ID: 1150003460

View in Genome Browser
Species Human (GRCh38)
Location 17:61455920-61455942
Sequence CTACCTCAGTGCTGTCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150003457_1150003460 -4 Left 1150003457 17:61455901-61455923 CCTTTGGTTCAGGAAGTCTCTAC 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1150003460 17:61455920-61455942 CTACCTCAGTGCTGTCTGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150003460 Original CRISPR CTACCTCAGTGCTGTCTGAG GGG Intronic
900094969 1:936541-936563 CTACAGCAGTGCCCTCTGAGGGG - Intronic
900244265 1:1630284-1630306 CCACCTCAGAGCCGTCTGCGGGG - Exonic
901468267 1:9437594-9437616 CTACGTCAGGGGTGTGTGAGAGG - Intergenic
903559574 1:24217416-24217438 CAACCTCAGTCCAGCCTGAGAGG + Intergenic
910125603 1:83838434-83838456 CTGCCCCAGTGCTGTCTGAAGGG - Intergenic
912956866 1:114160314-114160336 CTATCTCAGTGCTCTCTGAATGG + Intergenic
914995255 1:152537853-152537875 ATACCTCAGAGCTCTCTGCGGGG + Intronic
915666367 1:157448869-157448891 CTACTTCAGCACTGACTGAGTGG - Intergenic
916560911 1:165933618-165933640 CTCCCTCAGGGCAGTCTGGGAGG - Intergenic
916934518 1:169613779-169613801 CTAGCTCAGTCCTATCTGAGAGG - Intronic
917232362 1:172852004-172852026 CTATTTCAGTACTGACTGAGTGG - Intergenic
1067973435 10:50996627-50996649 CTAGCTCAGTGCTGTGTTACAGG + Intronic
1068741164 10:60472983-60473005 CTACCTTAGAGCTGCCTGTGGGG - Intronic
1068855870 10:61796683-61796705 CTACCACACTCCTGTCTCAGAGG + Intergenic
1069498929 10:68932009-68932031 CTAACTCAGTCTTGTTTGAGGGG - Intronic
1072900723 10:99404334-99404356 CTACAGCTGTGCTCTCTGAGTGG + Intronic
1075821405 10:125315950-125315972 CTACCTAAGTCCTGTCTGGATGG + Intergenic
1076650632 10:131984626-131984648 CTGCCTAAGAGATGTCTGAGAGG + Intergenic
1077104215 11:834976-834998 CTACCCCTCTGCTGTCTGAGTGG + Intronic
1077986269 11:7354464-7354486 CTACCTCAGGCCTGTTTGTGAGG - Intronic
1079416018 11:20237482-20237504 CTGACTCAGTGCAGTCTCAGTGG - Intergenic
1080451363 11:32381390-32381412 CTGCCTCAGTCCTTTCTGAATGG + Intergenic
1081882108 11:46462485-46462507 CTACCTCAGTGTAGTCAGTGAGG - Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1089595046 11:119573235-119573257 CGGCCTGAGTGCTGTCGGAGAGG + Intergenic
1092266054 12:6981445-6981467 CTTGCTCAGTGCTATCTGAAAGG + Intronic
1093494946 12:19745885-19745907 CTACCTCAGAGTTTTTTGAGAGG - Intergenic
1104294053 12:127495683-127495705 CCACCTCAGTGCTCTCTGTGTGG + Intergenic
1104792996 12:131495562-131495584 TTACCTGTGTGCTGCCTGAGTGG - Intergenic
1108336696 13:49449852-49449874 ATACCTCAGTGCTTTCTTATAGG + Intronic
1111277494 13:85968791-85968813 CTGTTTCAGTGCTGACTGAGTGG - Intergenic
1114416013 14:22544951-22544973 CTTCCTCAGTGGGCTCTGAGAGG + Intergenic
1115788943 14:36857316-36857338 CTCCCGCAGTGCTGCCTGAAAGG - Intronic
