ID: 1149992787

View in Genome Browser
Species Human (GRCh38)
Location 17:61392128-61392150
Sequence ACCAGCAACCTGCTTCTGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149992784_1149992787 -3 Left 1149992784 17:61392108-61392130 CCGACTGGCTTCCCGTAGGTACC 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992781_1149992787 4 Left 1149992781 17:61392101-61392123 CCTCTTCCCGACTGGCTTCCCGT 0: 1
1: 0
2: 0
3: 34
4: 346
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992775_1149992787 26 Left 1149992775 17:61392079-61392101 CCAATGAGAGCCAGCCCCTCAGC 0: 1
1: 0
2: 0
3: 17
4: 179
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992780_1149992787 10 Left 1149992780 17:61392095-61392117 CCTCAGCCTCTTCCCGACTGGCT 0: 1
1: 0
2: 6
3: 61
4: 412
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992783_1149992787 -2 Left 1149992783 17:61392107-61392129 CCCGACTGGCTTCCCGTAGGTAC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992774_1149992787 29 Left 1149992774 17:61392076-61392098 CCACCAATGAGAGCCAGCCCCTC 0: 1
1: 1
2: 1
3: 14
4: 197
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992779_1149992787 11 Left 1149992779 17:61392094-61392116 CCCTCAGCCTCTTCCCGACTGGC 0: 1
1: 0
2: 2
3: 18
4: 197
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992777_1149992787 12 Left 1149992777 17:61392093-61392115 CCCCTCAGCCTCTTCCCGACTGG 0: 1
1: 0
2: 3
3: 20
4: 204
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992773_1149992787 30 Left 1149992773 17:61392075-61392097 CCCACCAATGAGAGCCAGCCCCT 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125
1149992776_1149992787 16 Left 1149992776 17:61392089-61392111 CCAGCCCCTCAGCCTCTTCCCGA 0: 1
1: 0
2: 1
3: 51
4: 448
Right 1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149992787 Original CRISPR ACCAGCAACCTGCTTCTGAC TGG Exonic
900678536 1:3903438-3903460 AACAGCAACCGGCATCTGACAGG - Intergenic
901128031 1:6943075-6943097 ACCAGCAACCTGCTTGTGGCTGG + Intronic
902627724 1:17686491-17686513 ACCAGCCACTTCCTTCTGAATGG - Intronic
904470437 1:30732462-30732484 AGCAGCAACAAGCTTCTGTCTGG - Exonic
904979771 1:34489073-34489095 ATGAACAACCTGCTTCTGAATGG + Intergenic
906695446 1:47820316-47820338 ACCAGCACCCTGCTGCTGAAAGG - Intronic
908892460 1:68862513-68862535 CCCAGCAATCTGATTCTGATAGG - Intergenic
912472454 1:109914964-109914986 GACAGCAACCTGATTCTGCCTGG - Intronic
912794759 1:112686045-112686067 AGCAGTTACCTGCTTCAGACAGG + Intronic
1063224023 10:3997777-3997799 CCCTGAAACCTGCTTTTGACAGG + Intergenic
1063506076 10:6600797-6600819 ACCAGCAGCCTCCTTGTGAATGG - Intergenic
1063687325 10:8249523-8249545 TCCACCACCCAGCTTCTGACTGG + Intergenic
1065385481 10:25129548-25129570 ACCAGCAACCTTTTTCTGATGGG - Intergenic
1065574727 10:27105756-27105778 ACCAGGACCTTGCTTCTGCCAGG + Intergenic
1071488020 10:86115760-86115782 ACCAGCAGGCTCCTTCTGCCAGG - Intronic
