ID: 1149991674

View in Genome Browser
Species Human (GRCh38)
Location 17:61387084-61387106
Sequence CAGGGGCCCCAGCAGTAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149991674_1149991683 14 Left 1149991674 17:61387084-61387106 CCGACCTACTGCTGGGGCCCCTG 0: 1
1: 0
2: 0
3: 25
4: 265
Right 1149991683 17:61387121-61387143 GCTTTCCCTGCGTCTCACACAGG 0: 1
1: 0
2: 1
3: 4
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149991674 Original CRISPR CAGGGGCCCCAGCAGTAGGT CGG (reversed) Intronic
900592362 1:3465719-3465741 TGGGGGCCCCAGCAGGAGGCCGG - Intronic
900642775 1:3695309-3695331 CAGCGGCCCCAGGAGGAAGTGGG - Intronic
900651109 1:3730513-3730535 CAGGGGCCCCAGCACAAGCCGGG + Intronic
900782309 1:4626150-4626172 CCGGGGCCCGAGGAGGAGGTGGG + Intergenic
901311047 1:8269947-8269969 GAGGGAACCCAGCAGTGGGTGGG - Intergenic
901337922 1:8467481-8467503 CAGGGGCTCCAGCAGTTGCCAGG - Intronic
901634695 1:10665089-10665111 CAGCGGCCCCAGCACCAGGCAGG - Exonic
902515264 1:16986550-16986572 CAGCGGCCCCTGCAGGAGGCCGG + Exonic
902654685 1:17859313-17859335 CTGAGGACCCAGGAGTAGGTAGG - Intergenic
903328480 1:22584989-22585011 CAGGGGCCGCAGGAGCAGGGCGG + Intronic
904351529 1:29910179-29910201 CATGAGCCCCAGGAGTGGGTCGG + Intergenic
905263144 1:36733168-36733190 CAGTGGCCCCAGCTGTAGAGTGG + Intergenic
906112990 1:43337082-43337104 CAGGAGCAACAGCATTAGGTGGG - Intergenic
906243399 1:44256524-44256546 CTGGGGCCCCTGAAGTATGTTGG - Intronic
906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG + Intergenic
906880776 1:49587367-49587389 GAGGGGCCCCTGGACTAGGTGGG - Intronic
907894545 1:58673872-58673894 CAGGAGCACCAGTAGCAGGTGGG + Intronic
908253878 1:62286752-62286774 CTGGGGCCCCAGGAGGGGGTAGG - Intronic
909722729 1:78795457-78795479 CTGTGGCCCCAGCACTAGGGAGG - Intergenic
911179480 1:94848280-94848302 CAGGGACCACAGCAGTTGGCTGG + Intronic
912192160 1:107352867-107352889 CAGTGGTCCTAGCTGTAGGTGGG + Intronic
912748737 1:112268077-112268099 CAGTGGCCCCAGCAGATGCTGGG + Intergenic
914905103 1:151737515-151737537 CAGTGGCCCAAGCAGTACCTTGG - Intergenic
915512381 1:156393173-156393195 CAGGGCACCCAACATTAGGTGGG - Intergenic
917817675 1:178726057-178726079 CAGGGGCCGCAGCCCCAGGTCGG + Intronic
919802882 1:201364233-201364255 CTGGGGGCCCAGCAGGAGCTGGG + Intronic
919917001 1:202144857-202144879 CAGGGGCCGCACCCGCAGGTGGG + Intergenic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
923211369 1:231807057-231807079 GAGGGCCCCCAGCAGTGGGAAGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1067283424 10:44890362-44890384 CTGGGGCCCCAGCAGCCGATAGG + Intergenic
1072207803 10:93220570-93220592 CAGGGTCCCCACCAGCAGGAAGG + Intergenic
1073176481 10:101560383-101560405 CAGGGGCCACCACAGCAGGTAGG + Intergenic
1073327509 10:102651150-102651172 CAGTGGCCTCAGCAGCAGGAGGG + Intronic
1073484822 10:103810043-103810065 TAGAGGCTCCAGCAGTAGGGAGG - Intronic
