ID: 1149990497

View in Genome Browser
Species Human (GRCh38)
Location 17:61380618-61380640
Sequence GCTTCTTTTGTCCCTCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149990489_1149990497 12 Left 1149990489 17:61380583-61380605 CCTATCTTTGCCTATGTGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1149990497 17:61380618-61380640 GCTTCTTTTGTCCCTCAAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 190
1149990493_1149990497 2 Left 1149990493 17:61380593-61380615 CCTATGTGGAAGGGGTTGTCCCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1149990497 17:61380618-61380640 GCTTCTTTTGTCCCTCAAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149990497 Original CRISPR GCTTCTTTTGTCCCTCAAGA GGG Intronic
901503053 1:9665756-9665778 TTTTTTTTTGTCCCCCAAGACGG + Intronic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
906055780 1:42915713-42915735 TCTTTTTTTTTCCCCCAAGACGG + Intergenic
913411682 1:118559147-118559169 GTTTTTTTTCTCCCTCAGGATGG + Intergenic
916253945 1:162766997-162767019 TCTTGTTCTGTCCCTCAGGATGG - Intronic
916337303 1:163687391-163687413 GGTTCTTTGGACCCTCAAAATGG - Intergenic
916682596 1:167117791-167117813 GACTCTCTTGTCCCTCAAGAAGG + Intronic
917050847 1:170920754-170920776 CCAGCTTCTGTCCCTCAAGAAGG + Intergenic
920224402 1:204427751-204427773 GTTTCATTTGTCCCTACAGATGG - Exonic
920870511 1:209790528-209790550 CCTTCTTTTGTCTCTCAATCAGG + Exonic
921569740 1:216764297-216764319 TCTTGTTTTGTCCCCCAAGGTGG + Intronic
922723409 1:227910350-227910372 GCTTTTTTTTACCCCCAAGACGG - Intergenic
924313570 1:242773027-242773049 GCTTCTCTTTGCCTTCAAGAGGG - Intergenic
924663153 1:246041296-246041318 GCTTCTTTCCACCCTCAGGATGG - Intronic
1063622658 10:7663607-7663629 GATACTTTTTTCCTTCAAGAGGG + Intronic
1064064094 10:12165911-12165933 GATTTTTTTTTCCCTTAAGAAGG + Exonic
1067218915 10:44327534-44327556 GCTTCCTTTGTACCTCATGCTGG - Intergenic
1067374013 10:45710895-45710917 GCTTCATTTGTTGGTCAAGATGG - Intergenic
1069781191 10:70956699-70956721 GCTTCTTTCCTCCCTCCATAGGG - Intergenic
1070175017 10:73962806-73962828 GGTTCTTTTGCCCCTCCAGATGG - Intergenic
1070698197 10:78578678-78578700 GACTCTTTGGTCCCTCAAGTTGG + Intergenic
1072587895 10:96798855-96798877 CCTTCTGTTCTCCCTAAAGAGGG + Intergenic
1073794087 10:106969429-106969451 GCTGATTTTGTCCCTGAAGCAGG + Intronic
1075321746 10:121496721-121496743 GCTTCTCTTCTTCCTCAACAGGG - Exonic
1076172995 10:128338534-128338556 TCGTCTTTGCTCCCTCAAGAAGG + Intergenic
1078148657 11:8740372-8740394 GCTTCTTGTGTTACTGAAGAGGG - Intronic
1079109020 11:17593701-17593723 GGTTCTCTGGTCCCACAAGAGGG - Exonic
1080276172 11:30505494-30505516 GATTCTTTTGTCCAGCCAGATGG - Intronic
1080863999 11:36177487-36177509 GATTCTTTTGTCCCACAGGGTGG + Intronic
1081809004 11:45904949-45904971 GCTTCTTTTCTCCCTCCTGTAGG + Exonic
1083317312 11:61824375-61824397 TCTTTTTTTTTCCCCCAAGATGG - Intronic
1088822151 11:113465504-113465526 GCTTCTTTTTTCCCTCAGGATGG + Intronic
1089336282 11:117725972-117725994 ACTTCTTCTGTCACTCAATATGG - Intronic