1075520421 10:123140341-123140363 CCCAGGCACCTGCTTCTGTCGGG - Intergenic
1075740700 10:124694310-124694332 CCCAGCAACCTGCTTTCTACCGG - Intronic
1076014035 10:127013583-127013605 ACCAGAAGCCTGCCTCTGCCAGG + Intronic
1077772274 11:5232997-5233019 ACCAGCCACCACCTTCTGATAGG + Exonic
1080058726 11:27934289-27934311 AGCTGCTACTTGCTTCTGACTGG - Intergenic
1082761915 11:57135805-57135827 ACCAGCAACTTGCTGCAGAGAGG + Intergenic
1085738010 11:79056339-79056361 AACAGCACCTTGCTTCTGAAAGG - Intronic
1090258142 11:125300065-125300087 ACCAGCATCCTGCACCTGTCTGG + Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1092604705 12:10105740-10105762 AACAACAACCTGCTCCTGAATGG + Intronic
1093096065 12:14973583-14973605 GCCAGCACCCTGCTTCAGAATGG - Intronic
1095487879 12:42703343-42703365 ACCACCCACCTGATTCTGCCAGG + Intergenic
1096444784 12:51679591-51679613 ACCAGCAAGCTTTTTCTGAAAGG - Intronic
1097694714 12:62764992-62765014 ACCTGCAAGGTCCTTCTGACTGG - Intronic
1105787194 13:23761177-23761199 ACCAGCAACTTGCCTCTCAGTGG + Intronic
1107973009 13:45662277-45662299 AACAGGAACCAGCTGCTGACTGG + Intergenic
1111557979 13:89906291-89906313 ACAAGCAACAGGTTTCTGACAGG - Intergenic
1111682587 13:91461801-91461823 ACCAACACCCTTCTTCTGCCTGG - Intronic
1112909453 13:104463347-104463369 CCCAGCAACATGCTTCTACCTGG + Intergenic
1117287611 14:54302077-54302099 ACCTGCACTCTGCTTCTGCCTGG - Intergenic
1119517451 14:75259260-75259282 CCCAGCAACAGGCTTCTGATTGG + Intronic
1121270370 14:92633532-92633554 GCCACCAGCCGGCTTCTGACTGG - Intronic
1121602363 14:95214948-95214970 ACCAGCTCTCTCCTTCTGACAGG + Intronic
1122356207 14:101124414-101124436 AGCACCCACCTGCTTCTGGCAGG + Intergenic
1127830615 15:62747741-62747763 ACCAACAGCCTACTGCTGACTGG + Intronic
1130063309 15:80584830-80584852 CCCAGCCTCCTGCTTCTGGCTGG + Intronic
1140235043 16:73151441-73151463 TCCTCCAACCTGCCTCTGACTGG - Intergenic
1142805728 17:2370149-2370171 CCGAGCAAACTGCTGCTGACAGG + Intronic
1142888506 17:2928331-2928353 TCCTGCAATCTGCTTCTGTCCGG + Intronic
1143987848 17:10930523-10930545 GCCAGCAAGCTGCATATGACAGG + Intergenic
1144730245 17:17521941-17521963 GCCAGCATCCACCTTCTGACTGG + Intronic
1146408266 17:32558755-32558777 ACCAGTACCCTACATCTGACAGG + Intronic
1148895216 17:50835592-50835614 GCCAGCAGCCTGCCTGTGACAGG + Exonic
1149656029 17:58309994-58310016 GCCAGCAACCTGCTTCTGGAAGG + Exonic
1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG + Exonic
1152021121 17:77780847-77780869 ACCAGCACCCTGCTCCTGTGGGG - Intergenic
1160384162 18:78484996-78485018 ACCTGCAACCTCCTCCTGATGGG + Intergenic
1164143263 19:22493255-22493277 CCCAGCACGCTGCTTCTGACAGG + Intronic
1165445036 19:35851875-35851897 GCCAGCCACCTGCGTCTGTCTGG + Intronic
926069979 2:9879586-9879608 ACTAGCAACCTCCTTCTACCCGG - Intronic
928197977 2:29228713-29228735 GCCAGCACCCTGCCTCTGGCTGG + Intronic
