ID: 1149994651

View in Genome Browser
Species Human (GRCh38)
Location 17:61400173-61400195
Sequence CCCGATGAGAGAGCCGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149994626_1149994651 27 Left 1149994626 17:61400123-61400145 CCGCGCGCCCCCGGCCCCGGCCC 0: 2
1: 5
2: 55
3: 434
4: 2448
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994646_1149994651 -2 Left 1149994646 17:61400152-61400174 CCGGGCGCCTGGGCCGGATGTCC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994628_1149994651 20 Left 1149994628 17:61400130-61400152 CCCCCGGCCCCGGCCCCGGCCCC 0: 11
1: 30
2: 124
3: 772
4: 3357
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994640_1149994651 6 Left 1149994640 17:61400144-61400166 CCCGGCCCCCGGGCGCCTGGGCC 0: 1
1: 1
2: 5
3: 66
4: 575
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994641_1149994651 5 Left 1149994641 17:61400145-61400167 CCGGCCCCCGGGCGCCTGGGCCG 0: 1
1: 2
2: 6
3: 45
4: 445
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994630_1149994651 18 Left 1149994630 17:61400132-61400154 CCCGGCCCCGGCCCCGGCCCCCG 0: 7
1: 112
2: 228
3: 872
4: 3564
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994644_1149994651 0 Left 1149994644 17:61400150-61400172 CCCCGGGCGCCTGGGCCGGATGT 0: 1
1: 0
2: 0
3: 21
4: 79
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994645_1149994651 -1 Left 1149994645 17:61400151-61400173 CCCGGGCGCCTGGGCCGGATGTC 0: 1
1: 0
2: 2
3: 5
4: 128
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994636_1149994651 11 Left 1149994636 17:61400139-61400161 CCGGCCCCGGCCCCCGGGCGCCT 0: 1
1: 1
2: 11
3: 143
4: 937
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994635_1149994651 12 Left 1149994635 17:61400138-61400160 CCCGGCCCCGGCCCCCGGGCGCC 0: 1
1: 2
2: 22
3: 220
4: 1368
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994647_1149994651 -9 Left 1149994647 17:61400159-61400181 CCTGGGCCGGATGTCCCGATGAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994629_1149994651 19 Left 1149994629 17:61400131-61400153 CCCCGGCCCCGGCCCCGGCCCCC 0: 13
1: 109
2: 232
3: 1008
4: 4353
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994631_1149994651 17 Left 1149994631 17:61400133-61400155 CCGGCCCCGGCCCCGGCCCCCGG 0: 4
1: 14
2: 217
3: 779
4: 3525
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994634_1149994651 13 Left 1149994634 17:61400137-61400159 CCCCGGCCCCGGCCCCCGGGCGC 0: 1
1: 2
2: 25
3: 192
4: 1273
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994643_1149994651 1 Left 1149994643 17:61400149-61400171 CCCCCGGGCGCCTGGGCCGGATG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1149994639_1149994651 7 Left 1149994639 17:61400143-61400165 CCCCGGCCCCCGGGCGCCTGGGC 0: 1
1: 0
2: 4
3: 56
4: 527
Right 1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149994651 Original CRISPR CCCGATGAGAGAGCCGGCGC TGG Exonic
908581879 1:65525433-65525455 CGGGAGGAGAGACCCGGCGCTGG - Intronic
910448896 1:87328118-87328140 CCCGAGGGGCGAGCGGGCGCGGG + Intergenic
912315879 1:108667438-108667460 CACGCTGAGGGAGCCGGCTCTGG - Intergenic
914001719 1:143699944-143699966 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914244236 1:145873742-145873764 CCAGATTCGAGAGCAGGCGCAGG - Exonic
914514565 1:148362851-148362873 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
919049835 1:192499459-192499481 CAAGCTGAGAGAGCCGGCTCTGG + Intergenic
919486817 1:198156960-198156982 CCCGAGGAGAGGGGCGGGGCGGG - Exonic
1064155186 10:12897979-12898001 CCTGATGAGTGAGCTGACGCTGG - Exonic
1067450232 10:46377548-46377570 CCCCATGTGAGAGCTGGCTCGGG + Intronic
1067634070 10:47989982-47990004 CCCCATGTGAGAGCTGGCTCGGG - Intergenic
1075376072 10:121978777-121978799 CAGGCTGAGAGAGCCGGCTCTGG + Intergenic
1081773904 11:45665212-45665234 CCCGAGGATGGAGCCGGCGCTGG - Exonic
1083668045 11:64285891-64285913 GCTGATGGGAGAGCCGGCTCAGG - Intronic
1084180091 11:67441808-67441830 CCCGCTGACAGAGCCGGTGGTGG - Exonic
