ID: 1150003628

View in Genome Browser
Species Human (GRCh38)
Location 17:61456570-61456592
Sequence CAGCGCGGGCTCGGGGGCGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150003628_1150003646 28 Left 1150003628 17:61456570-61456592 CCAACGCCCCCGAGCCCGCGCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1150003646 17:61456621-61456643 TAGGCAGCCCCCCGGGACCCGGG 0: 1
1: 0
2: 0
3: 16
4: 219
1150003628_1150003645 27 Left 1150003628 17:61456570-61456592 CCAACGCCCCCGAGCCCGCGCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1150003645 17:61456620-61456642 CTAGGCAGCCCCCCGGGACCCGG 0: 1
1: 0
2: 3
3: 12
4: 166
1150003628_1150003638 -3 Left 1150003628 17:61456570-61456592 CCAACGCCCCCGAGCCCGCGCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1150003638 17:61456590-61456612 CTGGCAGCGCCGGGCCTCAGCGG 0: 1
1: 0
2: 2
3: 22
4: 213
1150003628_1150003643 21 Left 1150003628 17:61456570-61456592 CCAACGCCCCCGAGCCCGCGCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1150003643 17:61456614-61456636 GCCGCGCTAGGCAGCCCCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 102
1150003628_1150003647 29 Left 1150003628 17:61456570-61456592 CCAACGCCCCCGAGCCCGCGCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1150003647 17:61456622-61456644 AGGCAGCCCCCCGGGACCCGGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1150003628_1150003642 20 Left 1150003628 17:61456570-61456592 CCAACGCCCCCGAGCCCGCGCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1150003642 17:61456613-61456635 AGCCGCGCTAGGCAGCCCCCCGG 0: 1
1: 0
2: 1
3: 10
4: 144
1150003628_1150003640 9 Left 1150003628 17:61456570-61456592 CCAACGCCCCCGAGCCCGCGCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1150003640 17:61456602-61456624 GGCCTCAGCGGAGCCGCGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150003628 Original CRISPR CAGCGCGGGCTCGGGGGCGT TGG (reversed) Exonic
900307794 1:2019512-2019534 CGGCGCGGGGTCGGGGGCGGTGG + Intronic
901815126 1:11789394-11789416 CACCGCGGGGTTGGGGGCTTGGG + Exonic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
902612949 1:17607899-17607921 CAGCGAGGACTCGGGGGAGGAGG + Exonic
903448483 1:23437235-23437257 CAGCGCTGGCCCGGGGTCCTGGG - Exonic
903514725 1:23902785-23902807 CTGCGCGGGCGCGGGCGCGGGGG + Intronic
905037949 1:34929705-34929727 CTGCGCGGGGGCGGGGGCGGGGG - Intergenic
905179166 1:36156049-36156071 CGGCGCGGGCGCGGGGGGCTGGG + Intronic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
907397320 1:54200292-54200314 CAGCTCGGCCTTGGGGGCTTCGG + Exonic
913186194 1:116372966-116372988 CAGCGGGGACTCGGCGGCCTTGG - Intronic
914754900 1:150557095-150557117 CAGGGCTGGCTCGGGGCAGTGGG + Intronic
917481468 1:175415503-175415525 CAGCACGTGGTCAGGGGCGTTGG - Intronic