1074106013 10:110390179-110390201 CAGGTCCCCCAGCAGCAGGAGGG - Intergenic
1074478429 10:113795070-113795092 CGGGGTCCCCAGCAGTTAGTGGG + Intergenic
1074780284 10:116797519-116797541 CAGGTCACCCAGCAGTATGTGGG + Intergenic
1074780615 10:116799429-116799451 CAGGTCACCCAGCAGTATGTGGG - Intergenic
1074892062 10:117744041-117744063 CAGTGGTTCCATCAGTAGGTGGG - Intergenic
1075942867 10:126406189-126406211 CATGGGCCCCAGACCTAGGTGGG - Intergenic
1076024706 10:127101696-127101718 AAGGGGAGCCAGCAGCAGGTGGG + Intronic
1076798161 10:132808750-132808772 CTGGGGCCCCAGCAGCTGATGGG + Exonic
1076851386 10:133095150-133095172 CAGGAGCCCCAGCTGGAGCTCGG + Intronic
1077148347 11:1055993-1056015 CAGGGGCCCAAGAGGAAGGTGGG + Intergenic
1077214151 11:1388397-1388419 CAGAGGCCCCAGAATTGGGTAGG + Intergenic
1077673574 11:4179200-4179222 CAGTGGCAGCAGCAGTAGGCAGG + Intergenic
1078665501 11:13321666-13321688 CTGGGGCCCCACTAATAGGTAGG - Intronic
1080964224 11:37195479-37195501 CAGTGGCCCAAGCAGTATTTGGG + Intergenic
1083236865 11:61356666-61356688 CAGGGACCCCAGCAGCAGGCAGG + Exonic
1083782780 11:64926647-64926669 CAGCTGCCCCAGCTGTGGGTGGG - Intronic
1084000758 11:66294311-66294333 CAGGGGCCGCTGCTGCAGGTGGG - Exonic
1084810055 11:71606746-71606768 CTGGCGCTCCAGCAGTGGGTGGG + Intergenic
1085394935 11:76202467-76202489 CATGGGCACCAGCATGAGGTGGG - Intronic
1091396383 12:156293-156315 CAGAGGCCCCAGGAGTGAGTGGG + Intronic
1095939637 12:47717619-47717641 CAGCGGCCCTGGCAGGAGGTGGG + Exonic
1096957939 12:55546071-55546093 CAGGGTCCCCAAGAGTAGGAAGG - Intergenic
1102006300 12:109591163-109591185 CAGCTGCCCCAGCAGTGGGGTGG - Intronic
1102526485 12:113515715-113515737 CAGCGGCCACAGCAGGAGCTGGG + Intergenic
1102691704 12:114766410-114766432 GAGGGGCCGCAGCAGTAGGGGGG - Intergenic
1104797200 12:131528079-131528101 CAGGGCTCCCAGCAGGAGATGGG + Intergenic
1105407656 13:20145307-20145329 CAGGGGTCCAAGCAGAATGTTGG - Intronic
1105793969 13:23832281-23832303 CAGAGTCCCCACCAGTAGGAAGG + Intronic
1108450524 13:50558205-50558227 GAGGGGCCTCAGCAGGAGGCAGG + Intronic
1108455388 13:50608530-50608552 AATGGGCCACAGCAGCAGGTGGG + Intronic
1109078141 13:57864541-57864563 AAAGTGCCTCAGCAGTAGGTGGG + Intergenic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1113150807 13:107261562-107261584 CAGACTCCCCAGCAGTAGTTCGG - Intronic
1113762532 13:112859574-112859596 CAGGGTGCCCAGCAGCAGGCGGG + Intronic
1116624048 14:47242722-47242744 CAGGGGCCCATGGAGTGGGTGGG - Intronic
1117011637 14:51476395-51476417 CAGGTGTCTCAGCATTAGGTTGG - Intergenic
1118717889 14:68573278-68573300 GAGGGGGCACAGCAGGAGGTGGG - Intronic
1119390821 14:74289961-74289983 CAGAGGTCCCAGCTGTGGGTGGG + Intronic
1120953667 14:90063201-90063223 CAGGGGCCCCATGAGCTGGTTGG + Intronic
1121334712 14:93070230-93070252 GAGGGGGCCCGGCAGCAGGTGGG + Intronic