1090548747 11:127795194-127795216 GCTTTTTCTGTCCCTGGAGAAGG - Intergenic
1091136023 11:133190303-133190325 TCTTTTTTTGTCCCTTAAAATGG - Intronic
1091231897 11:133993461-133993483 GCTTCCTTTGTCCTTCTGGAAGG + Intergenic
1091243714 11:134072904-134072926 TCTTTTTTTTTCCCCCAAGACGG - Intronic
1092995699 12:13948357-13948379 GCATCTTTAGTCCCCCCAGAGGG - Intronic
1093599470 12:21003485-21003507 GCTTTTTTTCTTCCCCAAGATGG - Intergenic
1093742675 12:22706337-22706359 CCTTCTTTTCTCCATGAAGAAGG + Intergenic
1094039890 12:26111474-26111496 TCTTTTTTTTTCCCCCAAGATGG - Intergenic
1095300540 12:40579599-40579621 TCTTGTTTTGTCCCTCAGGCTGG - Intergenic
1098346581 12:69511107-69511129 GCTTTTTTTCTCCCTGAGGAGGG + Intronic
1100873619 12:98939529-98939551 GCTTCTTTTTTCCTTGAAGTCGG + Intronic
1104380927 12:128307249-128307271 GCTTCTTCTGTCCCCAAAGTGGG + Intronic
1104708597 12:130968414-130968436 TTTTCTTTTCTCCCTTAAGAAGG - Intronic
1106401452 13:29435308-29435330 GCTCCTGTTTTCACTCAAGAGGG - Intronic
1106447041 13:29844263-29844285 GTTTATTTTGTCCCCCAAAAGGG - Intronic
1108004720 13:45935044-45935066 GCTTCTTTTGTACCCTAAAATGG + Intergenic
1110013640 13:70371209-70371231 GCTTTTTGTTTCCCTGAAGATGG + Intergenic
1110290695 13:73803533-73803555 GATTCTTCTGTCCCTGGAGAAGG - Intronic
1110658571 13:78030475-78030497 TCTTCTTTTGTGCCTGAAAATGG + Intergenic
1111129611 13:83957500-83957522 TCTTCTTTAGTTCATCAAGAAGG - Intergenic
1112304086 13:98257763-98257785 TTTTCTTTTCCCCCTCAAGATGG - Intronic
1112588692 13:100743957-100743979 GATTCTTTTCTCCCTCAATGTGG - Intergenic
1113271675 13:108681602-108681624 TCTTTTTTTTTCCATCAAGAAGG + Intronic
1113465536 13:110510194-110510216 CCTTCTTTTGTCCGTGAGGATGG + Intronic
1114016691 14:18436550-18436572 TGTTTGTTTGTCCCTCAAGAAGG - Intergenic
1114021138 14:18479853-18479875 GCTCTGTTTGTCCCTCAAAAAGG + Intergenic
1118028567 14:61796700-61796722 GTTTCACTTGTACCTCAAGATGG + Intergenic
1121518121 14:94567430-94567452 GGTTCTTTTTTGCCTAAAGAGGG - Intronic
1121966317 14:98309751-98309773 CTTTCATCTGTCCCTCAAGATGG - Intergenic
1123587249 15:21771732-21771754 ATTTGTTTTGACCCTCAAGAGGG - Intergenic
1123623887 15:22214297-22214319 ATTTGTTTTGACCCTCAAGAGGG - Intergenic
1123744134 15:23305424-23305446 GCTTCTTTTTCCTCTCGAGAGGG + Intergenic
1123941130 15:25217194-25217216 CCTCCTTCTGTCCCTCTAGATGG + Intergenic
1126235078 15:46374202-46374224 GCTTTTTTTCCCCCTCAAAAAGG - Intergenic
1128509686 15:68305781-68305803 GCTCTTTCTGTCCCTCAAGGCGG + Intronic
1129960099 15:79676299-79676321 GTTTCTTTCTTCCTTCAAGAAGG - Intergenic
1130337864 15:82972955-82972977 GCCTCTTTTGTACCTCATGGAGG - Intronic
1130804291 15:87302431-87302453 CCTTCTTTTGCAGCTCAAGATGG - Intergenic
1133062039 16:3181194-3181216 GGTTCTTTTTTCAATCAAGAAGG + Intergenic
1133531051 16:6655342-6655364 GCTTATTTTGTCACTCAGGCTGG - Intronic
1134241941 16:12512979-12513001 GCTTCCCTTGTCCCCCCAGAGGG + Intronic
1136705662 16:32186084-32186106 GCTTCTTTTTCCTCTCAAGAGGG - Intergenic
1136762251 16:32743323-32743345 GCTTCTTTTTCCTCTCAAGAGGG + Intergenic