917715184 1:177728181-177728203 CAGAGCCTGCTCGGGGGGGTCGG + Intergenic
917797525 1:178542735-178542757 CGGCGGGGGCGCGGGGGCGTCGG - Intronic
917962302 1:180154774-180154796 GGGCGGGGGCTCGGGGGCGGGGG + Intergenic
918244015 1:182643320-182643342 CAGCGCGGGGGCGGGGGGGCTGG - Intergenic
921945086 1:220880490-220880512 CAGCCCGGGGTCCGGGGAGTGGG - Intronic
922766392 1:228158675-228158697 CGGCGCGGGGGCGGGGGCGGAGG - Exonic
922811250 1:228416692-228416714 CAGCGGGGGCTGGGGGGCGGCGG + Intronic
1063418236 10:5890296-5890318 CGGCGCGGGCCCGGCGGCGGCGG + Intronic
1066126468 10:32347205-32347227 CGGCGCGGGCACGCGGGCGGGGG + Intronic
1071579485 10:86756579-86756601 CGGCGCGGGTGCGGGGGCCTGGG - Intergenic
1073472383 10:103730968-103730990 CAGCACAGGCTCAGGGGCGGAGG + Intronic
1075413846 10:122248484-122248506 CTGGGAGGGCTCTGGGGCGTGGG + Intronic
1075556188 10:123434381-123434403 CTGCTCGGGCTTGGGGGAGTGGG - Intergenic
1075885672 10:125896857-125896879 CAGCGCGGACTCTAGGGCGCCGG - Intronic
1076371750 10:129959810-129959832 CCGCGCGGGCTCGGGCGCCCTGG - Intronic
1076478769 10:130770199-130770221 CAGCGTGGGGTGTGGGGCGTTGG - Intergenic
1076650180 10:131982019-131982041 CTGCGCGTGCGCAGGGGCGTGGG + Intergenic
1077107894 11:849811-849833 GCGCGCGGGGTCGGGGGCGCGGG + Intronic
1083658371 11:64241147-64241169 CAGCCCGGGCTGGGGGGAGCCGG + Intronic
1083881505 11:65551188-65551210 CAGCGCATGGTCGGGGGCGAGGG + Exonic
1087118111 11:94544986-94545008 CAGCGCTGGCCCGGGGGCCTGGG - Exonic
1090188258 11:124752030-124752052 CGGCGAGGGCTGGGGGGCATAGG - Intronic
1090416138 11:126541760-126541782 CAGCACGGGCTTGTGGGCCTGGG + Intronic
1093464948 12:19439768-19439790 CAGCCCGGGTTCGGCGGCGCGGG + Exonic
1096678047 12:53236243-53236265 CAGGGCTGGATCGGGGGAGTGGG - Intergenic
1097678984 12:62631901-62631923 CAGCGCGGGGGCGGGGGTGTAGG + Intergenic
1100565644 12:95790954-95790976 CAGCCGGGCGTCGGGGGCGTCGG - Intronic
1102457166 12:113077955-113077977 CGGCGCGGGCTCGGCGGGGCCGG - Exonic
1103528016 12:121580348-121580370 CGGCCCGGGCTTGGGGGGGTGGG + Intronic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1109957824 13:69591158-69591180 CAGCCTGGGCTGGGGGGCGAGGG + Intergenic
1110860515 13:80341036-80341058 CCGGGCGGGCGCGGGGGCCTGGG + Intergenic
1113994390 14:16054489-16054511 CAGGGCGGGCGATGGGGCGTGGG - Intergenic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1120539251 14:85734223-85734245 CAGCGGGGGGGCGGGGGGGTAGG + Intergenic
1122666722 14:103334843-103334865 CATCGCGCGCTCTGGGGCGGGGG + Intronic
1122874345 14:104656643-104656665 CAGCGCGGGAGCGGGGGCGGGGG + Intergenic
1122969514 14:105146847-105146869 CAGCTTGGGCTCGGGGGCAGGGG - Intronic
1122972461 14:105157980-105158002 CCACGCGGGCTCAGGGGCCTGGG + Intronic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1123024880 14:105419864-105419886 CTGCGCGGCCTCGGCGGCCTCGG + Exonic
