ID: 1149999420

View in Genome Browser
Species Human (GRCh38)
Location 17:61424349-61424371
Sequence CAGTAGGTCAGGATGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149999420_1149999424 -6 Left 1149999420 17:61424349-61424371 CCAAGTTCCATCCTGACCTACTG No data
Right 1149999424 17:61424366-61424388 CTACTGAGTCTGAACGTGCTTGG No data
1149999420_1149999425 -2 Left 1149999420 17:61424349-61424371 CCAAGTTCCATCCTGACCTACTG No data
Right 1149999425 17:61424370-61424392 TGAGTCTGAACGTGCTTGGCTGG No data
1149999420_1149999428 17 Left 1149999420 17:61424349-61424371 CCAAGTTCCATCCTGACCTACTG No data
Right 1149999428 17:61424389-61424411 CTGGATCTCCATTCCCAGGTGGG No data
1149999420_1149999426 13 Left 1149999420 17:61424349-61424371 CCAAGTTCCATCCTGACCTACTG No data
Right 1149999426 17:61424385-61424407 TTGGCTGGATCTCCATTCCCAGG No data
1149999420_1149999427 16 Left 1149999420 17:61424349-61424371 CCAAGTTCCATCCTGACCTACTG No data
Right 1149999427 17:61424388-61424410 GCTGGATCTCCATTCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149999420 Original CRISPR CAGTAGGTCAGGATGGAACT TGG (reversed) Intergenic
No off target data available for this crispr