ID: 1149992597

View in Genome Browser
Species Human (GRCh38)
Location 17:61391248-61391270
Sequence GCCCTTCAGGTTGATGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149992587_1149992597 17 Left 1149992587 17:61391208-61391230 CCAGGGAGGCAGAGGAGGAGGAG 0: 2
1: 4
2: 44
3: 569
4: 8386
Right 1149992597 17:61391248-61391270 GCCCTTCAGGTTGATGCTGAGGG 0: 1
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149992597 Original CRISPR GCCCTTCAGGTTGATGCTGA GGG Intronic
902680572 1:18041235-18041257 GCCCCTCAGGATAATGGTGAGGG + Intergenic
903093460 1:20944926-20944948 GCCCTGGAGGTTGAGGCTGCAGG + Intronic
903488813 1:23712029-23712051 GCTCTTTAGGTTGATGTTCAAGG - Intergenic
905653049 1:39669182-39669204 GCCTTTCAGGGTCAGGCTGATGG + Intronic
905656514 1:39689524-39689546 GGCCTTCACTTTGCTGCTGATGG - Intronic
906179372 1:43805182-43805204 GCCCTTCATGTTCTTTCTGAGGG - Intronic
906254228 1:44335264-44335286 GCCCAGGAGGTTGAGGCTGAAGG + Intronic
906320378 1:44812090-44812112 GCCCTGCAGGTGGGTGCTGCTGG + Exonic
906719320 1:47994192-47994214 GCCCGTCTGGGTGATGCTCATGG - Exonic
906995692 1:50791547-50791569 GACCTACAGGGTGATACTGATGG - Intronic
909719308 1:78749310-78749332 GCCATTCAGGTGGATTCTGAAGG + Intergenic
910778101 1:90896348-90896370 GTCCTTCAGGTTGATGCCAGTGG - Intergenic
914437096 1:147670066-147670088 GCCCTCCGGGTTGAGGCTGCAGG + Exonic
915034126 1:152908475-152908497 TCCCTCCAGGTTGAAGGTGATGG - Intergenic
916345747 1:163789439-163789461 GTCCTTCAGCTAGATGCTGCAGG - Intergenic
916517100 1:165528642-165528664 GCCCAGGAGATTGATGCTGAAGG + Intergenic
1065157114 10:22881602-22881624 GTCCTTTATGTTGATGTTGATGG - Intergenic
1065546404 10:26825969-26825991 GCCCTCATGGATGATGCTGAGGG - Intronic
1070312650 10:75284662-75284684 GCCCTTCACCTTCAAGCTGATGG + Intergenic
1070848692 10:79545073-79545095 GCCCTGCAGGTTGTTGCATATGG - Intergenic
1071411181 10:85398280-85398302 CCACTTCATCTTGATGCTGAAGG - Intergenic
1072606161 10:96984538-96984560 GCCCTGCAAGTGGATGCAGATGG + Exonic
1072953971 10:99872791-99872813 GCCCAGCAGGTTGAGGCTGCAGG - Intergenic
1072997032 10:100254580-100254602 TTCCTTCAGGTTTCTGCTGAAGG + Intronic
1075266250 10:121001608-121001630 GCCTTTCAGGATGGTGGTGAGGG - Intergenic
1076852181 10:133098642-133098664 GCCCTTGCGGCTGATGCGGATGG - Exonic
1077299248 11:1839596-1839618 GCCCATCAGGTAGGTGGTGAGGG - Intronic
1077309303 11:1881425-1881447 GGGCTTCAGGCTGAGGCTGAGGG - Exonic
1077551394 11:3202002-3202024 GCCCTACAGGTTGAATCTGCTGG - Intergenic
1077848048 11:6046580-6046602 GGCCTCCAGGTGGATGGTGATGG + Intergenic
1080428058 11:32174082-32174104 GCCCTGGAGGTTGAGGCTGCAGG - Intergenic
