ID: 1149988546

View in Genome Browser
Species Human (GRCh38)
Location 17:61367056-61367078
Sequence ACACACTCCCTGCCAATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149988546_1149988553 25 Left 1149988546 17:61367056-61367078 CCTGTCATTGGCAGGGAGTGTGT 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1149988553 17:61367104-61367126 CTGGCGAAGATAGTTTCTGACGG 0: 1
1: 0
2: 0
3: 10
4: 110
1149988546_1149988547 6 Left 1149988546 17:61367056-61367078 CCTGTCATTGGCAGGGAGTGTGT 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1149988547 17:61367085-61367107 ACTGCCCAGCCCTCACTGCCTGG 0: 1
1: 0
2: 2
3: 51
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149988546 Original CRISPR ACACACTCCCTGCCAATGAC AGG (reversed) Intronic
900622788 1:3595060-3595082 TCAGACACCCTGCCAATGGCAGG + Intronic
901758643 1:11456517-11456539 ACAAGCTCCCTGCAAAAGACTGG + Intergenic
902932460 1:19741055-19741077 GCCCACCCCCTGCCAATGAGTGG + Intronic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
907554870 1:55334943-55334965 ACAAGCACCCAGCCAATGACAGG - Intergenic
913516030 1:119606425-119606447 ACAAACTGCCTGACAATGAGAGG - Intergenic
916465994 1:165075291-165075313 ACCCTCTCCCTGCCAAAGCCTGG - Intergenic
919649361 1:200130783-200130805 ACACACACACTGCCACTGGCTGG + Intronic
919853604 1:201690678-201690700 ACACACACACTGCCACGGACAGG - Intronic
919853617 1:201690753-201690775 ACACACACACTGCCACGGACAGG - Intronic
920339535 1:205267336-205267358 AAACAGTCCCTGCCAATTACAGG - Intronic
921747865 1:218758191-218758213 CCACACTCTATGCCAATCACTGG + Intergenic
1063245760 10:4216641-4216663 ACCCCCTCCCTGCCAAAGAAAGG + Intergenic
1066564904 10:36711236-36711258 ACACAATTCCTGCAAATCACAGG + Intergenic
1067740570 10:48892807-48892829 ACAGACTCCTTGACAGTGACTGG + Intronic
1069776934 10:70932836-70932858 ATACCCTCCCTGCCAATGCCTGG + Intergenic
1070873545 10:79780141-79780163 ACCCACTCCCTTCCTGTGACGGG + Intergenic
1071490908 10:86135681-86135703 ACCCACTCACTGCCAAGGCCAGG + Intronic
1071640477 10:87302291-87302313 ACCCACTCCCTTCCTGTGACGGG + Intergenic
1071654759 10:87435654-87435676 ACCCACTCCCTTCCTGTGACGGG - Intergenic
1072463119 10:95638467-95638489 ACACACTCCCTGCAAATATTAGG - Intronic
1072547103 10:96448211-96448233 ACACACTCCCTGCAGCTGCCGGG + Intronic
1073305959 10:102503862-102503884 ACACCTTCCCTGCCTGTGACTGG + Intergenic
1074164299 10:110861150-110861172 ACACACACCTAGCAAATGACAGG + Intergenic
1074365717 10:112856011-112856033 ACACACTCCCTTTCAATCTCAGG + Intergenic
1076366987 10:129927549-129927571 AAACACACCCTGGCAACGACGGG + Intronic
1077139662 11:1018563-1018585 ACACACTCCCCGCCTACGGCGGG - Exonic
1079612228 11:22447413-22447435 ACAAACTCCCTTCTAATGATTGG - Intergenic
1080651306 11:34224735-34224757 ACATAGTCCCTGGCAAAGACTGG + Intronic
1082805403 11:57446231-57446253 TCACACTCCTTGCCCAAGACTGG + Intergenic
1083797357 11:65024851-65024873 ACCCACTGCCTGGCATTGACTGG + Intronic
1085823351 11:79816983-79817005 ACATGCTCCCAGCCAATGTCTGG + Intergenic
1089157932 11:116416293-116416315 ACCCACTCCAATCCAATGACTGG + Intergenic
