGTGGAGGGAGGGTGG - Intronic
996485432 5:124028063-124028085 AAGTAGAAGTTGATGGAAGTGGG - Intergenic
996651913 5:125888473-125888495 GAGGAGAAGGGGAAAGAAGGAGG + Intergenic
996871861 5:128201212-128201234 GGGGTGAAGGGGAGGGAAGGAGG - Intergenic
996900634 5:128538437-128538459 GAGGGGAAGAGGAAGGAAGGGGG + Intronic
997703003 5:135917943-135917965 GAGGAGAGGAGGAGGGGAGGAGG + Intergenic
997852629 5:137346316-137346338 GAGGAGGGGTGCAGGGAAGGAGG - Intronic
998060700 5:139116552-139116574 AAGGGGAAGTGGAGGTAAGGAGG - Intronic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
998757930 5:145401001-145401023 GAGTCTAAGTGGTGGGAGGGAGG - Intergenic
998914096 5:146995589-146995611 GAGTTGAACTTGTGGGAAGGTGG - Intronic
999016004 5:148106159-148106181 GAATAGGAGTGGAGAGAAGGAGG - Intronic
999449703 5:151668791-151668813 GAGTAGAAAAGGAGGGTTGGGGG - Intronic
999491258 5:152053649-152053671 GAGTAAAGGTGGAGGAATGGGGG + Intergenic
999802814 5:155053556-155053578 GAGGAGAAGAGGATGGAGGGCGG + Intergenic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000279535 5:159770250-159770272 AATGAGAAGAGGAGGGAAGGAGG + Intergenic
1000407611 5:160905258-160905280 TAGTAGAATTGTAGGTAAGGAGG + Intergenic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001428135 5:171638357-171638379 GAGGACAAGAGGAGAGAAGGGGG - Intergenic
1001655564 5:173346191-173346213 AAGCAGAAGGGGAGTGAAGGGGG + Intergenic
1001718862 5:173840180-173840202 GAGGAGAAGGAGAGGGCAGGAGG + Intergenic
1002606379 5:180385292-180385314 GAGACGGAGTGGAGAGAAGGCGG + Intergenic
1002940100 6:1708356-1708378 GATGAGGAGTGGAGGGAAGGCGG + Intronic
1003189019 6:3856734-3856756 GAGAAGAGGAGGAGGGCAGGAGG - Intergenic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003268250 6:4585454-4585476 GAGAAGAAGAGGGGAGAAGGAGG - Intergenic
1003365078 6:5466187-5466209 GAGTAGAAATTAAGGGAATGGGG - Intronic
1003394632 6:5742648-5742670 GAGTGGAAGTGGCGGGGTGGTGG - Intronic
1003491740 6:6628268-6628290 GGGAGGAAGGGGAGGGAAGGAGG - Intronic
1003530850 6:6936330-6936352 GAGAATAGGTGGAGAGAAGGAGG + Intergenic
1004101375 6:12615603-12615625 TAGCAGAAGTGGAAGGAAAGTGG - Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004374459 6:15079559-15079581 GTATAGAAGTGGAGGGCAGGGGG + Intergenic
1004579493 6:16935162-16935184 GAGTAGAGGGGAAGGGAATGAGG - Intergenic
1005040666 6:21596655-21596677 GAGGAGATGTTGAGGGGAGGAGG + Exonic
1005319831 6:24642132-24642154 GAGGGGAAGGGGAGGGAAGGAGG + Intronic
1005730752 6:28694490-28694512 CAGAAGAAGTTGAGGGAAAGGGG + Intergenic
1006014661 6:31070709-31070731 GAGTGGGAGTGTAGGAAAGGAGG + Intergenic
1006043404 6:31272453-31272475 GAGGAGAAGTGAAGGGGAAGGGG - Intronic
1006394490 6:33778207-33778229 GCACAGAAGGGGAGGGAAGGCGG + Intronic
1006806774 6:36793964-36793986 GGAAAGAAGGGGAGGGAAGGAGG + Intronic
1007359823 6:41346869-41346891 GAGAAAAAGAGGAGGGAAGAAGG + Intronic
1007386596 6:41524281-41524303 GAGGAGGAGAGGAGGGGAGGGGG + Intergenic