1124628716 15:31325736-31325758 CAGCCCGGGCTGGGAGGCGCGGG + Intergenic
1128264013 15:66252576-66252598 CCGCCCGGGCTCGGGGGCTCTGG + Intronic
1129189138 15:73927413-73927435 CGGCGTGGGCGCGGGGGCGGCGG + Exonic
1129423991 15:75451706-75451728 CGGGGCGGGGTCGGGGGAGTGGG - Intronic
1129503162 15:76059654-76059676 CAGAGCGGGCTTCGTGGCGTGGG - Intronic
1131257633 15:90872261-90872283 CAGCGGGGGCACAGGGGCCTCGG - Intronic
1132719882 16:1310185-1310207 CATCGCTGGCTCGCGGGGGTGGG + Intronic
1132995443 16:2820144-2820166 CTGCGCGGGCTGGGAGGCCTTGG + Intronic
1134587904 16:15428036-15428058 CAGCCAGGGCTCGGGGGCGGTGG + Intronic
1138514567 16:57528989-57529011 CAGCGCGGGCGCGGGGGGCAGGG + Exonic
1140223128 16:73058229-73058251 CGGCCCGGGCTCGGCGGCGGCGG + Intronic
1141898929 16:86977474-86977496 CAGCTGGGGATCGGGGGCGGTGG + Intergenic
1141957688 16:87383551-87383573 CAGCGCGGGGGCGGCGGCGAGGG + Exonic
1142007946 16:87699005-87699027 CAGCGCGGTCTGCGGGGGGTGGG + Intronic
1142403527 16:89873566-89873588 TCGCGCGGGGTCGGGGGCGGGGG - Intronic
1143320562 17:6065988-6066010 CAGGGCAGGCTCTGGGGCGGTGG + Intronic
1148747727 17:49927803-49927825 CAGCGCTGGCTCGGGAGCCAGGG - Intergenic
1148852465 17:50561585-50561607 CAGCGCGGACTCCGAGGCGGAGG + Exonic
1148854766 17:50572669-50572691 CTGCGCGGGGACGGGGGCGGTGG + Exonic
1150003628 17:61456570-61456592 CAGCGCGGGCTCGGGGGCGTTGG - Exonic
1150133330 17:62680768-62680790 CAGCGCGGGCGTGGGAGCGGCGG - Intronic
1151954513 17:77373710-77373732 CGGCGCGGGCACGGGGCCGGGGG - Intronic
1152352512 17:79791471-79791493 CTGCGGGGACTCGGGGGCGGGGG + Intergenic
1152403361 17:80082760-80082782 CGGCGGGGGCCCGGGGGCCTGGG - Intronic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152821271 17:82439088-82439110 AAGCGAGGGCTGGGGGGCCTTGG - Intronic
1152930629 17:83107833-83107855 CACTGCAGGCTCGGGGGCGGGGG + Intergenic
1159597405 18:70395545-70395567 CACCGTGGGCTCAGGGGCCTAGG - Intergenic
1159952709 18:74496596-74496618 GAGCGCGCGGTCGGGGGCGGAGG + Intronic
1160256233 18:77250601-77250623 CGGCCCGGGCTCCGGGGCGGGGG - Exonic
1160509304 18:79444424-79444446 CAGCGTGGGCTCGGGGTGGGTGG - Intronic
1160509321 18:79444472-79444494 CAGCGAGGGCTCGGGGTAGGCGG - Intronic
1160556504 18:79729080-79729102 TGGCGCGGGCACCGGGGCGTGGG - Intronic
1160712434 19:558762-558784 CAGAGCAGGCTCGGGGGTTTTGG + Intergenic
1160961921 19:1725881-1725903 CAGCGCGGGCTCGGCGTGGCCGG + Intergenic
1161065609 19:2236000-2236022 CAGCGCGCACTCAGGGGCGCAGG + Intronic
1161139050 19:2637214-2637236 CGGGCCGGGCTCGGGGGCGGGGG - Intronic
1161210251 19:3062106-3062128 GAGCCGGGGGTCGGGGGCGTAGG + Intronic
1162470745 19:10871071-10871093 CCGGGCGGGCCCGGGGGGGTGGG + Intergenic