1081529133 11:43945891-43945913 ACCCTTCAGGTAGGGGCTGAAGG - Intergenic
1083214701 11:61211083-61211105 TCCGTTCATGGTGATGCTGAGGG - Exonic
1083217585 11:61229912-61229934 TCCGTTCATGGTGATGCTGAGGG - Exonic
1083220583 11:61249662-61249684 TCCGTTCATGGTGATGCTGAGGG - Exonic
1083733816 11:64668455-64668477 GCCCATGAAGTTGTTGCTGACGG + Exonic
1084373358 11:68759648-68759670 GTCCTCCAGGTTGCTGATGACGG - Exonic
1085599614 11:77843449-77843471 GCCTTCCAGCTAGATGCTGAGGG + Intronic
1085627133 11:78082176-78082198 GCACTTCAGGTTGGGACTGAAGG - Intergenic
1086948296 11:92866037-92866059 GGCCTTTAGGATGATGCTCATGG - Intronic
1089310823 11:117557103-117557125 GCACTTCATGGTGATGCTGAAGG + Intronic
1089346520 11:117795138-117795160 GTCCTTCAGGTATTTGCTGAGGG + Intronic
1089419861 11:118323479-118323501 GACCTTGAAGATGATGCTGATGG + Intergenic
1090347672 11:126084129-126084151 TCTCTGCAGGATGATGCTGAGGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092531159 12:9346771-9346793 TCCTTTCAGGTGGATACTGAGGG + Intergenic
1095444804 12:42272942-42272964 CCCCATCAGGTTGCTGCTGCTGG + Intronic
1096513691 12:52145283-52145305 GGACTTCAGGCTGAGGCTGAGGG + Intergenic
1103348224 12:120265333-120265355 GCCCTTCTGGGAGATGGTGATGG + Intronic
1115912838 14:38275474-38275496 GCCCTTCATTTTCATGCAGATGG - Intergenic
1118573511 14:67218595-67218617 GTCCTGCAGGTTGCTCCTGACGG - Intronic
1119836208 14:77751368-77751390 GCCATTCAGGTGGATTCTGAAGG - Exonic
1122060766 14:99135306-99135328 GCCCTGCAGAATGATGCTGTTGG - Intergenic
1123716145 15:23033988-23034010 GCCCTTTTGGGGGATGCTGAAGG - Intronic
1124441066 15:29686776-29686798 ACCCTACAGGTTGCTGCTGCTGG - Intergenic
1132536257 16:482620-482642 CCCCTTCAGGTTGCAGCTCAGGG - Exonic
1132851235 16:2025970-2025992 GTGCTTCAGGTAGAGGCTGAGGG + Intronic
1135549811 16:23389488-23389510 GTCCTTCAGACTGGTGCTGAAGG - Intronic
1135984878 16:27176733-27176755 GCCCTGGAGGTTGAGGCTGCAGG + Intergenic
1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG + Intergenic
1136871030 16:33808481-33808503 GCACTGCAGGATGAGGCTGAGGG - Intergenic
1137894292 16:52194512-52194534 GACCTGCAGATTGATGCTGGAGG + Intergenic
1139668514 16:68475177-68475199 ACCCTTCAGGTTGGGGCTGTTGG - Intergenic
1141033947 16:80612163-80612185 GCCCTCCAGGGTGATGCTTCTGG + Intronic
1141509039 16:84500828-84500850 GCTCTTCGAGTTGATGCAGAGGG - Intronic
1203101142 16_KI270728v1_random:1307577-1307599 GCACTGCAGGATGAGGCTGAGGG + Intergenic
1142558894 17:798363-798385 GCCCTGCAGGTGGAGGCTGGGGG - Intergenic
1145819210 17:27818422-27818444 GGCCCTCAGGTTGATGCTGGAGG - Intronic
1145893646 17:28437563-28437585 GTCCTTCAAGTTCAAGCTGAAGG - Intergenic
