ID: 1149994810

View in Genome Browser
Species Human (GRCh38)
Location 17:61400844-61400866
Sequence CCGCGGGGCCTCCTCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149994810_1149994826 29 Left 1149994810 17:61400844-61400866 CCAGCGCAGAGGAGGCCCCGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1149994826 17:61400896-61400918 GCTCTCGCTCTTCTGCGTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 117
1149994810_1149994825 28 Left 1149994810 17:61400844-61400866 CCAGCGCAGAGGAGGCCCCGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1149994825 17:61400895-61400917 CGCTCTCGCTCTTCTGCGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
1149994810_1149994814 -9 Left 1149994810 17:61400844-61400866 CCAGCGCAGAGGAGGCCCCGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1149994814 17:61400858-61400880 GCCCCGCGGCTTGGCCCTGGCGG 0: 1
1: 0
2: 1
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149994810 Original CRISPR CCGCGGGGCCTCCTCTGCGC TGG (reversed) Intronic
901652593 1:10751785-10751807 CTGGGAGGCCTCCTCTGCCCTGG - Intronic
901757624 1:11450942-11450964 TCGCGGGGGCTCCTCAGGGCTGG + Intergenic
902770533 1:18643113-18643135 CCTCGGGGCCTCTTTTGAGCTGG - Intronic
906678491 1:47709647-47709669 CCGCGGGGCCGCCCCTCCCCCGG + Intergenic
908260090 1:62333738-62333760 CCATGGGGCCTCGTCTGGGCAGG - Intergenic
909691084 1:78409003-78409025 CCGGGGAGCCTCCTCTGCCTAGG + Intronic
914431727 1:147624867-147624889 CCCCGGGGCCTCATCTGTGGGGG - Exonic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918001656 1:180502662-180502684 CTGTGAGGCCTGCTCTGCGCCGG + Exonic
920385628 1:205568891-205568913 CGGCGGGGGCGCCTCTGCGGCGG - Intronic
923125823 1:231033537-231033559 CAGCGGTGCCTCCCCTGCTCTGG - Intronic
1062875580 10:940540-940562 CACTGGGGCCTCCTCTGGGCAGG - Intergenic
1069557846 10:69409094-69409116 CCCCGGGCCCTCCGCTGCCCAGG - Intronic
1070954350 10:80454508-80454530 CCGCGGGGCCGCTCCTGGGCAGG - Intronic
1071514327 10:86287141-86287163 CCACGGGACCTCCTGTGCCCAGG - Intronic
1071515132 10:86292042-86292064 CCCCAGTGCCTCCTCTGCTCAGG - Intronic
1075263157 10:120980084-120980106 CAGGCGGGCCTCCTCTGGGCGGG - Intergenic
1075574767 10:123570414-123570436 CCCCAGAGCCTGCTCTGCGCTGG + Intergenic
1076724068 10:132405225-132405247 CCGCGGGACCTGCTCTGCCGGGG - Exonic
1076750063 10:132537988-132538010 CCGCGGGGCGTCAGCTGCGCCGG - Exonic
1076871789 10:133198189-133198211 CCTGGGGGCTTCCTCTGTGCTGG - Intronic
1077064988 11:637172-637194 CCGCGGGGGCCCCCCTGAGCCGG + Intergenic
1078469930 11:11578693-11578715 CAGCCGGGCCTCCTGTGCGCAGG + Intronic
1079338100 11:19589049-19589071 CCTCTGTGCCTCCTCTGTGCTGG + Intronic
1081869336 11:46376231-46376253 CTGCGGAGCCTCCTCTGTGCTGG + Intronic
1083989166 11:66236156-66236178 CTGCGGGACCTCCTGTGCACTGG - Intronic
1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG + Intergenic
1085386631 11:76161561-76161583 GCTGGGGGCCTCCTCTGCCCAGG - Intergenic
1089495644 11:118907589-118907611 CCGCGGCGCCACCTCTGCCCAGG + Exonic