928706931 2:33959989-33960011 ACAGGCAGCCTGCTTATGACTGG + Intergenic
929980474 2:46674508-46674530 AACAACAAGCAGCTTCTGACAGG - Intergenic
930745761 2:54881852-54881874 ACAATTAACCTGCTTCTGGCTGG + Intronic
932638498 2:73415731-73415753 TCCAGCAACGTGCTGCTGATTGG + Intronic
932968593 2:76509817-76509839 AACATCAAGCAGCTTCTGACTGG + Intergenic
934896039 2:98121117-98121139 ACCAGCAAGCTGTTTAAGACAGG - Intronic
935831273 2:107003102-107003124 ACCAGCCACCTGTTTCTGTATGG - Intergenic
936444953 2:112587909-112587931 ACCAGCAACCAGCCTCTCTCTGG + Intronic
939861484 2:147426130-147426152 ATTAGCTACCTGCTTTTGACAGG - Intergenic
946019943 2:216633945-216633967 ACCTGCAACCTGCTCCGGGCTGG - Exonic
948967090 2:241391279-241391301 AGAAGCAACCTGCTACTAACTGG - Intronic
948982424 2:241501178-241501200 ACCAGCCACCTGCTCCTCACAGG + Intronic
1169207620 20:3749091-3749113 AACTCCAACCTGCTCCTGACTGG - Intronic
1169882889 20:10366730-10366752 ACCAGCACCATGCTTCTTAAAGG + Intergenic
1170550054 20:17468773-17468795 ACCAGCATCCTGCTATAGACGGG + Intronic
1173449877 20:43153903-43153925 ACAAGCCACCTGATTCTGAGAGG - Intronic
1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG + Intronic
1173927960 20:46794681-46794703 ACCTGCAACCTGCTTCTAGGCGG + Intergenic
1174687687 20:52471297-52471319 TCCAAGAAGCTGCTTCTGACTGG - Intergenic
1175628740 20:60513139-60513161 ACCATCACCATGCTTATGACAGG + Intergenic
1176106893 20:63393663-63393685 TGCAGCCACCAGCTTCTGACGGG - Intergenic
1183255511 22:36759108-36759130 ACCTGCAGGCTGCTTCTCACAGG - Intronic
1184327213 22:43798021-43798043 CCCAGCAATCTGTTTCTAACAGG - Intronic
1185388138 22:50545893-50545915 ACAGCCAACCTGCTTCTGCCTGG - Intergenic
1185414235 22:50701042-50701064 AACAGGAACCTGCTTCCAACAGG + Intergenic
951732690 3:25827613-25827635 ACCAGCTGCCTGCTTCTAATTGG + Intergenic
954446386 3:50549139-50549161 TCCAGCAACCTGGCTGTGACTGG - Intergenic
959105710 3:102062819-102062841 ATCACCAACATGCTTCTGAAGGG - Intergenic
962372132 3:134829414-134829436 ACCAGCAAACAGCTTTTGAGAGG - Intronic
964700304 3:159558399-159558421 AGCAGCAACCTGCTTCTTCTAGG + Intronic
965700286 3:171453649-171453671 ACCACCAGCCTTCTTCTGACTGG - Intronic
968751684 4:2393167-2393189 ACCAGCAACCTGCATTCCACGGG - Intronic
969080156 4:4611784-4611806 AGCAGCAAACTGATTCTGTCTGG + Intergenic
969281795 4:6175693-6175715 ACCAGCACCCTGCTCGTGCCTGG + Intronic
982054025 4:151529567-151529589 ACCATCAACCTGCTAGTCACAGG - Intronic
984342187 4:178471372-178471394 ACCAGCAACATGGTTCTCACCGG + Intergenic
988434284 5:31155492-31155514 ACCAGCATCCTCCTTATGTCAGG - Intergenic
988854551 5:35215232-35215254 ACCAGCAACATGCTTCTGGTTGG - Intronic
990287354 5:54312755-54312777 AGAAGCCACCTGCTTCTGAGTGG - Intergenic
990572696 5:57094950-57094972 CCTAGCAACCTGTTTCTGCCTGG + Intergenic
993077799 5:83256181-83256203 CCCATCAGCCTGCTTCTGGCCGG + Intronic
997283941 5:132665128-132665150 ACCTTCCACCTGCTTCTGAAAGG + Intergenic