1163442441 19:17328728-17328750 CAGCGGGGGCTGCGGGGCGCCGG - Exonic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165063859 19:33218084-33218106 CAGCGGGGGCTGGGTGGCCTTGG + Intronic
1165287021 19:34851012-34851034 CAACGGGGGCTTGGGGGCGGGGG + Intergenic
1165902068 19:39173703-39173725 CAGCTGGGGCTCTGAGGCGTGGG - Exonic
1166361318 19:42254029-42254051 CCGCGCGAGCCCGGGGGCGGCGG + Intronic
1167259616 19:48450985-48451007 CACTGCGGGCTGGGGGGCATTGG + Intronic
1168414508 19:56159915-56159937 CAGCGCGGGCCCGGGGCTGCCGG - Exonic
926267990 2:11344083-11344105 CGGCGCGGTCTCGGGGGCGCCGG + Exonic
931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG + Intronic
937992996 2:127674638-127674660 CAGCGCGGGCTCGGGGAAGTTGG + Intronic
938014650 2:127857612-127857634 GAGCGGGAGCTCGGGGGAGTCGG - Intronic
938537080 2:132256262-132256284 CAGGGCGGGCGATGGGGCGTGGG + Intronic
940639635 2:156333019-156333041 CTGCGCGGGCGCAGGGGCTTCGG - Intronic
948498073 2:238367643-238367665 CAGAGAGGGCTCGGTGGCGCAGG - Intronic
948563378 2:238868321-238868343 CAGAGCAGGCTGGGGGGCGGGGG - Intronic
1168748723 20:267093-267115 GAGGGCGGGCTGCGGGGCGTGGG - Intergenic
1171486967 20:25492176-25492198 AAGCCCGGGCTCTGGGGCTTAGG - Intronic
1175467228 20:59197595-59197617 CAGAGCAGGCTTGGGGGAGTGGG + Intronic
1176247160 20:64102718-64102740 CACCGCGGGGTGGGGGGCGGAGG - Intergenic
1178442796 21:32612370-32612392 CACCGCGGGCTAGGGAGCGTGGG - Exonic
1180054306 21:45349237-45349259 CAGCGCGGGCATGGGGGCTGTGG - Intergenic
1180084943 21:45504333-45504355 CAGCCCTGGCTCGGGGGGATGGG + Intronic
1180312702 22:11252915-11252937 CAGGGCGGGCGATGGGGCGTGGG + Intergenic
1180713467 22:17855874-17855896 CAGCCTGGGCTCGGCAGCGTGGG - Intronic
1181026948 22:20132105-20132127 CAGCCCGGGCACGGGGGCAGCGG + Intronic
1181841498 22:25666579-25666601 CAACGCGGGATAGGGGGCGGTGG - Intronic
1182676581 22:32043737-32043759 CAGGGAGGGCTCTGGGGCTTGGG + Intronic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1184035290 22:41915109-41915131 CGGCGCGGGCTCGGGCGGGCGGG + Intergenic
1184723018 22:46326521-46326543 CAGCGCCGGCTGGCGGGTGTGGG - Exonic
1185055465 22:48576440-48576462 CTGCGCGACTTCGGGGGCGTCGG + Intronic
1185219755 22:49623453-49623475 CAGCGGGGGCTCTGGGGCTGGGG - Intronic
1185272725 22:49936181-49936203 CGGCCCGAGCTCTGGGGCGTGGG + Intergenic
1185349399 22:50326777-50326799 GAGCGCGGGCGCGGGCGGGTGGG - Intronic
952364301 3:32661347-32661369 CACCGCGGGATCGGGGGCAAGGG + Intergenic
954748322 3:52799508-52799530 CAGCCAGGGCTCGGGGTAGTAGG + Intronic
956675018 3:71725272-71725294 GAGCGGCGGCTCGGGGGCGGCGG + Exonic
959530748 3:107431567-107431589 AAGCGCGGGCTCCGGGGGGAGGG + Intergenic
961623601 3:128243817-128243839 CAGGGCGGGCTGTGTGGCGTGGG + Intronic
961831877 3:129627133-129627155 CAGCGAGGGCCCGGGGGGCTCGG - Intergenic