1095298095 12:40550016-40550038 ACACACTCCCTGCCATACCCTGG + Intronic
1097378725 12:58868696-58868718 AGACAATCACTGCCAATAACAGG + Intergenic
1102432136 12:112891763-112891785 CCATGCTCCCAGCCAATGACTGG - Intronic
1102575585 12:113854242-113854264 ACACCATCCCTGCCAAAGACGGG + Intronic
1103901487 12:124305882-124305904 ACTCACTCCGTGTCAATGCCAGG + Intronic
1105599966 13:21877983-21878005 ACACACTCCCTGCACATGACAGG - Intergenic
1110693557 13:78460158-78460180 TCACATCCTCTGCCAATGACTGG - Intergenic
1118571806 14:67201598-67201620 CCACACCCCTTGCCAGTGACTGG - Intronic
1123123743 14:105930102-105930124 ACACCCTCCCTGCACATGATTGG + Intronic
1125405133 15:39344866-39344888 GCACACTTCCTGTAAATGACTGG - Intergenic
1126612624 15:50544899-50544921 ACACATTCCCTACCAAGGACAGG + Intronic
1127390189 15:58499097-58499119 AGACAGTGCCTGCCAGTGACAGG + Intronic
1128544195 15:68556281-68556303 ACTCACTCCCTGCCACTGGCCGG - Intergenic
1130984157 15:88833887-88833909 ACACACAACCTCCCAATGAAGGG + Intronic
1131073810 15:89482413-89482435 AATCACTCCCTGCCAAGGAGGGG + Intronic
1131715599 15:95107387-95107409 AAACACTTCTTGCTAATGACAGG - Intergenic
1131742518 15:95409755-95409777 ACACAATCCATGCAAATCACTGG + Intergenic
1137053751 16:35733879-35733901 AGACACTCCTTGCCAACCACAGG - Intergenic
1138585805 16:57969905-57969927 ACAGACTCTCTGCCAAAGCCCGG - Intronic
1138905101 16:61322464-61322486 ACACACCCACTGCCAATGTTGGG - Intergenic
1141317401 16:82975353-82975375 CCACACTGCCTGCCACTGTCTGG - Intronic
1142304329 16:89277186-89277208 ACAGAATCCCTGCCACCGACGGG - Intronic
1142656566 17:1398760-1398782 ATAAACTTCCTGACAATGACTGG + Intronic
1144765863 17:17732105-17732127 AGACCCTCCTTGCCAATGAAAGG + Intronic
1147541145 17:41360983-41361005 ACAGAGTCCCTGACCATGACAGG - Intergenic
1148650974 17:49249725-49249747 AGAAACTCCCTGCCACTGCCTGG - Intergenic
1149248253 17:54737365-54737387 ACACCCTTTCTGCCAAAGACAGG + Intergenic
1149988546 17:61367056-61367078 ACACACTCCCTGCCAATGACAGG - Intronic
1151376775 17:73694629-73694651 ACCCACTCCCTCCCCAGGACAGG - Intergenic
1158333793 18:56392439-56392461 ACACATTCCCTGAAAATGCCAGG + Intergenic
1161273603 19:3403861-3403883 GGACACTCTCTGCCAATGTCGGG - Intronic
1164372481 19:27654456-27654478 AAAGACTCCCTGCCAACCACAGG - Intergenic
1164372488 19:27654491-27654513 AAAGACTCCCTGCCAACCACAGG - Intergenic
1165231135 19:34387701-34387723 ACAGACTCACTGCTAATGTCAGG - Intronic
1165638356 19:37363029-37363051 TCACACTCCCTGCAAATGTAAGG - Exonic
926121891 2:10245766-10245788 CCCCACTCCCTGCCAAGGCCAGG - Intergenic
926148394 2:10411057-10411079 ACACACTCCCAGTCACTCACTGG - Intronic
926314238 2:11697637-11697659 CCACTCACCCTGCCAATGAATGG - Intronic
927109977 2:19857748-19857770 GCACACTCCATGCCTTTGACGGG + Intergenic
928159173 2:28906236-28906258 TCACATCCTCTGCCAATGACTGG + Intronic
929591938 2:43153312-43153334 TCACACTCCCTGACACTCACAGG + Intergenic
932629277 2:73324399-73324421 ACAGACGTCCTGCCAATGCCCGG + Intergenic
932691160 2:73914884-73914906 CCACAGTCCCTGCCAATCTCAGG + Intronic
