ID: 1149993330

View in Genome Browser
Species Human (GRCh38)
Location 17:61394713-61394735
Sequence GAGGCCGGTGGGAGCCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149993323_1149993330 20 Left 1149993323 17:61394670-61394692 CCTCTCAATTTGATGAAGGAAAA No data
Right 1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG No data
1149993326_1149993330 -6 Left 1149993326 17:61394696-61394718 CCTTCATGATCTGGAAAGAGGCC No data
Right 1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149993330 Original CRISPR GAGGCCGGTGGGAGCCAGCG TGG Intergenic
No off target data available for this crispr