1147415610 17:40287495-40287517 GCCCATCAGGATGATGCAAATGG + Intergenic
1149479188 17:56987906-56987928 GCAGTTCAGGTTTATGCTGATGG - Intronic
1149660801 17:58333079-58333101 GCCCTGCAGGCTGAGGCTGCAGG - Intergenic
1149992597 17:61391248-61391270 GCCCTTCAGGTTGATGCTGAGGG + Intronic
1151518207 17:74610957-74610979 GACATTCATGTTGATGTTGAAGG - Exonic
1151568715 17:74915402-74915424 ACCTTTCTGATTGATGCTGAGGG + Intergenic
1152261033 17:79267295-79267317 CCCCTTCAAGCTGATGGTGATGG + Intronic
1153023140 18:649522-649544 GCCTTTCACGATGATGATGATGG - Intronic
1153690254 18:7585196-7585218 ACTATTCAGGTTGATGCAGAGGG + Intronic
1154194413 18:12254948-12254970 GCCCTCCAGGTTGGTGGTGCTGG + Intronic
1157873935 18:51254354-51254376 GCCCGTCAGGATGATGCCCATGG + Intergenic
1158513288 18:58110180-58110202 GCCTTTCATGTGGAGGCTGAGGG + Intronic
1159554102 18:69927133-69927155 GCCCTTCAGAAAGATGTTGAAGG + Intronic
1161224317 19:3136143-3136165 GCCCGACAGGTTGACGGTGAAGG - Intergenic
1161390320 19:4017197-4017219 GGCCTTCAGGTTGAAGAGGAGGG + Intronic
1161840180 19:6675278-6675300 GGTCTGCAGGTTGATGGTGATGG + Intergenic
1164753147 19:30670750-30670772 GCCCTTCAGGCAGGTTCTGAAGG + Intronic
1166120862 19:40685524-40685546 GCCCTGAAGGTTGTTGCTGAAGG + Intronic
1167497584 19:49828626-49828648 GCCCTACAGGGTGAGGCTGGAGG - Intronic
925491033 2:4393520-4393542 GCCCAGGAGGTTGATGCTGTAGG - Intergenic
926388125 2:12358948-12358970 TGCCTTCAGATGGATGCTGAGGG - Intergenic
929385891 2:41406212-41406234 GGCCTTAAAGTTGATGCTTACGG + Intergenic
931131111 2:59337051-59337073 GTACTTCAGGTTGATTCAGATGG - Intergenic
931386347 2:61801134-61801156 GGCCTTAGGGTTGATGCTCACGG + Intergenic
932138619 2:69255101-69255123 GCCCATGAGGTTGAGGCTGCAGG - Intergenic
934922929 2:98360139-98360161 TTCCTTAAGGTTGCTGCTGAAGG - Intronic
935760512 2:106316386-106316408 GCCCTGCAGCTCGATGTTGAAGG - Intergenic
935922692 2:108032577-108032599 CCCCTGCAGGTTGCTGCTGCTGG - Intergenic
937088125 2:119185577-119185599 GCCCTGGAGGTTGAGGCTGCAGG + Intergenic
938291563 2:130153473-130153495 TCTCTTCATCTTGATGCTGAGGG - Intronic
938464988 2:131519490-131519512 TCTCTTCATCTTGATGCTGAGGG + Intergenic
940862517 2:158785501-158785523 GCCCTGGAGGTTGAGGCTGCAGG + Intergenic
941722211 2:168824135-168824157 ACCCTTCAGGATTATGCTTAAGG + Intronic
947731775 2:232435235-232435257 CCCCACCAGGTTGCTGCTGATGG - Intergenic
1170533165 20:17314906-17314928 GCTCTTCAGGAATATGCTGATGG + Intronic
1172536023 20:35674005-35674027 GCCCTTCAGGCTGGTGCAGATGG - Intronic
1173524839 20:43723967-43723989 GCTTTGCAGGTTCATGCTGAGGG - Intergenic
1174352968 20:49981592-49981614 GCCCTTCAGGTTGGTGGTGGTGG + Intergenic
