ID: 1149997096

View in Genome Browser
Species Human (GRCh38)
Location 17:61411182-61411204
Sequence TCGGAGGGGACATGTGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149997096_1149997105 1 Left 1149997096 17:61411182-61411204 CCCGCCGCACATGTCCCCTCCGA No data
Right 1149997105 17:61411206-61411228 TCGCCCACCCGGCGCTCCGCGGG No data
1149997096_1149997099 -10 Left 1149997096 17:61411182-61411204 CCCGCCGCACATGTCCCCTCCGA No data
Right 1149997099 17:61411195-61411217 TCCCCTCCGAGTCGCCCACCCGG No data
1149997096_1149997106 2 Left 1149997096 17:61411182-61411204 CCCGCCGCACATGTCCCCTCCGA No data
Right 1149997106 17:61411207-61411229 CGCCCACCCGGCGCTCCGCGGGG No data
1149997096_1149997111 12 Left 1149997096 17:61411182-61411204 CCCGCCGCACATGTCCCCTCCGA No data
Right 1149997111 17:61411217-61411239 GCGCTCCGCGGGGCCCCAGCTGG No data
1149997096_1149997104 0 Left 1149997096 17:61411182-61411204 CCCGCCGCACATGTCCCCTCCGA No data
Right 1149997104 17:61411205-61411227 GTCGCCCACCCGGCGCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149997096 Original CRISPR TCGGAGGGGACATGTGCGGC GGG (reversed) Intergenic