1121417864 14:93791335-93791357 CAGGGGCGTCAGCAGGATGTGGG - Intergenic
1121608154 14:95256518-95256540 CCGTGGGCCCAGCAGCAGGTGGG - Intronic
1122429464 14:101630605-101630627 CAGGGGCCCGGGCAGGAGGCAGG - Intergenic
1122816619 14:104317126-104317148 CAGGGGCCCCAGCTGCAGGATGG - Intergenic
1122863104 14:104591377-104591399 CTGTGTCCCCAGCAGAAGGTGGG - Intronic
1123042586 14:105496466-105496488 CTGGGGCTCCAGCAGTGGGCTGG - Intronic
1123107907 14:105851533-105851555 AAGGGGCCGCAGAAGCAGGTGGG - Intergenic
1124121471 15:26892418-26892440 CCGGGGGCCCAGCAGTGGGGGGG + Intronic
1124650862 15:31472860-31472882 CAGGGGGGCCTGCAGTAGGGAGG + Intergenic
1127293809 15:57592285-57592307 CAGGGGGCCCACCAGCTGGTAGG + Intronic
1131360061 15:91782705-91782727 AAGGGGGCCCAGCACTAAGTTGG + Intergenic
1131454313 15:92571296-92571318 GAGGGGCCCAAGCAGATGGTTGG - Intergenic
1131525918 15:93152482-93152504 CAGAGGTCCCAGCAGTGGGGAGG + Intergenic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132747126 16:1441486-1441508 CAGGGGCCTCCGCTGTGGGTGGG - Intronic
1133021242 16:2967858-2967880 CAGGGGCCCCAGGAGAAGCTGGG + Exonic
1136590419 16:31214938-31214960 CAGGCGCGCCAGCTGCAGGTTGG - Exonic
1136858768 16:33681986-33682008 CAGGGGCCACAGCAGCAGTGAGG + Intergenic
1137068958 16:35881930-35881952 CAGGGGCAACAGCAGTTGCTAGG - Intergenic
1138265581 16:55657372-55657394 AAGGGGCACCAGAAGTGGGTGGG + Intronic
1138540612 16:57685190-57685212 CAGGGGCCCCAGGAGCTGGAGGG + Intronic
1139464181 16:67145306-67145328 CTGTGGCCCCAGCCCTAGGTAGG - Intronic
1139482872 16:67240408-67240430 CAGCCTCCCCAGCAGTAGCTGGG - Intronic
1140840770 16:78836859-78836881 TAGGGGGCCAAGCAGTAGATGGG + Intronic
1142186770 16:88698433-88698455 GAGGGGCCCGAGCAGGAGGAGGG + Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1143025929 17:3942016-3942038 TAGGGGCCTCAGCAGCAGGGAGG + Intronic
1143100699 17:4503209-4503231 CAGGAGCCCCAGGTGGAGGTAGG + Intronic
1143141619 17:4744600-4744622 GAGGGGCCCCAGGAGTGGGGTGG - Intronic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1146279676 17:31537054-31537076 GATGGGCCCCAGCAGGAGGCAGG - Exonic
1146488153 17:33260711-33260733 ATGGGGCCCCAGCACTGGGTTGG - Intronic
1147647115 17:42040509-42040531 CAGGGCATCCAGCAGCAGGTGGG + Intronic
1147653898 17:42077761-42077783 GAGAGGCCCCAACAGTGGGTAGG + Intergenic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1147924584 17:43938688-43938710 CTGGGGCCCCGGGAGGAGGTCGG - Exonic
1148485716 17:47989678-47989700 CAGGAGCCCCAGCATTGAGTGGG + Intergenic
1148690672 17:49525102-49525124 CAGGGGCCCCGGGGGTGGGTAGG - Intergenic
1149450226 17:56744312-56744334 CAGGGGCTACAGCAGAAAGTTGG + Intergenic
1149991674 17:61387084-61387106 CAGGGGCCCCAGCAGTAGGTCGG - Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152723451 17:81934018-81934040 CAGGGGCCACACCAGTGGGGTGG - Intronic