1174587103 20:51617859-51617881 GCACTACAAGTTGCTGCTGATGG - Intronic
1176293606 21:5059158-5059180 GCACTTGAGGTGGATGGTGAGGG - Intergenic
1178023042 21:28431845-28431867 GCCCATCACGTTGAAGCTGTGGG - Intergenic
1179545352 21:42109610-42109632 GCCCTCCAGGTTGATGCACCAGG - Exonic
1179863654 21:44204490-44204512 GCACTTGAGGTGGATGGTGAGGG + Intergenic
1180179651 21:46112213-46112235 GCCCTGCAGGTTCTTGATGAAGG - Exonic
1181025226 22:20123963-20123985 GCCCTTGAGGGCGATGCAGAGGG + Intronic
1182013938 22:27023256-27023278 GCCCTTCATGTTGATGGGGCCGG - Intergenic
1182946692 22:34330878-34330900 GCCCTGCTGGCTGATGCTGCTGG - Intergenic
1184287789 22:43481760-43481782 GGCCTTCAGCTTGAGGGTGAAGG - Intronic
1184955524 22:47883666-47883688 GACTTTCAGGTTGAAGATGAGGG - Intergenic
1185394638 22:50580503-50580525 GCCCTTCCAGTAGTTGCTGAGGG - Intronic
951233668 3:20209814-20209836 GCCCTTCAGGACTATGTTGATGG + Intergenic
951313616 3:21161120-21161142 GCCATTCAGATTGGTGCTGTAGG - Intergenic
951609849 3:24479757-24479779 GCCCTGCTGGTAGATGCTGCTGG + Intronic
953164547 3:40453251-40453273 GCTCTTCAGGTAGAGGCCGAAGG + Intergenic
954580007 3:51698106-51698128 TCCCTTCAGCTGGCTGCTGAGGG + Intronic
955766896 3:62354423-62354445 GCCCTGCAGGTGTTTGCTGAAGG + Intergenic
956681594 3:71785959-71785981 GCCGTTCAGGGTGATGCCAAAGG + Intergenic
964698348 3:159535431-159535453 GCCCTCAAGGCTGATGCTCAGGG - Intronic
965906672 3:173716549-173716571 CCCATTCAGGTTTATCCTGAGGG + Intronic
966385680 3:179395260-179395282 GCACTACAGGTTGAAGCAGAGGG - Intergenic
969431277 4:7156105-7156127 CCATTTCAGGGTGATGCTGATGG + Intergenic
969676322 4:8616392-8616414 CCACTGCAGGCTGATGCTGAGGG + Intronic
970251756 4:14124047-14124069 GCACTACAGGTTCATGCTAATGG - Intergenic
971527595 4:27640397-27640419 GCCTTTCAGGTTTTTGATGATGG - Intergenic
974431060 4:61796497-61796519 GCCCTGAAGGTAGATTCTGAGGG + Intronic
976696435 4:87923460-87923482 ACGCTTCGGGTTGATACTGAGGG - Intergenic
977577913 4:98694281-98694303 GCCCTTCACCTGGATGCAGATGG - Intergenic
978317214 4:107451789-107451811 GCCCTTCTGGTTTATGGAGAGGG - Intergenic
978869199 4:113555314-113555336 GAACTTCAGGTTGGAGCTGATGG + Intronic
980917253 4:139045194-139045216 GCTGTTCAGGTTGAGGCTGGAGG - Exonic
984513628 4:180710700-180710722 GCCTTAAAGGTGGATGCTGACGG + Intergenic
985663084 5:1166965-1166987 GCCCATCAGGTTGATGCCAGGGG + Intergenic
985815453 5:2124942-2124964 CCTCTGAAGGTTGATGCTGATGG - Intergenic
986702794 5:10427959-10427981 GCCCTGCAGGCTGATGCAGGAGG + Intronic
992319732 5:75601722-75601744 GCCCTTCAGTCTGTGGCTGAAGG - Intergenic
992750731 5:79858076-79858098 ACCCTGCATGTTGATGCTGGTGG - Intergenic