1090782650 11:130021534-130021556 TCTCGGGGCCTCCTCTGCCTGGG + Intergenic
1091613970 12:2035117-2035139 GGGCGTGGCCTCCCCTGCGCCGG + Intronic
1096193736 12:49635765-49635787 CCCCAGGTCCTCCTCTGCCCAGG + Intronic
1098275685 12:68808787-68808809 CTGCGGGGCCGCTTCGGCGCGGG + Intronic
1101371811 12:104137822-104137844 CCGCGGCCCCTCCTCGGCCCCGG + Intronic
1101820898 12:108183706-108183728 CCTCGGGGCCTCCTCTCTGTGGG - Intronic
1102587519 12:113933517-113933539 CCGCTGGGCCTCCTTTGGCCCGG - Intronic
1103119887 12:118372157-118372179 CCTCGGGGTCTCCTCTCCCCGGG + Intronic
1104773538 12:131379432-131379454 CCGGGGGGCCTCCCCTGCTGTGG + Intergenic
1106221405 13:27748813-27748835 TCTCGGCGCCTCCTCTGCGTGGG - Intergenic
1106600624 13:31183507-31183529 TCTCGGGGCCTCCTCTGCCTGGG - Intergenic
1107787063 13:43968390-43968412 CCGCGGGCCCTCCGCTGGCCGGG + Intergenic
1108292594 13:48976239-48976261 CCGCGGCGCCTCCTCCGGGGCGG - Intronic
1110874446 13:80491060-80491082 TCTCGGGGCCTCCTCTGCCTGGG - Intergenic
1113076854 13:106475349-106475371 ACGTGGGGCCTCCACTGGGCTGG - Intergenic
1113820570 13:113209626-113209648 CCGCGGGGCCTCGTCCGCCATGG - Exonic
1118766090 14:68910101-68910123 CAGTGGGGCCTCCTGTGAGCCGG - Intronic
1119318372 14:73714179-73714201 GCGCGGGGACTCCTCTGGGCGGG + Exonic
1119764820 14:77181773-77181795 CAGCGGGTCCTCCTCCTCGCCGG - Intronic
1122854852 14:104555089-104555111 CCGCTGTGACTCCTCTGTGCAGG + Intronic
1124264215 15:28219316-28219338 CCGTGGGGCCACCCCTGCCCAGG + Intronic
1125600146 15:40911156-40911178 TCCCTGGGCCTCCTCTGCTCTGG + Intergenic
1129785078 15:78304514-78304536 GAGGGGGGCCTCCTCTCCGCAGG - Intergenic
1132323071 15:100941687-100941709 CCCCTGGCCCTCCTCTTCGCAGG - Intronic
1132572280 16:649354-649376 TCGCGGGGCGTACTCTGCGCTGG + Intronic
1132678151 16:1129208-1129230 CCGCCCGGCCTCCTCGGGGCAGG - Intergenic
1132778519 16:1610524-1610546 CCGCGGGGACTCGGCGGCGCCGG + Intronic
1138560598 16:57798595-57798617 TCGCGGTGCCTCCTCTGTGTGGG - Intronic
1139602977 16:67998077-67998099 TCTCGGGGCCTCCTCTGCCTGGG + Intronic
1139930647 16:70523559-70523581 CCGCGAGGCCCCCTCTTCGTTGG + Exonic
1141522910 16:84593356-84593378 CCTCGGGGTCTCCTGTGCCCTGG - Intronic
1141736860 16:85859803-85859825 CCGAGGGGCCCCCTCTGCAATGG - Intergenic
1142031242 16:87839582-87839604 ACGCGGGGCCCCCTCTGCGTAGG + Intronic
1142247936 16:88978369-88978391 ACCCGGGGCCTCCCCTGCCCTGG + Intergenic
1142293259 16:89202097-89202119 CCGCCCGCCCTCCTCGGCGCTGG + Intergenic
1142851519 17:2707030-2707052 CCAAGGGGCCTCCTCTCCCCAGG + Intronic
1142917536 17:3154147-3154169 CCTCAGGGCCCCCTCTGCCCAGG - Intergenic
1143578478 17:7809383-7809405 CCACGAGGCCTCTTCTGTGCAGG + Intronic