1154062469 18:11075090-11075112 CAGTTGCCACAGCAGTAGATAGG + Intronic
1156493415 18:37510340-37510362 CAGGGGTCCCTGCAGCAGATTGG - Intronic
1157904606 18:51558352-51558374 CAGGCCGCACAGCAGTAGGTGGG + Intergenic
1159746562 18:72243145-72243167 AAGGTGCCTCAGCAGAAGGTGGG + Intergenic
1159893200 18:73972333-73972355 CAGGGTCCCCAGAAGTAACTGGG - Intergenic
1160524791 18:79529170-79529192 CAGGGTACCCAGCCGCAGGTGGG - Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160837640 19:1132206-1132228 CAGCAGCCCCAGCATTGGGTCGG + Intronic
1161310260 19:3589970-3589992 CAGGGGTCCCAGCGGGAAGTTGG + Intronic
1161843193 19:6694626-6694648 CTGGGGTCCCTGCAGCAGGTGGG + Exonic
1163175355 19:15560934-15560956 CAGGGCCCCCTGGAGTAGGTGGG - Intergenic
1163361826 19:16851614-16851636 CAGAGGCCCCAGCAGGGGTTCGG + Intronic
1163776185 19:19219209-19219231 CAGTGGCCCCAGAAGTAGCGTGG - Exonic
1164428353 19:28165060-28165082 CAGGGGTCCCACCACAAGGTAGG + Intergenic
1165390191 19:35534295-35534317 CGGGGGCCGCAGGGGTAGGTGGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1168305579 19:55433396-55433418 CCCGGGCCCCAGCAGCAGGTTGG + Exonic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
925199897 2:1958789-1958811 AAGGGGCCTCTGCAGTCGGTTGG - Intronic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
926282792 2:11464173-11464195 AGGGGTCCCCAGCAGTGGGTTGG + Intronic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
930032326 2:47066014-47066036 CAGGCACCCCAGCAGTAGTGGGG + Exonic
934983955 2:98870577-98870599 CAGGGGCCCCTGCAGCAGAATGG + Intronic
936252498 2:110877372-110877394 CACGGGCCGCAGCAGAAGCTTGG - Intronic
937976355 2:127584350-127584372 CAGGGCCTCCACCAGAAGGTCGG - Intronic
939681135 2:145134588-145134610 CAGAGGGCCCTGCTGTAGGTAGG + Intergenic
942653980 2:178195252-178195274 CAGGGGCGCCAGCAGCGGGTGGG - Intronic
944161227 2:196662589-196662611 CAGGCCACCCAGCAGCAGGTGGG - Intronic
946148297 2:217747362-217747384 CAGGGGCCCACGCAGAAGTTTGG - Intronic
946182165 2:217955320-217955342 CAGGGGCCCCAGGACCATGTGGG + Intronic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946875796 2:224128659-224128681 CAGGGTCCCTGGCAGTAGGTGGG - Intergenic
948793737 2:240391839-240391861 CCCGGGGTCCAGCAGTAGGTGGG + Intergenic
1169115166 20:3059718-3059740 CATGGACGGCAGCAGTAGGTGGG - Intergenic
1171225147 20:23436424-23436446 GAGGGTGCCCAGCAGCAGGTGGG + Intergenic
1171289129 20:23970288-23970310 CAAGGGCACCTGCAGTAGCTGGG + Intergenic
1172031121 20:31982844-31982866 CAGAGGCCCCATCAGTAAGAAGG - Intronic
1172409485 20:34710773-34710795 CAGGGTCCCCACCATTTGGTAGG - Exonic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1175201029 20:57277773-57277795 CAGGGGCCCCAGCTGGAAGTTGG - Intergenic
1175266547 20:57706877-57706899 CAGGGGAACCAGCAGTGGGTGGG + Intronic
1175754330 20:61519932-61519954 CATGTGGCCCAGCAGTTGGTGGG - Intronic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1175902165 20:62364259-62364281 CAGGGGCTCCTGGAGAAGGTAGG + Intronic