1007388600 6:41536535-41536557 TAGGAGAAGTGGAGGTAAAGAGG + Intergenic
1007403293 6:41616742-41616764 GAGTAGAAAGGGGGGAAAGGTGG + Intergenic
1007518406 6:42431584-42431606 AAGTAGAACTGGAGGAAGGGAGG + Intronic
1007562164 6:42818974-42818996 GATTTGTCGTGGAGGGAAGGGGG - Intronic
1007692318 6:43710555-43710577 GAGAAGAAATGGAGGGAGGGAGG + Intergenic
1007821722 6:44565278-44565300 GAGTAGACTTGGAGAGAAGAGGG - Intergenic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1009863400 6:69365244-69365266 GAGTAGAGGTTGAGGAAAAGAGG + Intronic
1010331635 6:74629971-74629993 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1010400369 6:75441425-75441447 GAATAGAAGGGGGGGAAAGGTGG - Intronic
1011626618 6:89288322-89288344 GAGTGGAAAAGGAGGAAAGGAGG + Intronic
1011735009 6:90301883-90301905 GAGTCAGAGAGGAGGGAAGGTGG + Intergenic
1011742611 6:90377637-90377659 GAGGAGGAGGGGAGGGAGGGAGG - Intergenic
1012330010 6:97973617-97973639 AAGTAGAAGTTGAGGGAGGTTGG + Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1013309574 6:108880721-108880743 GAGAAGAGGGAGAGGGAAGGGGG - Intronic
1013314556 6:108929132-108929154 GATCAGATCTGGAGGGAAGGAGG - Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013661864 6:112306233-112306255 GAGAAGAGATGGAGGGAGGGAGG - Intergenic
1014328715 6:120032312-120032334 GAATAGAAGTGGAGGATAGATGG - Intergenic
1014897005 6:126913668-126913690 AAGTAAAAGTGAAGGGAGGGGGG + Intergenic
1015199482 6:130563248-130563270 GAGTAGAAGTGCGGGGCAGTGGG + Intergenic
1015591454 6:134826686-134826708 GAAAAGAAGGAGAGGGAAGGGGG + Intergenic
1015805273 6:137102210-137102232 CATTAGATGGGGAGGGAAGGAGG - Intergenic
1015915162 6:138208964-138208986 GAGTAGAAGTTGTGGGCAGGTGG + Intronic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016590563 6:145739124-145739146 AAGGAGAAGTGAAGGGGAGGAGG - Intergenic
1016764330 6:147775056-147775078 GAGTAAAATTGGAGGGGATGGGG + Intergenic
1017096867 6:150812387-150812409 GAGTAGCAGAGGAGGCAGGGAGG + Intronic
1017286334 6:152680903-152680925 GAAAAGAAATGGAAGGAAGGAGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017625011 6:156339142-156339164 GGGAAGTAGAGGAGGGAAGGGGG + Intergenic
1017743865 6:157429601-157429623 GAGAAGGAGGGGAAGGAAGGAGG + Intronic
1018517820 6:164606212-164606234 GATTAGAAGATGAAGGAAGGGGG + Intergenic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1018998417 6:168727461-168727483 GAGCAGAGGTGGCTGGAAGGAGG + Intergenic
1019059185 6:169243100-169243122 AGGTAGGAGTGGTGGGAAGGTGG - Intronic
1019115767 6:169760846-169760868 GAGTAGAAGTGAAGAGAACCTGG + Intronic
1019223568 6:170493426-170493448 GAGGAGAGGAGGAGGGCAGGAGG + Intergenic
1019313449 7:373927-373949 GAGGAGAAGGGAAGGGAAGGAGG + Intergenic
1019768833 7:2870776-2870798 GAGGAGAAGAGGAAGGAAGGAGG + Intergenic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020441098 7:8217365-8217387 GTGTAGAGGTGGAGGGAAGGAGG - Intronic