993738632 5:91508272-91508294 GACCTTCAGGTTAATGCCTAAGG - Intergenic
996769858 5:127074217-127074239 GCCTTTCAGGTTTGTGCTAAGGG + Intergenic
997827513 5:137120057-137120079 GCCCTCCACCCTGATGCTGAGGG - Intronic
1000583547 5:163065083-163065105 GACCTGCAGGCTGATGCTGGAGG + Intergenic
1002582082 5:180215109-180215131 GGCCGTCAGGTTGTAGCTGAGGG + Intergenic
1005179640 6:23089975-23089997 GCCCTCCAGGTTGATGCAAAGGG + Intergenic
1006258883 6:32852588-32852610 GCCCTCCAGGATAATGGTGAGGG - Intronic
1006341154 6:33447834-33447856 TCCCTTCAGGCTGATGCTGGTGG + Exonic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1007151538 6:39697366-39697388 GCCTATCAGGTTGGTGCTGTCGG + Intronic
1007904816 6:45448852-45448874 GCCCTTCAAGGAGATGATGAAGG + Intronic
1008959958 6:57256306-57256328 GCCCTGTAGGGTGATGGTGAGGG - Intergenic
1009198158 6:60711973-60711995 GCCCTTCAAAATGATGCTCAAGG - Intergenic
1015573025 6:134641538-134641560 GCCCTTCAGCTACATTCTGAAGG - Intergenic
1018812365 6:167307233-167307255 GCCCTCCAGGCTGAGGCTGCGGG + Intronic
1018864174 6:167734705-167734727 CCCCTTCAGTGTGATGCTGTGGG + Intergenic
1020977673 7:15027052-15027074 GCTCTCCAGGTTGTTTCTGACGG + Intergenic
1023586510 7:41736508-41736530 GCCCTACATGTATATGCTGATGG - Intergenic
1023615880 7:42018954-42018976 GCCCTGCAGGGTTATGCTGCTGG + Intronic
1024526486 7:50354012-50354034 GCCCTCCAGGATGATGCTATGGG - Intronic
1028902920 7:96121210-96121232 GCCTTTGAGGTAGATACTGATGG + Exonic
1033220109 7:139522228-139522250 GCACTTTAGGTAGATGCTGCGGG + Intergenic
1034201593 7:149286034-149286056 GTCCTTCTGGCTGCTGCTGAGGG + Intronic
1034573768 7:151979872-151979894 TCCCTTCAGTTTGATGTTGGTGG - Intronic
1038680096 8:29658791-29658813 GCCCTTCAGGTTCATGGAGGGGG - Intergenic
1044886611 8:96785099-96785121 GCACTTCTGGTTGATACTGTTGG + Exonic
1048907678 8:139104252-139104274 GCCCTTCAGTCTGTGGCTGAAGG + Intergenic
1049092224 8:140524825-140524847 GCCCTGCTGGTTGGTGCTGTGGG + Intergenic
1049161233 8:141099289-141099311 GCCCTCCAGGTGGATGGTGTTGG - Intergenic
1050498307 9:6267280-6267302 GGCCTTCAGTCTGAGGCTGAAGG - Intergenic
1051923943 9:22300120-22300142 TTACATCAGGTTGATGCTGATGG + Intergenic
1053146616 9:35716478-35716500 GCCATCAAGGCTGATGCTGAGGG - Exonic
1062027589 9:134347639-134347661 GCCCTCCAGGGGGATGCTGCGGG + Intronic
1062115306 9:134805351-134805373 GGCCTTCAGGGAGATGCGGACGG + Intronic
1186734657 X:12448905-12448927 TCCCCTCTGGTTGATGCTTAAGG + Intronic
1188598943 X:31937255-31937277 GTCTTTCAAATTGATGCTGAAGG - Intronic
1191148008 X:57189578-57189600 GTCCTTTATGTTGATGTTGATGG + Intergenic
1193514233 X:82444460-82444482 GACCTTCAGTTTGAAGCTGAAGG + Intergenic