1088250550 11:107858136-107858158 CAGGAAGAGAGAGCCGGCTCTGG + Intronic
1088570828 11:111221940-111221962 CAAGCTGAGAGAGCCGGCTCCGG - Intergenic
1089868984 11:121655943-121655965 CCCAATTATAGAGCCGGGGCTGG - Intergenic
1091119891 11:133048041-133048063 CCCGATGAGAGTGTCTGGGCAGG - Intronic
1102136915 12:110583090-110583112 GCTGAGGAGAGAGCCGGCTCCGG - Exonic
1108418919 13:50228845-50228867 GCAGATGGGAGAGCCGGGGCGGG + Intronic
1110862084 13:80355508-80355530 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
1112538228 13:100282408-100282430 CAAGCTGAGAGAGCCGGCTCTGG - Intronic
1115566613 14:34630123-34630145 TCCGAGGCGAGGGCCGGCGCAGG + Exonic
1116452308 14:45080398-45080420 CAAGCTGAGAGAGCCGGCTCCGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1125715793 15:41819271-41819293 TCTGATGAGAGAGCCGGTCCAGG - Exonic
1130076707 15:80695655-80695677 CCCGAGGAGGGCGCGGGCGCGGG + Exonic
1130247214 15:82262778-82262800 CCCGGTGACAGACTCGGCGCCGG - Intergenic
1130453429 15:84080177-84080199 CCCGGTGACAGACTCGGCGCCGG + Intergenic
1132097660 15:99000011-99000033 CAAGCTGAGAGAGCTGGCGCTGG - Intronic
1132685329 16:1159671-1159693 GTCGATGAGAGAGACGGGGCTGG + Intronic
1136508233 16:30720239-30720261 CCCGGCGAGAGAGGCGGTGCCGG - Exonic
1139868009 16:70079199-70079221 TCCGATGAGAAAGCCGAGGCCGG - Intergenic
1140387327 16:74552654-74552676 TCCGATGAGAAAGCCGAGGCTGG + Intronic
1141624514 16:85254226-85254248 CCCGTTGGCAGAGCCGGCACTGG + Intergenic
1142803508 17:2359664-2359686 CCCGATGGGAGTGCTGGGGCCGG + Intronic
1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG + Exonic
1152015743 17:77749294-77749316 CCCCATGACAGAGCCGCGGCTGG - Intergenic
1152421193 17:80194037-80194059 CCAGATTAGAAAGCCGGGGCAGG - Intronic
1153688234 18:7567348-7567370 GCCGATGACCGAGCCCGCGCCGG - Exonic
1166055619 19:40286514-40286536 CCCTATGAGAGAGGAGGGGCTGG - Intergenic
925927283 2:8679273-8679295 CCGGACGCGAGAGCCGCCGCGGG + Exonic
936385343 2:112023816-112023838 CTCCATGACAGAGCCAGCGCAGG - Intronic
937439335 2:121903270-121903292 CCCGCTGAGGGAGCCAGAGCCGG + Intergenic
947171868 2:227320589-227320611 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
1171386077 20:24770201-24770223 CCAGAGGAGAGAGACGGGGCTGG + Intergenic
1176298132 21:5085234-5085256 CCTGATGACAGAGGCGGGGCCGG + Intergenic
1178882656 21:36461393-36461415 CCCGATGACGGCGCAGGCGCAGG + Exonic
1179858897 21:44176715-44176737 CCTGATGACAGAGGCGGGGCCGG - Intergenic
1180951956 22:19724482-19724504 CCTGAGGAGAGAACCGGCGCTGG + Exonic
1183452902 22:37906385-37906407 CCCGAAGCCAGAGCCGGAGCCGG + Exonic
1183553354 22:38506168-38506190 TCCGACGAGAGAGGCGGCGACGG - Exonic
969362305 4:6672686-6672708 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
976246767 4:83012708-83012730 CCCGCTGCGAGTGCCTGCGCGGG - Intronic
989956798 5:50369401-50369423 CCAGCTGAGGGAGCCGGCTCCGG - Intergenic
993770231 5:91917237-91917259 CAAGATGAGGGAGCCGGCTCCGG - Intergenic
1002642788 5:180638408-180638430 CCCAGTGAGAGAGCAGGGGCGGG - Intronic
1004864346 6:19838192-19838214 CCCGGTGAGAGGCCGGGCGCCGG + Exonic
1004866103 6:19854823-19854845 CCAGCTGAGGGAGCCGGCTCCGG + Intergenic
1006547551 6:34792291-34792313 CCCGGTGAGAGCGCCAGCGCCGG + Exonic
1018734790 6:166679722-166679744 CCAGCAGAGAGAGCCGGCTCCGG - Intronic
1024700684 7:51901292-51901314 CAAGCTGAGAGAGCCGGCTCCGG + Intergenic
1029329223 7:99837550-99837572 CCCTATGAGTGAGCCTGAGCAGG + Intronic
1047702721 8:127465771-127465793 CAAGATGAGAGAGCCGATGCTGG + Intergenic
1050268479 9:3916417-3916439 CCTGATTAGAGAGTTGGCGCAGG - Intronic
1053353502 9:37428597-37428619 CACGCTGTGAGAGCCGGGGCGGG - Intronic
1056746950 9:89311371-89311393 CCGGCTGAGGGAGCCGGCTCGGG - Intronic
1186426106 X:9465255-9465277 CCCGGAGAGAGCGCGGGCGCTGG - Exonic
1188242515 X:27809101-27809123 CAAGCTGAGAGAGCCGGCTCCGG - Intronic
1192657001 X:73003077-73003099 CCCGATGCGCGAGCGGGAGCTGG - Intergenic
1192665119 X:73079924-73079946 CCCGATGCGCGAGCGGGAGCTGG + Intergenic