1136805848 16:33127063-33127085 GCTTCTTTTTCCTCTCAAGAGGG - Intergenic
1139157846 16:64465745-64465767 CCTTTTTTTGACCCTCAAGATGG - Intergenic
1139606704 16:68023755-68023777 GCTTCTTCTCTCTCTCAAGTGGG + Intronic
1140539441 16:75742908-75742930 GCTTTTTTTGCCCCTTAAAATGG + Intronic
1140731090 16:77857029-77857051 GCTTCTTTTGTCCCACCATGGGG - Intronic
1140857762 16:78992783-78992805 GCTATTTATGTCCCTCAAGGAGG - Intronic
1203064408 16_KI270728v1_random:1003642-1003664 GCTTCTTTTTCCTCTCAAGAGGG + Intergenic
1145015842 17:19397670-19397692 GCTTCTGTTGACACTTAAGAGGG + Intergenic
1146503013 17:33380681-33380703 GCCTCCTTTGTCCCTCATCAAGG + Intronic
1147860664 17:43520732-43520754 TCTTTTTTTGTCCCTCTAGATGG + Exonic
1148121933 17:45218264-45218286 TTTTTTTTTTTCCCTCAAGACGG + Intergenic
1149227604 17:54492996-54493018 GCTTCTTTTGGTGCTAAAGATGG - Intergenic
1149251815 17:54778893-54778915 GCTTTTTTTGTCCTGCAACATGG - Intergenic
1149812660 17:59692640-59692662 TCTTTTTTTTTCCCCCAAGATGG + Intronic
1149990497 17:61380618-61380640 GCTTCTTTTGTCCCTCAAGAGGG + Intronic
1153975493 18:10265173-10265195 GGCTCTGTTGTCCCTCCAGAAGG + Intergenic
1154075376 18:11195598-11195620 GCTTCTTTTGTCCCTGGGGATGG - Intergenic
1155483563 18:26316389-26316411 TCTTTTTTTTTTCCTCAAGATGG + Intronic
1156502696 18:37569644-37569666 GCTTCTCTCGTTCCTCAAGGAGG + Intergenic
1158745890 18:60199571-60199593 GCTTCTTCTTTCCCTGAACATGG + Intergenic
1161895929 19:7080297-7080319 CCTTCTTTTCCCCCACAAGATGG - Intronic
1162747636 19:12807608-12807630 GCTTCCTTTGTCACCCAGGATGG - Intronic
1164942561 19:32262844-32262866 TCTTCTTTTGTCACAAAAGAGGG - Intergenic
1165268523 19:34682715-34682737 GCCTCTTCTGTCACTGAAGAAGG - Intronic
1165316380 19:35058924-35058946 GCTCACTTTTTCCCTCAAGAGGG + Intronic
1165482848 19:36075448-36075470 GCTTTTTTTCCCCCCCAAGACGG + Intronic
1165680579 19:37771161-37771183 GCGTCTTTTGTCCCTGCAGGTGG + Intronic
1165770004 19:38374564-38374586 GCCTCTGTCGTCACTCAAGATGG - Exonic
1168105186 19:54162101-54162123 GCTGCTTTTCTACCTGAAGAAGG - Exonic
1168552139 19:57305165-57305187 GCTGCTTTTATCCAACAAGATGG + Intergenic
926064458 2:9826124-9826146 TCTTCTTTTTTCCCCCAAAAGGG + Intergenic
928252126 2:29690231-29690253 GGTTCTTCTGTTCATCAAGATGG - Intronic
929215987 2:39413827-39413849 GATCATTTTGTCACTCAAGAGGG + Intronic
929357316 2:41041365-41041387 GCTTCATGTGTCCTTCAGGATGG - Intergenic
931776951 2:65549081-65549103 GCTTGCTCTGTCCCTTAAGAAGG + Intergenic
932153160 2:69391401-69391423 GCTTCTCTCCTCCCTCAAGTAGG + Intergenic
934979352 2:98827305-98827327 TCTTTTTTTTTCCCCCAAGATGG + Intronic
935146443 2:100398702-100398724 ATTTCTTTTTTCCCCCAAGACGG - Intronic
937716758 2:125040412-125040434 CCTTTTTTTTTTCCTCAAGATGG - Intergenic
940571058 2:155434197-155434219 GCTGCTTTTGTACCACAACAAGG - Intergenic
941786089 2:169500199-169500221 GCTTCATTTGTCTCTCCAGCTGG + Intronic
942508113 2:176665413-176665435 GCTTCTTCTCTCCCTGTAGATGG - Intergenic
945764002 2:213950713-213950735 TTTTTTTTTTTCCCTCAAGACGG + Intronic
