ID: 1149994810

View in Genome Browser
Species Human (GRCh38)
Location 17:61400844-61400866
Sequence CCGCGGGGCCTCCTCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149994810_1149994814 -9 Left 1149994810 17:61400844-61400866 CCAGCGCAGAGGAGGCCCCGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1149994814 17:61400858-61400880 GCCCCGCGGCTTGGCCCTGGCGG 0: 1
1: 0
2: 1
3: 17
4: 195
1149994810_1149994825 28 Left 1149994810 17:61400844-61400866 CCAGCGCAGAGGAGGCCCCGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1149994825 17:61400895-61400917 CGCTCTCGCTCTTCTGCGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
1149994810_1149994826 29 Left 1149994810 17:61400844-61400866 CCAGCGCAGAGGAGGCCCCGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1149994826 17:61400896-61400918 GCTCTCGCTCTTCTGCGTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149994810 Original CRISPR CCGCGGGGCCTCCTCTGCGC TGG (reversed) Intronic