1144781575 17:17810841-17810863 CCGCCGCGCCTACTCTGCACGGG + Exonic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1147819660 17:43234244-43234266 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147821776 17:43246131-43246153 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147822868 17:43252286-43252308 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147825386 17:43267090-43267112 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147826509 17:43273557-43273579 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147827398 17:43278435-43278457 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147828506 17:43284596-43284618 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147829615 17:43290748-43290770 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147831392 17:43300498-43300520 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1149099220 17:52884048-52884070 CCCCGTGGGCTCCTGTGCGCCGG - Intronic
1149347273 17:55751268-55751290 CCGCGGGGCCTAGAATGCGCCGG + Intronic
1149994810 17:61400844-61400866 CCGCGGGGCCTCCTCTGCGCTGG - Intronic
1150137521 17:62703955-62703977 CCGCGTGGCTTCCGCTGGGCAGG - Intronic
1152009013 17:77699410-77699432 CCGCGGGGCCTCCTGCTCCCCGG + Intergenic
1152098975 17:78289881-78289903 CCGCGGGAACTCCTCTGCCCTGG - Intergenic
1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG + Intronic
1152523313 17:80872981-80873003 CCCCGGGGCCTCCTCAGTGGTGG - Intronic
1154128833 18:11717402-11717424 TCTCGGGGCCTCCTCTGCCTGGG - Intronic
1154954680 18:21242402-21242424 CCGCGGGGACTCCGGGGCGCGGG + Intronic
1157334037 18:46724252-46724274 CCAAGGGGCCTCCTCAGCCCAGG - Intronic
1158202876 18:54959490-54959512 CCCCGGGGCCTCACCGGCGCCGG - Exonic
1160053124 18:75455530-75455552 GCCCGGGGCCGCCTCTGCGCCGG + Intergenic
1160791769 19:926634-926656 CCGGGGGCCCCTCTCTGCGCTGG - Intronic
1160832260 19:1109464-1109486 CCGCGGGCCCTCCTCTGGGGGGG + Intronic
1160967638 19:1753623-1753645 CCGCGCGCGCTCCTCAGCGCCGG - Exonic
1161289136 19:3483413-3483435 CCTCCGGGCCTCCCCTGTGCCGG - Intergenic
1162771610 19:12952783-12952805 CTGCGGGGCCTCCTCTCCTATGG - Exonic
1163437295 19:17303182-17303204 CCCCGGGGCCTCCACTTCGGAGG - Intronic
1164625435 19:29724487-29724509 CCCCGGGGCCCCATCTGTGCCGG + Intergenic
1166838387 19:45681582-45681604 CCTCCGCGCCTCCTCTGGGCAGG + Exonic
1167264845 19:48478377-48478399 GGGCGGGGCCTCCTCTGCCCAGG + Intronic
925394081 2:3519615-3519637 CCGTGGGGCCTCCCCCGCGCCGG - Exonic
925913481 2:8588084-8588106 CCACCTGGCCTCCTCTGCTCAGG + Intergenic
925913496 2:8588134-8588156 CCACCTGGCCTCCTCTGCTCAGG + Intergenic
929096408 2:38267095-38267117 TGGCTGGGCCTCCTCTGGGCAGG + Intergenic
930029069 2:47047399-47047421 CCACTGGTCCTCCTCTGCCCTGG - Intronic
932398918 2:71466445-71466467 CCGTGGGGCCTGCTCCGCGGGGG - Intronic
932449757 2:71802034-71802056 CTGTGGGGCCTCTTCTGCTCTGG - Intergenic
938133698 2:128737091-128737113 CCGCGCGGCCGCCTCCGGGCGGG + Intergenic
938583688 2:132669775-132669797 CCTCGGGGCCAGCCCTGCGCTGG - Intronic
941008365 2:160270320-160270342 CCGCGGGGCCCCCCGGGCGCAGG - Intronic
948686227 2:239671325-239671347 CCGCAGAGCCTCCTCAGTGCAGG + Intergenic
1169135608 20:3195312-3195334 CCGCTGGGCCTGCTCCTCGCGGG + Exonic
1172962097 20:38806518-38806540 CCGGGGGCGCTCCTCTGGGCCGG - Intronic