948491103 2:238313929-238313951 CCTTCTTTTGTACCCCAAGCTGG + Intergenic
948626025 2:239268579-239268601 GGTTCTTCTGTCCCTCCAGGTGG - Intronic
1170788507 20:19488519-19488541 GCATGTTTTATCCCTCCAGAAGG - Intronic
1172343934 20:34181908-34181930 ACTTTTTTTTTCCCCCAAGACGG + Intergenic
1173265359 20:41474343-41474365 TCTTCTGTTTTCCCTCTAGATGG - Intronic
1173465533 20:43278288-43278310 GCTTCTTTCTTCCCCCAACAGGG - Intergenic
1175642127 20:60639654-60639676 GCTCCATTTGTCCCTCCCGATGG + Intergenic
1176921778 21:14696379-14696401 GCTTCTTTAATCCCTCCACATGG + Intergenic
1176948473 21:15013873-15013895 GCTTCTATTTTTCCTCAAAACGG + Intronic
1178450154 21:32690914-32690936 GCTTTTTTTTTCCCCCAAGTTGG - Intronic
1179315111 21:40237194-40237216 ACTTCTTTAGTGCCTCCAGAAGG - Intronic
1179639175 21:42735998-42736020 GCTTTTTGTGTCCGTAAAGAGGG - Intronic
1180441197 22:15367423-15367445 TGTTTGTTTGTCCCTCAAGAAGG - Intergenic
1180445598 22:15410199-15410221 GCTCTGTTTGTCCCTCAAAAAGG + Intergenic
1183744185 22:39683971-39683993 TCTCCTTATGCCCCTCAAGATGG + Intronic
949929890 3:9070393-9070415 GCTTCTCTTTTCCTTCAAGGAGG - Intronic
954866579 3:53735087-53735109 GCTTGTTGTCTTCCTCAAGATGG - Intronic
955950142 3:64235622-64235644 GCTTCTGATGTCCCTCCGGAGGG + Intronic
956047569 3:65212384-65212406 TCTTGCTTTGTCCCTCAAGCTGG - Intergenic
959975029 3:112449049-112449071 GCTTTTTTTTCCCCTCAATAGGG + Intergenic
960925011 3:122786005-122786027 CTTTCATTTGTCTCTCAAGAGGG - Intronic
964325071 3:155536144-155536166 GATTCTTTTGTCCCACAGGGTGG - Intronic
964678083 3:159305631-159305653 TCTTCCTTTCTCCCTTAAGATGG - Intronic
969435126 4:7184959-7184981 ACTGTGTTTGTCCCTCAAGAGGG + Intergenic
971061754 4:22979179-22979201 GATTCTTTTGTCCCACAGGGTGG - Intergenic
971674426 4:29607212-29607234 GCTTCTTTTCTCTCTAAAAAAGG + Intergenic
971759891 4:30752134-30752156 CCTTTTTTTTTCCTTCAAGATGG + Intronic
972033886 4:34496472-34496494 GCTTTTCTTTTCCCTCATGAAGG + Intergenic
975693240 4:76986143-76986165 GCTTTTTTTCTCCTGCAAGAGGG + Intronic
976887940 4:90008371-90008393 GATTCTTTTGTCCCACAGGGTGG - Intergenic
977281871 4:95049848-95049870 GCTGATTTGGTTCCTCAAGAAGG - Intronic
977873966 4:102127594-102127616 GCTTATTTTTTTCCTAAAGAAGG - Intergenic
978018695 4:103781733-103781755 GCTTCTTTTGTTTCACAAGTTGG + Intergenic
980464977 4:133163045-133163067 CCTTCTTTTGTCCCTTCTGATGG + Exonic
986493500 5:8317947-8317969 GCTTTGTTTGTCCCTTAACAAGG + Intergenic
993034426 5:82741339-82741361 CCTTTTGTTGTCCCTAAAGAGGG - Intergenic
997666630 5:135634685-135634707 GCTTGTTTGGACCCTCAAAAGGG + Intergenic
998435638 5:142106107-142106129 GTTTCTTTTCTCTCTCAGGAGGG + Intergenic
998906501 5:146911111-146911133 TCTTGTTTTGTCCCCCAAGTTGG + Intronic
1001337039 5:170807442-170807464 CCCTCTTTTGTACCTAAAGAGGG - Intronic
1002020798 5:176363298-176363320 GGTTCTTTTGGCTCTCCAGAGGG + Intergenic
1002021036 5:176364794-176364816 GGTTCTTTTGGCTCTCCAGAGGG - Intergenic
1008851068 6:56022384-56022406 TCTTTTTTTATCCCTCAAGTTGG + Intergenic