1020594714 7:10191389-10191411 GCGTAGAAGTGAGGAGAAGGAGG - Intergenic
1020632514 7:10656639-10656661 GAATGGAAGTGCAGAGAAGGAGG + Intergenic
1020731134 7:11882430-11882452 AAGGAGAAGGGGAGGGATGGAGG - Intergenic
1022056549 7:26741420-26741442 GGGTAGAGGTGGGGGGAAGGGGG + Intronic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1022636170 7:32137801-32137823 AAAGAGAATTGGAGGGAAGGAGG - Intronic
1022992511 7:35722312-35722334 GAGGAGAAGTGGAGGAAAGGAGG + Intergenic
1023055169 7:36285047-36285069 GAGCAGGAGAGGGGGGAAGGAGG + Intronic
1023133169 7:37024072-37024094 AAGGAGAAAAGGAGGGAAGGAGG - Intronic
1023575497 7:41622064-41622086 GAGAAGGAATGGAGGGAGGGAGG + Intergenic
1023638688 7:42237547-42237569 GAGGAGGAGAGAAGGGAAGGAGG - Intronic
1023837694 7:44077978-44078000 GAGCAGAAACAGAGGGAAGGTGG + Intronic
1024112738 7:46163295-46163317 GAGAGGAAGTGGATGGAATGGGG - Intergenic
1024270160 7:47635850-47635872 AAGGAGAAGAGGAGTGAAGGAGG + Intergenic
1024280149 7:47711818-47711840 GTGTAGAAGTGAGGAGAAGGAGG + Intronic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025139460 7:56450072-56450094 GAAGAGAAGGGGAGGGAAGGGGG - Intergenic
1025837899 7:65112896-65112918 GAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1025872640 7:65449204-65449226 GAGGAGAAGAGAAGGGAAGGGGG - Intergenic
1025879370 7:65520187-65520209 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025885169 7:65583088-65583110 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025957423 7:66193598-66193620 GAGGGGAAGGGAAGGGAAGGGGG - Intergenic
1026058308 7:67004465-67004487 GAGTAGAAGTGAAAGGGAGCTGG - Intronic
1026162662 7:67883309-67883331 AAGGAGAAGGGAAGGGAAGGAGG - Intergenic
1026719782 7:72820561-72820583 GAGTAGAAGTGAAAGGGAGCTGG + Intronic
1026917461 7:74129531-74129553 AAGGAGAAGGGGAAGGAAGGAGG + Intergenic
1026927397 7:74204048-74204070 GGGAAGGAGGGGAGGGAAGGAGG + Intronic
1026927423 7:74204121-74204143 GGGAAGGAGAGGAGGGAAGGAGG + Intronic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1027997748 7:85447560-85447582 GAGTAGAATTGGTTGGCAGGGGG - Intergenic
1028227169 7:88265925-88265947 GAATAGAAATGGGGGAAAGGTGG - Intergenic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1029392147 7:100282526-100282548 GAGGAGAAGGGGAGGGGAAGGGG - Intergenic
1029444568 7:100604946-100604968 GAGAAGAAGGGGAGGTAAGATGG - Intronic
1029481726 7:100817421-100817443 GAGTGGAGGGCGAGGGAAGGAGG - Intronic
1029646604 7:101860785-101860807 GAGAAGAAGAGAGGGGAAGGAGG - Intronic
1029813800 7:103074572-103074594 GGGGAGGAGTGGAGGGAAGGCGG - Intronic
1029941404 7:104484365-104484387 GCTGAGAAGTGAAGGGAAGGAGG - Intronic
1030744529 7:113149024-113149046 GAGTTGAAGATGAGGGAAAGAGG + Intergenic
1030796809 7:113798793-113798815 AAGGAGAACAGGAGGGAAGGAGG + Intergenic
1031326437 7:120404805-120404827 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1031937199 7:127747960-127747982 GAGTAAAAGGGGTGGGAAGGGGG - Intronic