1173258480 20:41412226-41412248 CAGCGTGGCCTCCTCTGCTTTGG + Exonic
1174412240 20:50343672-50343694 CCGCGGGGCGGCCTCTCCACAGG - Intergenic
1175202730 20:57289347-57289369 CAGCGGGGCATCCTCTGCATGGG + Intergenic
1175902916 20:62367036-62367058 CGCCGGGGCCTCCTCTCCGCAGG + Exonic
1176179544 20:63742868-63742890 CCGCGGGGCTTCCTGTGCGGGGG - Exonic
1180177713 21:46098416-46098438 CCCCGCGGCCTCCTCTGGGGCGG + Intronic
1181427442 22:22853118-22853140 CCCCTGTGCCTCCTCTGGGCTGG - Intronic
1181541006 22:23573339-23573361 CTGCGGGACCTCCACTGCTCGGG + Exonic
1181550912 22:23638697-23638719 CTGCGGGACCTCCACTGCTCGGG + Intergenic
1181744527 22:24946594-24946616 CAGCGTGGCCACCTCTGCTCAGG + Exonic
1181797374 22:25319991-25320013 CTGCGGGACCTCCACTGCTCGGG - Intergenic
1183601562 22:38843341-38843363 CCGCGCGGCCTCCAGGGCGCCGG - Exonic
1184796895 22:46738047-46738069 CCGCGCGGGCTCTGCTGCGCTGG - Exonic
1185101624 22:48843709-48843731 CAGCGGGTCCTCCTGTGGGCTGG + Intronic
1185279058 22:49962213-49962235 TGGCGGGGCCTCCCCTGCGTGGG + Intronic
1185384799 22:50526738-50526760 ACGCTGAGCCTCCTCTCCGCAGG - Exonic
950345270 3:12287726-12287748 CCGTGGGCCCTACTGTGCGCGGG + Intronic
952945326 3:38475069-38475091 CCACAGGGCCTCCTCTCCCCAGG - Intronic
954785909 3:53092290-53092312 CCGCTAGGCCTCCTCTTCCCAGG - Intronic
962250712 3:133834427-133834449 GCACGGGGCCTCCTCTAGGCGGG - Intronic
963827433 3:149970647-149970669 CCGCGGGGGCACCGCAGCGCGGG - Intronic
964622839 3:158733065-158733087 CCTCGGCGCCTCTTCTGGGCAGG - Intronic
965109505 3:164402410-164402432 TCTCGGGGCCTCCTCTGCCTGGG - Intergenic
965446400 3:168780003-168780025 TCTCGGGGCCTCCTCTGCCTGGG + Intergenic
965590379 3:170356862-170356884 CCGCGGGGCCTCCTGCCCGAGGG - Intergenic
968293490 3:197556033-197556055 CCGAGCCGCCTCCTCCGCGCTGG + Intronic
968698123 4:2042475-2042497 CCCCGGCACCTACTCTGCGCGGG - Exonic
969417209 4:7068457-7068479 CCGCGGGCCTTCCTTTGCTCTGG + Intergenic
969488560 4:7485905-7485927 CCATGGGGCTTCCTCTGTGCTGG + Intronic
973037025 4:45420025-45420047 TCTCGGGGCCTCCTCTGCCTCGG + Intergenic
973945272 4:55948901-55948923 CCGCGGCGCCTCCTCCGTGTCGG + Intronic
974047461 4:56908946-56908968 CCGCGGAGCCTCCCCGGCCCTGG + Intronic
978761178 4:112357567-112357589 CCCCGGGTCCTCCTTTGCCCTGG + Intronic
981920483 4:150079512-150079534 CCGCGGGCTCCCCGCTGCGCCGG - Intronic
984667853 4:182448326-182448348 CCGCGGGGCGTCCGCAGCGAAGG - Intronic
992627681 5:78649221-78649243 CCCCGGGGCCCGCTCTCCGCCGG - Intronic
995106365 5:108381449-108381471 CGGCGGCTCCTCCTCTGGGCCGG + Exonic
997479791 5:134176635-134176657 CAGCGAGGCCTCCTCTGGCCGGG - Intronic
1000329265 5:160194404-160194426 TCTCGGGGCCTCCTCTGCCTGGG - Intronic
1002043924 5:176531791-176531813 CCACGGGGCTTTCTCTGCCCCGG - Intronic
1004561868 6:16760221-16760243 CCGCAGCGCCTCCTCCGCGGCGG + Intronic
1006396001 6:33788346-33788368 CCCAGGGCCCTCCCCTGCGCCGG + Intronic
1007161125 6:39792509-39792531 CCGCGGGGAGCCCTCTCCGCTGG + Intronic
1010244956 6:73654031-73654053 CGGCGCGGCCGCCTCTGGGCGGG - Exonic