1175944867 20:62553957-62553979 CCCTGGCCCCAGCAGTAGCTCGG - Intronic
1176011647 20:62900099-62900121 CAGGGGGCCCAGCAGCGTGTAGG - Intronic
1176020931 20:62962036-62962058 GAGGGGCCTCAGCAGCAGATGGG + Intronic
1176091433 20:63320170-63320192 CAGGGGCCCCCGGAGCAGTTCGG + Exonic
1180744539 22:18078501-18078523 CAGGTGCACCACCAGGAGGTCGG - Exonic
1180791616 22:18578090-18578112 CAGCGGTCCCAGCACTAGGCGGG + Intergenic
1181085916 22:20439273-20439295 GAGGGGCCCCAGCACTGGGAGGG - Intronic
1181230124 22:21417220-21417242 CAGCGGTCCCAGCACTAGGCGGG - Intergenic
1181248525 22:21517646-21517668 CAGCGGTCCCAGCACTAGGCGGG + Intergenic
1181584674 22:23846621-23846643 CAGCGGCCACAGCAGGAAGTGGG - Intergenic
1183327732 22:37203547-37203569 CTGGGGCCCCAGCGTTGGGTGGG - Intergenic
1183524175 22:38314050-38314072 CAGGGGCTCCAGCTGGAGCTAGG + Intronic
1184091997 22:42297772-42297794 CAGGGGCCCCAGCTGGTGGGGGG - Intronic
1184235270 22:43179860-43179882 CAGGGGCCACAGCAGCGTGTAGG + Exonic
950868989 3:16212801-16212823 CAGGGCCACTAGCAGGAGGTGGG + Intronic
951671577 3:25189458-25189480 CAGGGGCCCCAGCAGTGCCCAGG + Intronic
952014764 3:28943197-28943219 GAGGTTCCACAGCAGTAGGTAGG - Intergenic
953876328 3:46668781-46668803 CAGGGGCTCCTGCAGCAGCTGGG + Intergenic
954123509 3:48514895-48514917 CAGGGGCCCCTGAACGAGGTGGG + Intergenic
954967573 3:54624946-54624968 CAGGCGTCCCAGCTGTAGTTGGG - Intronic
955688185 3:61564730-61564752 CAGGAGCCCCACCAGTGGCTCGG - Intronic
956828084 3:73017486-73017508 CAGGGGACCCACCAGTGGCTAGG - Intronic
957934861 3:86929187-86929209 TAGGGTACCCAGCAGTAGCTGGG + Intergenic
957997659 3:87710748-87710770 CAGAGTCCCCAGCAGCAAGTAGG + Intergenic
958966454 3:100563988-100564010 CAGAGGCCCCAGCCCTTGGTGGG + Intronic
960774781 3:121237307-121237329 CAGCAACCCCAGCAGTAGCTGGG + Intronic
960992305 3:123319858-123319880 CAGGGGCACCAGCAGAGGGCTGG + Intronic
961407622 3:126692877-126692899 CAGGTGCCTCAGCTGTAGGATGG - Intergenic
961749241 3:129085871-129085893 CAGAGGCCCAGGCAGGAGGTGGG + Intergenic
961756156 3:129128414-129128436 CAGAGGCCCTGGCAGGAGGTGGG - Intronic
962352366 3:134665265-134665287 CAGGGGCAGCACCAGGAGGTAGG - Intronic
965932239 3:174059150-174059172 CCGGGGCCCAAGCAGTATGATGG - Intronic
966241355 3:177758033-177758055 CAGGGGCCCAAGCTGTACCTTGG + Intergenic
969270198 4:6094482-6094504 CAGGGGCCCCGGAGGTTGGTAGG - Intronic
970015253 4:11505783-11505805 CAGAGGCCCCTGCAGTGGGGAGG + Intergenic
979334567 4:119449270-119449292 CAGGGGTACCAGGATTAGGTTGG - Intergenic
979828167 4:125266037-125266059 CAGTGGCGGCAGCAGCAGGTGGG + Intergenic
985820179 5:2154259-2154281 GAGGGACCCCGGCAGTAGGTAGG + Intergenic
986410579 5:7475059-7475081 CAGAGGCCCAGGCAGGAGGTGGG - Intronic
988915860 5:35892948-35892970 CAGGAGCCCATGAAGTAGGTGGG + Intergenic