963808614 3:149752363-149752385 CAGCGCGGGTCAGCGGGCGTGGG - Exonic
968093096 3:195909890-195909912 CAGGCCGGGCCCGGGGGAGTCGG - Intronic
968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG + Intergenic
968775402 4:2536873-2536895 CAGAGCGGGCGCGGGGGCCGCGG - Intronic
968799358 4:2732128-2732150 CACCGCGGCCTCGGAGGCCTGGG + Exonic
971257926 4:25030884-25030906 CAGCCCGGGCTCGGGTGGGGGGG - Intergenic
978351518 4:107825017-107825039 GAGTGCGGCCTCGGGGGCGGCGG + Intronic
985111938 4:186555318-186555340 GAGCACGGGCTGGGAGGCGTTGG + Exonic
992468539 5:77030810-77030832 CAGCTCAGGCTCGGGGGAGGTGG - Exonic
994083293 5:95731470-95731492 CAGGGCGGGCTAGCGGGCGGGGG - Exonic
1002204690 5:177554360-177554382 CGGCGGGGGCTCGGGCGCCTGGG + Exonic
1002927280 6:1611682-1611704 CAGGGCGCGCCCGGGGGCGCGGG + Exonic
1004044726 6:12012570-12012592 CGGCGCGGGCTCCGCGGCGGGGG + Intronic
1004442028 6:15662935-15662957 CAGCGCGGGGTTGGCGGCGTGGG - Exonic
1004627915 6:17393906-17393928 CGGCGCGGGCGCGGGGGCCGGGG + Intronic
1006725578 6:36196997-36197019 CAGAGCGGGGGCGGGGGCATCGG + Intronic
1008013256 6:46491026-46491048 CAGGGCGGGGGCGGGGGCGGGGG - Intronic
1014724997 6:124962735-124962757 CCTCGCGGGCTCTGGGGCGCTGG - Exonic
1015843309 6:137494909-137494931 CAGCGGGGGCTGGGGGTGGTGGG + Intergenic
1018613006 6:165662029-165662051 CAGCGCGGCCGCGGCGGCGAGGG + Exonic
1022415625 7:30174318-30174340 CAGCACTGGCACGGAGGCGTTGG + Intergenic
1026985917 7:74555229-74555251 CAGCGCGGGGTCGGGAGCCATGG + Intronic
1029537222 7:101163795-101163817 CAGCGCGGCCTCGGGGGTCGGGG - Exonic
1034415174 7:150960867-150960889 CAGCACGGGTTGGGGGGCGGGGG - Intronic
1037802459 8:22043064-22043086 CAGGGCGGGGGCGGGGGCCTGGG + Intronic
1037857769 8:22383944-22383966 CAGCCCGGGCCTGGGGGAGTGGG - Intronic
1039453727 8:37695320-37695342 CGGCGCGGGCTCTGGGACGCTGG - Intergenic
1039467796 8:37796723-37796745 CAGGGCGGGCGCGGGGACGCAGG + Intronic
1040850779 8:51898894-51898916 CAGTGGGGGCTCGGGGTCGTGGG - Intronic
1046770439 8:118111988-118112010 CGGCGCGGCGTTGGGGGCGTAGG + Intergenic
1049354093 8:142179213-142179235 CAGCTTGGGCTCGGGGCCGTGGG - Intergenic
1049424928 8:142533704-142533726 CCGCACTGGCTTGGGGGCGTGGG + Intronic
1049620684 8:143597202-143597224 CAGCGCGGGCTTAGGGGCCGTGG - Intronic
1049973618 9:842000-842022 CGGCTCCGGCTCCGGGGCGTCGG + Exonic
1050876299 9:10641040-10641062 CAGCGTGGGGTCGGGGGAGGGGG - Intergenic
1060888833 9:127175540-127175562 CAGGGAGAGGTCGGGGGCGTGGG + Intronic
1061028941 9:128068203-128068225 GAGCGCGGGCTCGGAGACGCCGG - Exonic
1062561191 9:137142798-137142820 CAGCTCAGGGTCGGGGGCGCTGG + Intronic
1062621325 9:137423681-137423703 CAGCGCGGCCTCGGGGTCCCCGG - Exonic
1192261060 X:69505981-69506003 CAGCCCGGGCTCCGGGGCCTGGG + Exonic
1197873547 X:131082386-131082408 CGGTGCGGGCGCGGGGGCGGCGG + Intronic