999582833 5:153058707-153058729 ACCAGGTACCTGCTTGTGCCAGG - Intergenic
1001447463 5:171796894-171796916 CCCATCACCCTGCTTCTCACAGG - Intergenic
1003217193 6:4125151-4125173 ACATGTAACCTGCTTATGACTGG + Intronic
1006790376 6:36697501-36697523 CCCATCAACCTGCTGCTGTCTGG + Intergenic
1008086751 6:47253424-47253446 AGCAGCAACCTCCCTCTCACTGG + Exonic
1008535286 6:52502726-52502748 ACCAGCCCCAGGCTTCTGACCGG + Exonic
1009186619 6:60581729-60581751 AACAACAACCTGCTCCTGAATGG + Intergenic
1010564617 6:77394584-77394606 AAAAGGAACCTGCATCTGACAGG - Intergenic
1010634141 6:78235660-78235682 GCCTGCAACCTGCCTCTTACAGG + Intergenic
1011624558 6:89272564-89272586 ACCAGCAACCTGCATCTATCAGG + Intronic
1011972905 6:93250511-93250533 AACAGCTACCTGATACTGACTGG - Intronic
1014617347 6:123619493-123619515 ACCAGCAACCTGGATATGTCTGG + Intronic
1016613757 6:146024160-146024182 CCCAGCAACCAACTTCTGCCTGG - Intergenic
1022632754 7:32101193-32101215 ACCAGCAAAGTTCTTCTCACAGG + Intronic
1024563161 7:50661071-50661093 ACCAGCAAACTGCTCGGGACAGG + Intronic
1028063309 7:86348698-86348720 ATAAGATACCTGCTTCTGACTGG - Intergenic
1029517282 7:101033142-101033164 ACCACCAGCCTGGTGCTGACAGG - Exonic
1029517456 7:101034735-101034757 ACCACCAGCCTGGTGCTGACAGG - Exonic
1033492711 7:141860042-141860064 ACCAGCAGCCTGCCTCAGACTGG - Intergenic
1035864714 8:3069848-3069870 ACCTGCAACAGGCTTCTGCCTGG + Intronic
1036924945 8:12895414-12895436 ACCGGCACCCTGCTTGTTACTGG - Intergenic
1037540271 8:19864219-19864241 AGCAGCCTCATGCTTCTGACTGG + Intergenic
1037835500 8:22212778-22212800 ACCAGCACTCAGCATCTGACCGG - Intergenic
1041368687 8:57135984-57136006 TCCAGCAACCCTCTGCTGACTGG - Intergenic
1043428761 8:80174087-80174109 ATCAGAGACCTGCTTCTTACTGG + Intronic
1047888073 8:129275001-129275023 AGTAACAACCTGCTTCTGAGTGG - Intergenic
1049684879 8:143935313-143935335 ACCAGCCACCTGCTTGTCCCAGG - Exonic
1051221185 9:14850124-14850146 ACCAGCAACTTGATTCAAACAGG - Intronic
1051257182 9:15226458-15226480 ATCTGCAACATGCTGCTGACTGG + Intronic
1051448839 9:17172176-17172198 TCCAGCAACCTGCTCCTCAGAGG - Intronic
1053367426 9:37533098-37533120 ACCAGCAACCTGCTAATAAAGGG + Intronic
1056796428 9:89662031-89662053 CACAGGAACCTGCTTCTGCCTGG + Intergenic
1057463186 9:95285718-95285740 ACCAGAAACCTGCATATGAGTGG - Intronic
1057550387 9:96047805-96047827 CCCAGCGAACTGCCTCTGACTGG - Intergenic
1185875839 X:3701715-3701737 ATCAGCAAGCTCCTTATGACCGG - Intronic
1191595101 X:62935144-62935166 ATCAGCAGCCTGCTTCTAATAGG - Intergenic
1192229396 X:69254769-69254791 ACCTGCAACCTGTATCTTACAGG + Intergenic
1194656051 X:96575093-96575115 ACTAGCAACTTGCTTCTAAAGGG - Intergenic
1195635912 X:107115922-107115944 ACCAGGAAACTGCTTCTCTCAGG - Exonic
1196975986 X:121158199-121158221 AGCTCAAACCTGCTTCTGACAGG - Intergenic
1197827072 X:130601111-130601133 ACCAGCAGCCTGCTCCTCTCAGG + Intergenic