1032364104 7:131283326-131283348 GAGGGGAAGGGAAGGGAAGGAGG - Intronic
1032428118 7:131838111-131838133 AAGGAGAAGTGGAGGGAGTGGGG + Intergenic
1032472596 7:132189389-132189411 GAATGGAGGTAGAGGGAAGGGGG + Intronic
1032889646 7:136180968-136180990 GACTAGAAGTCCAGGTAAGGGGG + Intergenic
1032948715 7:136882437-136882459 GAGAAGAAGGAGGGGGAAGGAGG - Intronic
1033041994 7:137927376-137927398 GAGAAGGAAGGGAGGGAAGGAGG + Intronic
1033742284 7:144284479-144284501 GAGCAGAAATGGGAGGAAGGTGG + Intergenic
1033751618 7:144365135-144365157 GAGCAGAAATGGGAGGAAGGTGG - Exonic
1033832638 7:145271804-145271826 GAGGAGAAGAGGAGGGGAGGAGG + Intergenic
1034442326 7:151092230-151092252 GCCCAGAAGTGGAGGGAACGAGG + Intronic
1035416645 7:158694872-158694894 GAGGAGAATTGAAGGGGAGGAGG - Intronic
1035748486 8:1978656-1978678 ACGTAGAAGGGGAGGGAACGGGG + Intronic
1035776259 8:2191168-2191190 GAGGAAAGGAGGAGGGAAGGAGG - Intergenic
1036506863 8:9364819-9364841 GAATAGAAAGGGAGGAAAGGTGG - Intergenic
1036611327 8:10352434-10352456 GAGTTGAAGAGGAGGCAGGGAGG + Intronic
1036614747 8:10379568-10379590 GAGGGGAAGAGGGGGGAAGGCGG - Intronic
1036740918 8:11361033-11361055 GAGAACAAGTGGAGGAAATGGGG - Intergenic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1037187476 8:16081513-16081535 GAGTTGGAGTGAAGGGAAGGGGG - Intergenic
1037339748 8:17831865-17831887 GGGCAGCGGTGGAGGGAAGGTGG - Intergenic
1037467276 8:19172672-19172694 GAGGGGAAGGGGAGGGAACGGGG + Intergenic
1037691206 8:21183178-21183200 GAGGAGAAGTGTAGGGGAGGAGG - Intergenic
1037799654 8:22025408-22025430 GAGGAGAAAGGGAGGGAAGTGGG - Intronic
1038390075 8:27189363-27189385 GAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1038542670 8:28402365-28402387 GAGAAGGAGGGGAGGGACGGAGG + Intronic
1038960264 8:32510588-32510610 GAGTAGAAGGTGAGGAAATGGGG + Intronic
1039364592 8:36916480-36916502 GAGAAGAAAAGGAGGGAAAGAGG + Intronic
1039476817 8:37843123-37843145 GAGTAGAGGGAGAGGGCAGGTGG + Exonic
1039728667 8:40251391-40251413 GAGTAGAAGTGTAGATCAGGTGG + Intergenic
1039903878 8:41772430-41772452 GAGAAGAAATGGAGGGGAGGAGG - Intronic
1039965216 8:42279053-42279075 GAGTAGAGGTGGAGGGGAGCAGG + Intronic
1040491711 8:47929349-47929371 CAGAACAAGAGGAGGGAAGGTGG + Intronic
1041184533 8:55285489-55285511 GAGGAGAGAAGGAGGGAAGGAGG + Intronic
1041185907 8:55300446-55300468 GAGCTGAGGTGGAGTGAAGGTGG + Intronic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041765033 8:61410557-61410579 GAATAGAAGTAGAGCGAAGAAGG - Intronic
1041807485 8:61868388-61868410 GAGTAGAAGTGCTGGGGAGAAGG - Intergenic
1041953610 8:63533127-63533149 GAGGAGAAAAGGAAGGAAGGTGG - Intergenic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042300417 8:67273825-67273847 GACTAGAACAGGAGGGGAGGTGG - Intronic
1042503155 8:69531449-69531471 GAGTTGAGGTGGAGGAGAGGTGG - Intronic
1042905258 8:73766048-73766070 GAGGAAAAGGGGAGGGAGGGAGG + Intronic