933974163 2:87494398-87494420 ACCCTATCCCTGCCAATGCCTGG - Intergenic
934551678 2:95266806-95266828 AGACGCTCCCTGCCAAGGTCTGG - Intergenic
935335547 2:102012464-102012486 ACACACACCCAGCCTAGGACTGG - Intronic
935447683 2:103173958-103173980 TCACACTCACTGCTAATCACAGG - Intergenic
936263245 2:110979976-110979998 ACTCACCCCATGCCAAAGACGGG - Intronic
941155342 2:161971124-161971146 ACAGACTACCTGCCATTGAATGG + Intronic
942628517 2:177929954-177929976 ATACACTCCCTGCCAAGTAACGG + Intronic
944150314 2:196551294-196551316 ACACACTTACAGCCAAGGACAGG + Intronic
946212817 2:218161192-218161214 ACACTCTCCCTGGCTCTGACTGG + Intergenic
946407437 2:219499056-219499078 CCACAATCCCTGGCAATGAGAGG + Exonic
948662634 2:239516494-239516516 CCACACTCCCTGCCAGAGTCGGG - Intergenic
1170731859 20:18982963-18982985 TCCCACTCCCTGCAAATGATGGG - Intergenic
1171981364 20:31631642-31631664 ACACCCACCTTGCCCATGACAGG - Intergenic
1172649517 20:36492987-36493009 CCAGACTCCCTGCCAGTGGCTGG + Intronic
1174262279 20:49305248-49305270 CTACTCTCCTTGCCAATGACTGG - Intergenic
1174719437 20:52796265-52796287 ACATACTCCCTGCTAATGTTAGG - Intergenic
1175691056 20:61066322-61066344 ACACACACCCAGCCAATTCCAGG + Intergenic
1175691330 20:61067895-61067917 ACACACACCCGGCCAATTCCAGG - Intergenic
1178250459 21:30998888-30998910 CCTCACTCCTTGCCAATGTCAGG - Intergenic
1182708559 22:32305945-32305967 GCACACTCAATGCCAATGGCAGG - Intergenic
1183750770 22:39719185-39719207 TCACACTCCCTGCCCAGGGCGGG + Intergenic
1184133602 22:42532745-42532767 ACACACCCTCATCCAATGACTGG - Intergenic
1184260518 22:43312750-43312772 GCACACTCCCTGCCTGTGCCTGG + Intronic
951342938 3:21511097-21511119 ACAGACTCCCTTTCAATAACAGG + Intronic
952722069 3:36544132-36544154 ACACACTCCCTGCTCATCACTGG + Intronic
955488340 3:59457423-59457445 CCACACTGCCTGCCACTGCCGGG - Intergenic
961452074 3:127006739-127006761 ACACACTCCCTGCCCAAGCAGGG - Intronic
964284777 3:155106279-155106301 AAACACTCCCTGTCAACCACTGG - Intronic
964343862 3:155736521-155736543 ACACACTGCCTGCAAAAGACAGG + Intronic
965765953 3:172130145-172130167 ACACACACCAGCCCAATGACCGG - Intronic
968933992 4:3600439-3600461 ACACACTGCTTGGCAATGAATGG + Intergenic
970316292 4:14831443-14831465 GCACACCCCCTGCCCATGCCTGG - Intergenic
974010202 4:56599551-56599573 ACACACCCCCTGCCGCTGACAGG + Intronic
977463216 4:97351826-97351848 ACACACTCATTGCCAATAATAGG + Intronic
979696756 4:123621467-123621489 CCTCACTCCCTGATAATGACAGG - Intergenic
982294754 4:153816120-153816142 ACACACTCTTTGCCATTGAGAGG - Intergenic
983865334 4:172759570-172759592 ACACACCCCCTGCCTATGGGAGG - Intronic
986872330 5:12064144-12064166 ACACAACCCTTGCCAAAGACTGG - Intergenic
994011638 5:94911068-94911090 ACTCACTGCCTGCTAATGATGGG + Intronic
995422749 5:111985613-111985635 ACATAGTCCCTGCTAATGAAAGG + Intronic
997868461 5:137486005-137486027 ACACACTCCCTACCAATCCAGGG + Intronic
999745294 5:154587371-154587393 AGCCACTCCCTGCCAATGAATGG - Intergenic
1003397469 6:5765449-5765471 CCACGCTCCCTGCCATTGGCAGG - Intronic