1116448887 14:45042272-45042294 CTACCAAAGTGCTTTCTGTGAGG - Intronic
1116965385 14:51009352-51009374 CTGCCTCAGTGCTGTTGGTGAGG + Intronic
1117237043 14:53789268-53789290 CAGCCTCAGATCTGTCTGAGAGG - Intergenic
1120439578 14:84519867-84519889 CTGCCCCAGTGCTGTCCCAGTGG - Intergenic
1122722465 14:103730048-103730070 CTTTCTCAGTTCTGTCTCAGCGG + Intronic
1123975359 15:25548661-25548683 CTACCAGAGTGCTGTCAGAGAGG + Intergenic
1124067589 15:26360018-26360040 CTACTTCAGTGGTGGCTGAATGG - Intergenic
1124231214 15:27947724-27947746 GCACCTCAGGGCTGTCTGTGGGG - Intronic
1124237389 15:28002422-28002444 CTACCTCACTGTGGTCTGTGGGG + Intronic
1126340581 15:47636695-47636717 CTAGGACAGTGCTGACTGAGAGG - Intronic
1127143278 15:55998638-55998660 AAACCTCACTGCTGTCTGACTGG + Intergenic
1128300645 15:66564517-66564539 CTACCCCAGTGCAGCCAGAGGGG - Intronic
1128683288 15:69666598-69666620 CTTCCTCTGTGCTGTGTGGGAGG + Intergenic
1128738876 15:70069933-70069955 CAAACACAGTGATGTCTGAGTGG + Intronic
1129140550 15:73594204-73594226 CTTTCTCAGTGCAGTCTGAGAGG - Intronic
1133842201 16:9420125-9420147 CTCCATCAGTGCTGACAGAGAGG + Intergenic
1134195191 16:12154376-12154398 CCACCTCAGGGGTGTCAGAGGGG - Intronic
1141727353 16:85798998-85799020 CTTCCTCTCTGCTGACTGAGGGG + Intronic
1141929996 16:87196015-87196037 CCCCCTCAGTGCTCTCTCAGGGG + Intronic
1142122561 16:88394097-88394119 CTACACCTGCGCTGTCTGAGAGG + Intergenic
1142122591 16:88394297-88394319 CTACACCTGTGCTGTCCGAGAGG + Intergenic
1142144226 16:88486114-88486136 AGAGCTCAGTGGTGTCTGAGAGG + Intronic
1146920757 17:36709014-36709036 CTACCTCAAAGCTCTTTGAGGGG - Intergenic
1147567980 17:41549101-41549123 CCTGCTCAGTGCTGTGTGAGAGG + Intergenic
1148332528 17:46820883-46820905 CATCCACAGTGGTGTCTGAGTGG - Intronic
1150003460 17:61455920-61455942 CTACCTCAGTGCTGTCTGAGGGG + Intronic
1150859913 17:68790691-68790713 GGGCCTCATTGCTGTCTGAGAGG - Intergenic
1151298579 17:73204387-73204409 CTACCTCAGGGGTGACTGTGGGG + Intronic
1155828592 18:30481881-30481903 CTACCTCAGTCTTCTCTGTGTGG - Intergenic
1156376062 18:36516335-36516357 CGACCTCTGTGCTTCCTGAGTGG - Intronic
1160814807 19:1030091-1030113 CTGCCTCAGTGCTGTCTCCGCGG + Intronic
1161314449 19:3611350-3611372 CGGCCTCAGTGCTGCCTGTGCGG + Exonic
1162193108 19:8962628-8962650 CTCCATCAGTGGTGACTGAGGGG - Exonic
1163032109 19:14551542-14551564 CGTCCTCAATGCTGACTGAGAGG - Intronic
1163977838 19:20869213-20869235 CTACCTCTGTGATGGATGAGTGG - Intergenic
1164306093 19:24004592-24004614 CTGTCTCAGTGCTGTCTCATTGG - Intergenic
1164695635 19:30241554-30241576 CTAGCACAGTCCTGTCTCAGAGG - Intronic
1166248968 19:41552519-41552541 CTACTTCAGTACTGACTGAGTGG - Intronic
1167561200 19:50227010-50227032 CATACTCAGTGCTGTCTGAAAGG - Intronic