992159047 5:73982950-73982972 CAGGGACCCCAGCAGCTGGCAGG - Intergenic
992732818 5:79689823-79689845 CAGGGGCCAGAGCAGTCGGAGGG + Intergenic
993429491 5:87814243-87814265 CATGTGCACCAGCAGTAGCTGGG - Intergenic
998225521 5:140323427-140323449 CAGTGGCCCCAGCAGCCGGGTGG - Intergenic
999229353 5:150052541-150052563 CGTGAGCCCCAGCACTAGGTGGG + Exonic
999328718 5:150658903-150658925 CAAGGGACCCAGCAGCAGGTAGG - Intronic
999796757 5:154995940-154995962 AAGGGTCCCCAGCAGTAGAGTGG - Intergenic
1001435072 5:171693738-171693760 CAGGTCCCCCAGCAGGAGGCTGG - Intergenic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1001559568 5:172660230-172660252 CAGGGGGCCCGGCAGAGGGTCGG + Intronic
1001996215 5:176161271-176161293 CAGGGGGCCCAGTCATAGGTGGG + Intergenic
1002292746 5:178210860-178210882 CAGGTCCCCCAGAAGCAGGTGGG + Exonic
1006021754 6:31121522-31121544 CAGGGGCCAGAGCAGGAGGGAGG - Intronic
1006899380 6:37490225-37490247 CAGGGGCCCAAGGAACAGGTTGG + Intronic
1007796052 6:44348587-44348609 CTGTGGGCCCAGCAGCAGGTAGG + Intronic
1011551099 6:88531587-88531609 CAGGGGCCTCAGCTGTTGCTGGG - Intergenic
1011827579 6:91328443-91328465 AATGGGCCCCGGCAGTGGGTGGG + Intergenic
1013292136 6:108728824-108728846 CAGTGGCCCCTGCACTAGGAAGG + Intergenic
1013514794 6:110875572-110875594 CAGGGGCCCCAGGTGGGGGTCGG + Intronic
1013928591 6:115502717-115502739 CAGTGGTCCCAGCTGTACGTTGG - Intergenic
1014342756 6:120229557-120229579 CAGTGGCACCAGCTCTAGGTAGG - Intergenic
1016067331 6:139697995-139698017 CAGGAGCCCAAGGAGTGGGTGGG + Intergenic
1018112460 6:160548577-160548599 CATGGACCCCAGCATCAGGTGGG - Exonic
1019522155 7:1465910-1465932 CTGGGGCGCCAGCAGTAGCCTGG + Intergenic
1019579180 7:1751597-1751619 CAGGGAGCCCAGCAGGAGATGGG - Intergenic
1019602102 7:1889911-1889933 CAGGGGCCACAGCAACAGCTGGG + Intronic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1021362590 7:19734042-19734064 CAGGGGCTCAAGCTGAAGGTGGG + Intronic
1023221169 7:37921066-37921088 CAGGCGCCGCAGCAGTGGGAGGG + Exonic
1024069490 7:45774409-45774431 CAGGGGTACCAGGATTAGGTTGG + Intergenic
1024210667 7:47200631-47200653 CAGTGGCCCCAGCTGCATGTAGG + Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1026507452 7:70997439-70997461 CTGGGGCCCCAGCAATACATGGG - Intergenic
1026718085 7:72807430-72807452 CAGGGGCCCCAGAAGGACTTTGG - Intronic
1027337698 7:77171499-77171521 CAGGGAGCTCAGCAGTGGGTAGG - Intronic
1029778036 7:102699305-102699327 CAGGGAGCTCAGCAGTGGGTAGG + Intergenic
1032046881 7:128618713-128618735 CAGGGGTACCAGGATTAGGTTGG + Intergenic
1034204344 7:149302584-149302606 AAGGGGCCCCAGCAGCAAGTAGG - Intergenic
1034825225 7:154256320-154256342 CAGGGGCCCCTGCAGAAGGCAGG + Intronic
1034875638 7:154722615-154722637 CAGGGGCGGCAGCAGGAGGCAGG + Intronic
1034890023 7:154831340-154831362 CAGTGGCCCCTGGAGTAGGGAGG - Intronic