1042905505 8:73768044-73768066 GAGTTGAAGTGGTGGAGAGGAGG + Intronic
1043045062 8:75312781-75312803 GAGAAGGAATGGAAGGAAGGAGG + Intergenic
1043052970 8:75405134-75405156 GAGTAGGGGTGGGGGGATGGGGG + Intergenic
1043908439 8:85833332-85833354 GAAAAGAAGGGAAGGGAAGGGGG - Intergenic
1044164364 8:88962974-88962996 GAGAGGAAGTGGAGTGAAGGGGG + Intergenic
1044430372 8:92101637-92101659 GGGGAGAGGGGGAGGGAAGGCGG + Intronic
1044740473 8:95321378-95321400 GAGCAGAAATGGAGAAAAGGAGG - Intergenic
1045487103 8:102640346-102640368 AAGGAGAAATGGAGGGAGGGAGG + Intergenic
1046026844 8:108734578-108734600 GAGTTGAAGTAGTGGGGAGGAGG - Intronic
1046082147 8:109382831-109382853 GAGTAGAAGTAGAGATAAAGGGG - Intronic
1046158678 8:110330445-110330467 ATGTAGAAGTGGTGAGAAGGTGG + Intergenic
1046319190 8:112548225-112548247 GAGAAGAAATGGAGGAAAGCCGG - Intronic
1046555513 8:115768549-115768571 GGGAAGAAGTGAAGGGAGGGAGG - Intronic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047520610 8:125592846-125592868 GAGATGAAGTGCAGGGAAGGTGG - Intergenic
1047907001 8:129483131-129483153 AAGGAGGAGAGGAGGGAAGGGGG + Intergenic
1048025866 8:130586148-130586170 GAGTAGGAGGTGAGGAAAGGAGG + Intergenic
1048260099 8:132937988-132938010 GAGTGGAGGAGGAGGGGAGGAGG + Intronic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049190952 8:141287105-141287127 GTGTAGAAGTGGAAGGAACCGGG - Intronic
1050634696 9:7599054-7599076 GAGTAGAAGTGGTGAGAACAGGG - Intergenic
1050744185 9:8857912-8857934 GGGTAGGGGTGGAGGGAGGGCGG - Intronic
1051369768 9:16348499-16348521 GAGTAGAAGAGAATGGAAGAGGG - Intergenic
1051524158 9:18024019-18024041 AAGAAGAAAGGGAGGGAAGGGGG - Intergenic
1051661740 9:19433599-19433621 GAATAGAAAGGGAGGAAAGGTGG - Intronic
1051700907 9:19822932-19822954 AAGGAGAAGAGGAAGGAAGGAGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052475915 9:28958730-28958752 GAGAAGAAGGGAAGGGAGGGGGG + Intergenic
1052545117 9:29866400-29866422 GAGTAGTTGTGGAGGTAAGTAGG + Intergenic
1053273733 9:36767686-36767708 GAGAAGGAGTGGAGGGAGGGGGG + Intergenic
1053369462 9:37548609-37548631 GGGTAGAGAGGGAGGGAAGGAGG - Intronic
1053484750 9:38443265-38443287 GAGGAGAAGTGGGAGGGAGGAGG + Intergenic
1053728296 9:41026445-41026467 AAGGAGAAGCGAAGGGAAGGAGG + Intergenic
1053728304 9:41026471-41026493 GAATAGAGATGGAGGGAAAGGGG + Intergenic
1053763679 9:41366989-41367011 GAGGAGAAGGGGAGGGGAAGGGG - Intergenic
1054700211 9:68405638-68405660 AAGGAGAAGCGAAGGGAAGGAGG - Intronic
1054850646 9:69843452-69843474 AAGTAGGAGGGGAGGGGAGGGGG - Intronic
1055145065 9:72923468-72923490 AAGGAGAAGTGGCGGGCAGGAGG - Intronic
1055518803 9:77060598-77060620 GAATAGAAATGGGGGAAAGGTGG - Intergenic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1055804335 9:80076155-80076177 GAATAGCAGAGGAGGGGAGGTGG - Intergenic
1056152910 9:83805018-83805040 GAATAGAAGGGGGGGAAAGGTGG + Intronic