925395791 2:3532913-3532935 CTCCATCAGTCCTGTCTGCGCGG - Intronic
926486026 2:13459576-13459598 CTTCCACAGTGCTGTCATAGTGG - Intergenic
927338081 2:21948449-21948471 AGACCTCCGTGCTGTCTGAGAGG + Intergenic
935753589 2:106260267-106260289 AAACCTCAGTGCTGAATGAGGGG + Intergenic
938636033 2:133227361-133227383 CTACCTCAGTGCTTTATTAGGGG + Intronic
940796838 2:158089331-158089353 CAAACTCAGTGCTGTCAAAGGGG - Intronic
944675284 2:202030360-202030382 CTACCTCACTCCAGCCTGAGTGG + Intergenic
944704819 2:202278174-202278196 CTAACTCAATGTTGTCTCAGTGG - Intronic
945957444 2:216099473-216099495 CTAGTTCTGTGCTTTCTGAGAGG - Intronic
947181103 2:227412159-227412181 CTAACTCATTTCTGTCTGGGTGG - Intergenic
947307319 2:228761942-228761964 CTATCTCAGGGATATCTGAGGGG - Intergenic
1171258831 20:23712892-23712914 TTATCTCAGTGATCTCTGAGAGG - Intergenic
1171286596 20:23944397-23944419 TTATCTCAGTGATCTCTGAGAGG - Intergenic
1171444935 20:25196266-25196288 CACCCTCAGTCCTGTCCGAGCGG - Intronic
1173519212 20:43686715-43686737 CTCGCTCAGTGTTGCCTGAGGGG + Intronic
1174185039 20:48700616-48700638 CTACATCAGTGCTGTCTAGTAGG - Intronic
1174457552 20:50660445-50660467 CTAACTCATTGCTGTGAGAGTGG - Intronic
1179632787 21:42688953-42688975 CTCCCTCAGTGAGGTCTCAGTGG + Intronic
1181287473 22:21764491-21764513 CCACCTCAGAACTGTCTGAGAGG - Intronic
1181759872 22:25050860-25050882 CTAAGTCAGAGCTATCTGAGAGG - Intronic
1182046139 22:27275629-27275651 CAACCTCTGTGCTGTCTGCTGGG - Intergenic
1182414706 22:30213740-30213762 CAGCCTTAGTTCTGTCTGAGAGG - Intergenic
1184727164 22:46353881-46353903 CAGCCCCAGTGCTGTCTCAGAGG - Intronic
950310447 3:11953399-11953421 CTAGCTCTTTGCTGTCTGATGGG + Intergenic
950653419 3:14422047-14422069 CCACCTCAGTGAAGTCTGAGGGG + Intronic
965287798 3:166840631-166840653 CAAACTCAGTGCAGCCTGAGTGG + Intergenic
967222687 3:187260998-187261020 CTACCTCTGGGCTGTATGAGAGG - Intronic
977788888 4:101074296-101074318 CTAGCTCAGATCTTTCTGAGAGG - Intronic
983120157 4:163873537-163873559 GTAACACAGGGCTGTCTGAGCGG - Intronic
984892977 4:184509912-184509934 CTTCTTCATTGCAGTCTGAGAGG + Intergenic
984898471 4:184563362-184563384 CTGGCTCAGTGCTGGCTGAACGG - Intergenic
985986892 5:3523461-3523483 CTGCCTCAGAGCTGTCTCTGTGG - Intergenic
991487623 5:67154225-67154247 CTATCTGAGAGCTATCTGAGAGG - Intronic
996827610 5:127703085-127703107 CAGCCACACTGCTGTCTGAGAGG - Intergenic
997190603 5:131931342-131931364 CTAGCTCAGTGCAGAGTGAGTGG - Intronic
998507770 5:142685997-142686019 CTCGCTCAGTGCTGTCCCAGGGG + Intronic
1002446031 5:179290697-179290719 CTCCCTCAGTGCTCTCTGGCCGG + Intronic
1007590604 6:43018515-43018537 CGACTCCAGTGCTGCCTGAGGGG + Exonic
1008911390 6:56737604-56737626 CTAGAGCAGTGCTGTCTGATAGG - Intronic
1008932908 6:56958310-56958332 CTTCCTCAGTACTTTCTTAGAGG + Intronic