1034972433 7:155427580-155427602 CAGGGGCTCCAGCATGGGGTGGG + Intergenic
1035129831 7:156641117-156641139 CAGGGGCCCCAGGTGCAGGGTGG + Intronic
1035437517 7:158870169-158870191 CAGGGGCCGCAGCGGTGGGTGGG + Intronic
1035569981 8:666514-666536 GAGGGGCCCCAGCAGGAAGGTGG - Intronic
1035878285 8:3215542-3215564 GAGGGGCCCCAGAAGTGGGCAGG - Intronic
1036528407 8:9556460-9556482 CAGGGGTCCCAGCAGTGAGCGGG + Exonic
1039596946 8:38798766-38798788 CCTGGGCCCCAGCAGTTGTTGGG + Intronic
1040555155 8:48471802-48471824 CAGGGGACTCTCCAGTAGGTTGG + Intergenic
1040556572 8:48484270-48484292 CAGCTTCCCCAGTAGTAGGTGGG - Intergenic
1041771210 8:61474379-61474401 CAGCGGGCTCAGAAGTAGGTAGG + Intronic
1041946574 8:63450379-63450401 AAGGAGCCCAAGCAGGAGGTAGG + Intergenic
1043401909 8:79892071-79892093 GAGGCGCCCCGGCAGGAGGTCGG - Intergenic
1045163074 8:99571065-99571087 CAGGGGCCCCAGATCTAGGTAGG + Intronic
1048876043 8:138837673-138837695 GAGGAGCCCCAGCAGTGGGAGGG + Intronic
1049106428 8:140616661-140616683 CAGGGGCAGCAGCAGTGGGCAGG + Intronic
1049311410 8:141935767-141935789 GAGAGGCCTCAGCAGAAGGTGGG - Intergenic
1049420426 8:142513995-142514017 CAGGGGTCCCAGCAGGAGTGAGG + Intronic
1052864090 9:33454469-33454491 CAAGGGCCCCACCGGGAGGTGGG - Intergenic
1056753605 9:89368587-89368609 CAGGGGCCCCAAGAGGAGGGAGG + Intronic
1057576112 9:96244121-96244143 CAGAAGCCACAGCAGCAGGTGGG + Intronic
1057836003 9:98445791-98445813 CAGGGGCACCTGCAGCAGCTGGG + Intronic
1060135597 9:121150372-121150394 TGGGGGCCCCAGCAGGAGGTGGG - Exonic
1060151961 9:121294514-121294536 CCTGGGTCCCAGCACTAGGTGGG + Intronic
1060200373 9:121648928-121648950 CAGGGGCGCCGGCGGGAGGTGGG + Intronic
1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG + Intergenic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1061940967 9:133883597-133883619 CAGGCGGCCCAGCAGCAGGCAGG + Intronic
1062008800 9:134256162-134256184 AAGGGGGCCCGGCGGTAGGTAGG + Intergenic
1185863820 X:3604640-3604662 CAGGGGCCCCAGAAGCACGTTGG + Exonic
1186457075 X:9718132-9718154 CTGGGTCACCAGCAGTGGGTAGG + Exonic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1192197520 X:69038426-69038448 CTGGGGCCATGGCAGTAGGTGGG - Intergenic
1192206179 X:69097976-69097998 CATTGGCCACAGCAGTAAGTAGG - Intergenic
1192298712 X:69878344-69878366 CAGGGGCCCCAGAAGCACGTTGG + Intronic
1194810246 X:98380257-98380279 CAGGGTGCCCAGCAGCAGGCTGG - Intergenic
1194895269 X:99432466-99432488 CAGGGGCCCGAGCTGTACCTGGG - Intergenic
1197280888 X:124534656-124534678 CAGGGGATCTAGCAGCAGGTGGG + Intronic
1199086266 X:143633895-143633917 CAGGGGCCCAAGCAGCAGCCTGG + Intronic
1199097286 X:143758002-143758024 CAGGGGCACCAGCAGTACCTGGG + Intergenic
1199540062 X:148948756-148948778 AAGGGGCCCCAGGTGTAGGAGGG - Intronic
1200800336 Y:7381256-7381278 CAGGGGCCCCAGAAGCACGTTGG - Intergenic
1201668313 Y:16485427-16485449 CAGGGGCCCCAGGAAAAGATGGG - Intergenic