1056649432 9:88445226-88445248 GAGTAGACAAGGATGGAAGGAGG - Intronic
1056706802 9:88959146-88959168 GAGTAGAAAGGGGGGAAAGGTGG - Intergenic
1056726399 9:89122805-89122827 GAGTAGGAATTGTGGGAAGGAGG + Intronic
1056904283 9:90631945-90631967 GAGAACAAGAGGAGGTAAGGAGG - Intronic
1057014048 9:91634973-91634995 AAGTAGCAGAGGAGGGGAGGAGG + Intronic
1057256987 9:93557920-93557942 GGGTAGAAGGGCAGGGCAGGTGG - Exonic
1057292777 9:93818090-93818112 GGGAAGGAGTGAAGGGAAGGAGG + Intergenic
1057489355 9:95509243-95509265 GAGGAGGAGGGGAGGGGAGGGGG + Intronic
1057556946 9:96095534-96095556 GAGGAGGAGGGGAAGGAAGGAGG - Intergenic
1057624984 9:96668912-96668934 GAGTACATGTGGATGGGAGGAGG - Intergenic
1057716661 9:97501541-97501563 GAGTGGAGGGGGGGGGAAGGAGG + Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058116502 9:101090943-101090965 GAAAAGAAAGGGAGGGAAGGAGG - Intronic
1058437040 9:104972357-104972379 GAGGAGAAAGGGATGGAAGGAGG + Intergenic
1059070583 9:111131821-111131843 CAGCAGAAGTGGAGAGGAGGAGG + Intergenic
1059266115 9:113032616-113032638 GAGCAGAAGATGAAGGAAGGCGG + Intergenic
1059373335 9:113861686-113861708 GAGAAGGAGGGGAGGGATGGAGG - Intergenic
1059500669 9:114750822-114750844 GAGTCCTACTGGAGGGAAGGAGG - Intergenic
1059526086 9:114992286-114992308 GAGGAGAAGAGGAGGAAGGGGGG - Intergenic
1059750705 9:117244709-117244731 AAGGAGAAAGGGAGGGAAGGAGG + Intronic
1059994615 9:119896770-119896792 AAGGAGAAAAGGAGGGAAGGAGG + Intergenic
1060124132 9:121025213-121025235 CAGTAGAAGTGGAGGTAATAGGG + Intronic
1060129880 9:121085985-121086007 AAGGAGAACTGGAAGGAAGGTGG + Intronic
1060418837 9:123452998-123453020 GAGCAAAAGTGGGAGGAAGGAGG + Intronic
1060732336 9:126046681-126046703 AAGAAGAAGAGGAGGGGAGGGGG - Intergenic
1060935032 9:127509787-127509809 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060935039 9:127509808-127509830 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060967699 9:127720939-127720961 AAGAAGAAGAGGAGGAAAGGAGG - Intronic
1061187180 9:129061349-129061371 GAGCAGGTGTGGAGGGAGGGAGG + Intronic
1061414902 9:130442337-130442359 AAGTGGAAGTGGAGAGAAAGGGG + Intergenic
1061666390 9:132162911-132162933 GAGCAGAGGCGGCGGGAAGGCGG + Intronic
1061914956 9:133745061-133745083 GAATAGAAGCGGGGGAAAGGTGG + Intergenic
1061935430 9:133854965-133854987 GAGGAGATGGGGACGGAAGGTGG - Intronic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062449180 9:136608364-136608386 GAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1185661922 X:1735183-1735205 GAGGAGGAGGGAAGGGAAGGAGG - Intergenic
1185665206 X:1760098-1760120 AAGGAGAAGGGGAAGGAAGGAGG - Intergenic
1186156587 X:6732593-6732615 AAGGAGAAGGGAAGGGAAGGAGG + Intergenic
1186410623 X:9342332-9342354 AAGCAGAGGGGGAGGGAAGGAGG - Intergenic
1186490797 X:9970530-9970552 AAGGAGAAAAGGAGGGAAGGAGG - Intergenic
1187048492 X:15673688-15673710 AAGCAGAAATGGATGGAAGGTGG + Intergenic
1187830249 X:23374013-23374035 GAGTAGAAGAAGTGGGAAGGGGG + Intronic