1011607354 6:89118038-89118060 GCGCTGCGCCCCCTCTGCGCCGG - Exonic
1013272592 6:108558205-108558227 CCCCGACGCCTCCTCTTCGCTGG + Intergenic
1016386765 6:143537088-143537110 CGGCGGCGCCTGCCCTGCGCTGG + Intronic
1019648100 7:2141682-2141704 TCGTGGGGCCTCCTCAGCGGGGG - Intronic
1019660712 7:2222550-2222572 GAGCGGGGCCTCTGCTGCGCAGG - Intronic
1019995585 7:4722421-4722443 CCACGGGACCTCCTCTGGCCAGG - Intronic
1020021417 7:4871745-4871767 CAGAGGGGCCTCCTCTCCTCAGG + Intronic
1020281945 7:6654407-6654429 CCGCGGAGCCACCGCAGCGCCGG + Exonic
1026512269 7:71037457-71037479 TCTCGGGGCCTCCTCTGCCTGGG + Intergenic
1027239579 7:76318373-76318395 CCGAGGGGCCTCCTTTGCATTGG - Intergenic
1027868020 7:83673181-83673203 TCTCGGCGCCTCCTCTGCGTGGG + Intergenic
1028778248 7:94705358-94705380 TCTCGGGGCCTCCTCTGCCTGGG + Intergenic
1028852599 7:95552963-95552985 TCTCGGGGCCTCCTCTGCCTGGG - Intergenic
1029832929 7:103280065-103280087 CTGCGGGGCCTCCCCCGCCCGGG - Intergenic
1032238004 7:130141245-130141267 GTGCGGGGCCGCCTCTTCGCGGG - Intergenic
1034267723 7:149789332-149789354 CCGCCGGCCCTGCTCTGCGATGG + Intergenic
1034343422 7:150371883-150371905 CCGCGGGGCGGCCCCTGGGCCGG - Exonic
1037305180 8:17497106-17497128 CGGCGGGCGCTCCTCTTCGCGGG + Intronic
1037802062 8:22041247-22041269 CTCCGGGGTCTCCTCTCCGCAGG - Intergenic
1037879339 8:22565484-22565506 CCTCGGGCCCTCCTGGGCGCTGG + Intronic
1038440638 8:27568933-27568955 CAGCAAGGCCTCCTCTGCCCAGG - Intergenic
1038725955 8:30082857-30082879 CCGCGGGCCCTGCCCTGGGCTGG - Exonic
1038734501 8:30156655-30156677 CCGGGAGACCCCCTCTGCGCAGG - Intronic
1040545858 8:48397274-48397296 CCGGGGCGCCCCCTCTGCACAGG + Intergenic
1049290565 8:141799605-141799627 CCGCAGGTCCTCCTCTGTGGGGG - Intergenic
1051054173 9:12964322-12964344 CCTTGTGGCCTCCTCTGCGAAGG + Intergenic
1052824727 9:33166762-33166784 CAGCGGGGACTCCTCAGGGCAGG + Exonic
1057040497 9:91844307-91844329 CCTGGGGGCCTCCTCTGGGCCGG + Intronic
1057314167 9:93958376-93958398 CGGCGGGGCCTCCTCTGCTCAGG + Intergenic
1058662908 9:107283002-107283024 CCGCGGCTCCGCCTCTGTGCAGG - Intergenic
1059457134 9:114406661-114406683 CCCAGGGACCTCCTCTGCACAGG - Exonic
1060661675 9:125408408-125408430 CCGCTGGGCCTCGGCTGCGAAGG + Intergenic
1061458079 9:130713287-130713309 CGGCCGGGCCTCCTCTACACGGG + Intergenic
1061483747 9:130909983-130910005 TCTCGGCGCCTCCTCTGCGTGGG + Intronic
1061584666 9:131558084-131558106 CCGCGAGGCCTCCTCAGCCTGGG - Intergenic
1061618943 9:131798439-131798461 CAGTGGGGCCACCTCTGGGCAGG + Intergenic
1062387460 9:136318639-136318661 CTGCGGGGGCTCCTCTCCCCTGG - Intergenic
1062533784 9:137012854-137012876 CCGCTGCACCTGCTCTGCGCAGG - Exonic
1187225851 X:17375147-17375169 CCGCGCGGCCTCCTGCGCCCGGG + Intergenic
1190560645 X:51682485-51682507 CTGCGGGGCCTCAGCTGCGAGGG - Intergenic
1190563646 X:51710836-51710858 CTGCGGGGCCTCAGCTGCGAGGG + Intergenic
1191213188 X:57910006-57910028 CCCCGCGGGCTGCTCTGCGCAGG - Exonic
1197931885 X:131704638-131704660 CCTCGGTTCCTCCTCTGGGCAGG + Intergenic