1010411091 6:75562648-75562670 TTTTCTTTTTTCCCCCAAGATGG + Intergenic
1012655503 6:101813932-101813954 GCTTGCTTTGTCCTTCAAGCTGG - Intronic
1013533656 6:111043146-111043168 GCTTCTTTAGTCCATCTAGTGGG - Intergenic
1017064136 6:150513053-150513075 GTTTCTTTTGTTGCTCAAGCTGG - Intergenic
1019586258 7:1805567-1805589 TTTTCTTTTTTCCCCCAAGACGG - Intergenic
1023474180 7:40558871-40558893 GCTGCTTTTCTCTCTCATGAGGG + Intronic
1023939643 7:44761380-44761402 GCGTCTTGTGTCACTCAAGGAGG - Intronic
1024887669 7:54163028-54163050 GCTTCTTTTTTCCCCTAGGAAGG - Intergenic
1029215988 7:98950045-98950067 TCTTCTTTTGACCCTCCAGAAGG + Exonic
1029650927 7:101890925-101890947 TCTTCTTTTGTCACTTAAGTAGG + Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1029902630 7:104058216-104058238 TCTTCTTTTGTCACCCAGGATGG - Intergenic
1032379526 7:131462569-131462591 GCTTCTTTTTTCCCTGTAGCTGG + Intronic
1033020232 7:137717288-137717310 GCCTTTTTTGGCTCTCAAGAAGG + Intronic
1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG + Intergenic
1035605075 8:925160-925182 TCTTATTTTGTCACTCAAGCTGG + Intergenic
1036616490 8:10391781-10391803 GCTTCATTTGTCCCACGTGAAGG + Intronic
1038916227 8:32026380-32026402 GCTTATTTTTTCCCCCAAGAAGG + Intronic
1039045623 8:33446545-33446567 GCTTCCTTTGTCCCTAACAAAGG - Intronic
1039136952 8:34335728-34335750 GCTTCTTATGTGCCTTGAGAGGG + Intergenic
1040283713 8:46088934-46088956 GGTTCTTTTGTTTCTCAAGGAGG + Intergenic
1043995439 8:86808760-86808782 TTATTTTTTGTCCCTCAAGAAGG - Intergenic
1047471765 8:125181189-125181211 GCTCCTTTTTTCCCCCAAGGAGG + Intronic
1047558874 8:125965037-125965059 GCTCCCTTTGTCTCTCAAAAGGG - Intergenic
1048252273 8:132876605-132876627 GGTCCTTTTGCCCTTCAAGAAGG + Intronic
1050082411 9:1928860-1928882 TCTGCATTTTTCCCTCAAGAAGG - Intergenic
1053202473 9:36162168-36162190 TCTTTTTTTTTCCCCCAAGATGG - Intronic
1053208561 9:36208470-36208492 GCTTCTGTTGTTCCTGAATATGG - Intronic
1061611601 9:131750218-131750240 GCTTGTTTTCCCCCCCAAGATGG - Intergenic
1061948012 9:133919612-133919634 GCATCTTTTCTCTCCCAAGATGG - Intronic
1062479722 9:136745686-136745708 GCTTCTCTTCACCCTCAGGATGG + Intronic
1186719371 X:12286598-12286620 GCTTTTTTTGTGCCTTATGAAGG + Intronic
1187670771 X:21664223-21664245 GCTTCTTTTTGCCCTTCAGAAGG - Intergenic
1188605081 X:32018341-32018363 TCCTCTTTTGTCCCTCAACATGG + Intronic
1191675171 X:63785411-63785433 GCTGCTTTTGTCCCCCACCAAGG + Intronic
1192266418 X:69541390-69541412 GCTTCTCTTGACCTTCAAGTTGG - Intergenic
1193673171 X:84414993-84415015 GCCTATTTTGTACCACAAGATGG - Intronic
1195127579 X:101823161-101823183 CCTTCTTTTGGCCCACAACATGG - Intergenic
1197033632 X:121848825-121848847 GCATCTTTTGTAACTCAGGATGG - Intergenic
1197313115 X:124930635-124930657 GCTTCTTTTGTACCTTACCATGG + Intronic
1198269006 X:135036429-135036451 GCTGCTTTTGGCCCTCTTGACGG + Intergenic
1199262276 X:145789305-145789327 GCTTCTTTAGGGCCCCAAGAAGG - Intergenic
1199704532 X:150412426-150412448 CCTTCTTGCATCCCTCAAGATGG + Intronic
1201913434 Y:19156949-19156971 GCATCTTTTGTCCTTGAAGAAGG + Intergenic