1003414887 6:5898718-5898740 ACGCACTACCTACCACTGACAGG - Intergenic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1009045853 6:58237140-58237162 ACACGCTCAGTGTCAATGACTGG - Intergenic
1009734743 6:67662556-67662578 ACACACTCCCTGGCTATGGCAGG + Intergenic
1009856464 6:69271754-69271776 ACACACCCCTTTCCAATTACAGG + Intronic
1010840604 6:80645504-80645526 ACACACTCCATGCTCATGAATGG + Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1021940314 7:25672661-25672683 AGAAACACCCTGCTAATGACTGG + Intergenic
1023554479 7:41406658-41406680 CCTCACTCCCTGCCAAAGTCTGG + Intergenic
1024939284 7:54745480-54745502 ACACATTGCCTGCCAAAGAAGGG - Intergenic
1025785492 7:64639921-64639943 TCACAATCCCTGCCATGGACAGG - Intergenic
1026323785 7:69290591-69290613 ACACTCTCCCTGCCAAAGGTAGG - Intergenic
1026678538 7:72448214-72448236 ACACACTGCCTGCATATTACAGG + Intergenic
1026770632 7:73195793-73195815 ACCCACACGTTGCCAATGACAGG - Intergenic
1027011500 7:74749182-74749204 ACCCACACGTTGCCAATGACAGG - Intronic
1027076541 7:75196860-75196882 ACCCACACGTTGCCAATGACAGG + Intergenic
1027958463 7:84913339-84913361 ACACATGCCCTGGCAATGTCAGG + Intergenic
1030693448 7:112558487-112558509 ACACAGTTCCTGACAATAACAGG + Intergenic
1031058753 7:117024782-117024804 ACATACTCCCTGCCATTCCCTGG + Intronic
1032082018 7:128864000-128864022 ACCCACCCCCTGCCAGTCACTGG - Intronic
1037188830 8:16097804-16097826 ACAAATTCCATGCCAATGTCAGG + Intergenic
1037620435 8:20558840-20558862 ACACACTCCCTGCTTCTCACTGG - Intergenic
1039973050 8:42336472-42336494 ACACACACCCTGCTGAGGACTGG + Intergenic
1041277856 8:56181560-56181582 CCCCACCCCCTGCCAATGACAGG - Intronic
1045255707 8:100519149-100519171 ACCCCACCCCTGCCAATGACTGG + Intronic
1045319860 8:101074124-101074146 ACAAACTCTCTGCCAAGCACTGG - Intergenic
1046063459 8:109167527-109167549 ACACACTCCCTACCAAAGCTGGG + Intergenic
1048038514 8:130701495-130701517 ACATATTCCCTGCCAATAAGGGG + Intergenic
1048333487 8:133486627-133486649 ACAAGCTCCCTGTCAATGGCAGG + Intronic
1048520205 8:135146914-135146936 AACCACTCCCTGTCCATGACTGG + Intergenic
1048714711 8:137255358-137255380 ACACAATGCCTGTCACTGACAGG - Intergenic
1050988101 9:12108502-12108524 ACACATTCCCCCCCAATAACTGG + Intergenic
1051259080 9:15244368-15244390 CCACACTGCCCGCCAGTGACTGG - Intronic
1052145700 9:25045637-25045659 ACTCACACCCTGGCAATGGCGGG + Intergenic
1053249279 9:36560872-36560894 ACAAACACCCTGGCAATGTCTGG - Intergenic
1053284679 9:36842475-36842497 ACCCACTCCCTCCCAAAGCCAGG + Intronic
1053362803 9:37501314-37501336 ACACACGCCATGCAAATGGCAGG - Intronic
1056660233 9:88537772-88537794 ACACACTCCCTGGGGATGCCAGG - Intronic
1059808830 9:117833710-117833732 TCAAACTCCCTCCCAATGGCTGG - Intergenic
1060413996 9:123418160-123418182 AGACACTCCCCTCCAATCACAGG + Intronic
1192552877 X:72068143-72068165 ACACCCTCCTAGGCAATGACTGG + Intergenic
1195030824 X:100926291-100926313 ACACACAACCAGTCAATGACAGG + Intronic
1196151041 X:112374876-112374898 TCTCTCTCCCTCCCAATGACTGG + Intergenic
1199526060 X:148793237-148793259 CCACCCACCCTGCCAAAGACTGG - Intronic