1012414257 6:98995422-98995444 ATACCTCCCTGCTGCCTGAGTGG + Intergenic
1022212391 7:28224407-28224429 CTACCACACTGCTGTGGGAGAGG + Intergenic
1022787267 7:33650893-33650915 GGACCTCAGTGCTGTATGATGGG + Intergenic
1023121500 7:36913834-36913856 CTACCCCACTGCTGTATGATTGG - Intronic
1025152145 7:56566287-56566309 CCACCTCACTCCAGTCTGAGTGG + Intergenic
1030007148 7:105130858-105130880 CTCCCTCAGTGCTGTCAGGACGG - Intronic
1032216125 7:129958700-129958722 CAGCCTCAGTGTTGTCTTAGAGG - Intergenic
1032555669 7:132831395-132831417 CTACTTTAGTGCTGTGTGAATGG - Intronic
1034391050 7:150788051-150788073 CTCCCTAAGTGCCGCCTGAGGGG - Intergenic
1034702616 7:153109458-153109480 CTACCTCCCTGCTGTTTTAGTGG + Intergenic
1034927300 7:155132472-155132494 CTCCCTAGGAGCTGTCTGAGTGG - Intergenic
1039366496 8:36933510-36933532 CTTCCTCAGGGCTGTCAGAGTGG - Intronic
1039835104 8:41249737-41249759 ATAGCTCAGTGCTGTGTGAAGGG + Intergenic
1046650719 8:116834206-116834228 TCCCCTCTGTGCTGTCTGAGAGG + Intronic
1048798139 8:138170750-138170772 CTGCCTCAGGGGTGTCTGTGAGG + Intronic
1049587747 8:143439927-143439949 CTACCTGAGTCCTTGCTGAGGGG + Intronic
1051636346 9:19183995-19184017 CTAGCTCAGTGCAGGCTGAGGGG - Intergenic
1052746006 9:32441679-32441701 CTACCTGAGTGCTGACTGCCTGG - Intronic
1053794216 9:41710227-41710249 CTGGCTCAGTGCTGGCTGAATGG + Intergenic
1054150952 9:61604600-61604622 CTGGCTCAGTGCTGGCTGAACGG - Intergenic
1054182622 9:61922266-61922288 CTGGCTCAGTGCTGGCTGAACGG + Intergenic
1054470735 9:65535712-65535734 CTGGCTCAGTGCTGGCTGAACGG - Intergenic
1054655885 9:67666213-67666235 CTGGCTCAGTGCTGGCTGAACGG - Intergenic
1054750110 9:68897080-68897102 GAGCCTCAGTGCTGGCTGAGGGG + Intronic
1055126034 9:72719049-72719071 CAATCTCAGTGCTGTTGGAGGGG - Intronic
1055999287 9:82196943-82196965 GTACTTCAGTGCTGACTGAAAGG - Intergenic
1057871976 9:98725293-98725315 CCACTTCAGAGCTGTCTCAGGGG - Intergenic
1060352520 9:122871224-122871246 TTACCTCAGTGAAGTCTTAGAGG - Intronic
1061387406 9:130298755-130298777 CCAACTCAGTGCAGTCAGAGGGG + Intronic
1062516982 9:136941751-136941773 CTACCTCAGTGGTGTCTCTGGGG + Intronic
1187376871 X:18763475-18763497 CTGTCTCAGTACTGACTGAGTGG - Intronic
1190773727 X:53536143-53536165 CTACCTCAGTGCTGAAGGTGAGG + Exonic
1192210869 X:69126965-69126987 CTGCCTCAGTGCTGCTAGAGTGG - Intergenic
1192955113 X:76062122-76062144 CTACCTCAGTCCTGCCAGAATGG + Intergenic
1194003225 X:88457770-88457792 CTGTTTCAGTGCTGGCTGAGTGG - Intergenic
1196074623 X:111561631-111561653 CTATTTCAGTACTGACTGAGTGG - Intergenic
1197124732 X:122930968-122930990 ATACCTCAGTCCTGTTTGTGAGG - Intergenic
1198772976 X:140150541-140150563 CTAGCTCAGAACTGGCTGAGCGG - Intergenic
1201955965 Y:19622652-19622674 CTAACCCAGTGCTGTCACAGCGG + Intergenic