1188304096 X:28541265-28541287 GAGTGGTGGTGGAGGGGAGGTGG + Intergenic
1188803449 X:34559514-34559536 GTGGAGAAGTGGGGGGAAGTGGG - Intergenic
1189901229 X:45708483-45708505 GACTGGAACTGGAGGGGAGGGGG + Intergenic
1190184617 X:48222754-48222776 GAATAGAAAGGGGGGGAAGGTGG + Intronic
1191754529 X:64580150-64580172 TAGGAGAAGGGGAGGGAAGTGGG + Intergenic
1191904893 X:66077228-66077250 GGGAAGGAGGGGAGGGAAGGAGG - Intergenic
1191904904 X:66077254-66077276 GAGAAGGAGAGAAGGGAAGGAGG - Intergenic
1192179166 X:68905240-68905262 GAATAGAGGTAGAAGGAAGGTGG + Intergenic
1192179326 X:68906515-68906537 GAATAGAGGTAGAAGGAAGGTGG + Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1193132151 X:77931458-77931480 GAATAGAAAGGGAGGAAAGGTGG - Intronic
1193164483 X:78265289-78265311 GAGTAGAAAGGGGGGAAAGGTGG - Intergenic
1193195174 X:78623061-78623083 GAGTAGAAGTGGGAGTAGGGAGG + Intergenic
1195077149 X:101338096-101338118 AAGCAGAAATGGAGAGAAGGAGG - Intergenic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1196599226 X:117583034-117583056 GAGCAGAAGGAGAGGGGAGGAGG - Intergenic
1196996039 X:121385005-121385027 GGGTCGAAGTGGAGGGGAGGTGG + Intergenic
1197047072 X:122010371-122010393 GAGTGGAAGTGGAGGAATGTAGG + Intergenic
1197143861 X:123148776-123148798 GAATAGAAGTGGTTGGAAGAGGG - Intergenic
1197651597 X:129071523-129071545 GGGGAGAAATGGAGGGAGGGAGG + Intergenic
1198204350 X:134452158-134452180 GAGAAGAGGGGGAGGGAGGGAGG + Intergenic
1198210202 X:134509111-134509133 GAGCAGAAGGGCAGTGAAGGAGG - Intronic
1198241975 X:134796373-134796395 TAGGAGAGGAGGAGGGAAGGAGG + Intronic
1198573605 X:137985886-137985908 GAGGATAAGTGGAGGTAGGGAGG + Intergenic
1198637304 X:138713652-138713674 GAGGAGAAGTGGAGGAAAAACGG - Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199073659 X:143506866-143506888 GAGAAGAAGTGGGGAGAAGTAGG + Intergenic
1199212594 X:145231440-145231462 GAGTAGAAATGAAGGTCAGGTGG - Intergenic
1199282100 X:146013980-146014002 GAATACAAGAGGAGGGAGGGAGG + Intergenic
1199532132 X:148861755-148861777 GAGTAAAGGTGGAGTGAAGATGG - Intronic
1199644226 X:149890142-149890164 GAGTAGCAGTGGTGGGAGTGTGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199785131 X:151098530-151098552 GAACAGAAGCGGAGAGAAGGAGG + Intergenic
1199810708 X:151345719-151345741 GATTAGATGAGCAGGGAAGGCGG + Intergenic
1199846729 X:151697060-151697082 AAGGAGAAGGGAAGGGAAGGAGG - Intronic
1199924852 X:152451403-152451425 GGGGAGAAGGGGAGGGGAGGAGG - Intergenic
1200811638 Y:7491496-7491518 GAGAAGAAGAGAAGAGAAGGAGG - Intergenic
1201256350 Y:12112007-12112029 GAGAAGAGAGGGAGGGAAGGGGG - Intergenic
1201365756 Y:13204744-13204766 GAGGAGAACTGGAAGGAAAGGGG - Intergenic
1201549995 Y:15209429-15209451 GAAGAGGAGGGGAGGGAAGGAGG + Intergenic
1201671996 Y:16533360-16533382 GAGTTGAAAGGGTGGGAAGGTGG - Intergenic
1202384851 Y:24315867-24315889 GAGGAGTAGGGGAGGGGAGGAGG + Intergenic