ID: 1150005009

View in Genome Browser
Species Human (GRCh38)
Location 17:61463895-61463917
Sequence GTGGGCCAACAGCTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150005009_1150005014 -7 Left 1150005009 17:61463895-61463917 CCCTGCTTCAGCTGTTGGCCCAC 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1150005014 17:61463911-61463933 GGCCCACCAGGAGAGAGGCAGGG 0: 1
1: 0
2: 6
3: 46
4: 400
1150005009_1150005020 3 Left 1150005009 17:61463895-61463917 CCCTGCTTCAGCTGTTGGCCCAC 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1150005020 17:61463921-61463943 GAGAGAGGCAGGGCCGGGAAAGG 0: 1
1: 1
2: 10
3: 161
4: 1239
1150005009_1150005018 -2 Left 1150005009 17:61463895-61463917 CCCTGCTTCAGCTGTTGGCCCAC 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1150005018 17:61463916-61463938 ACCAGGAGAGAGGCAGGGCCGGG 0: 1
1: 0
2: 12
3: 97
4: 1007
1150005009_1150005013 -8 Left 1150005009 17:61463895-61463917 CCCTGCTTCAGCTGTTGGCCCAC 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1150005013 17:61463910-61463932 TGGCCCACCAGGAGAGAGGCAGG 0: 1
1: 0
2: 5
3: 36
4: 290
1150005009_1150005022 7 Left 1150005009 17:61463895-61463917 CCCTGCTTCAGCTGTTGGCCCAC 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1150005022 17:61463925-61463947 GAGGCAGGGCCGGGAAAGGGTGG 0: 1
1: 0
2: 7
3: 99
4: 1073
1150005009_1150005021 4 Left 1150005009 17:61463895-61463917 CCCTGCTTCAGCTGTTGGCCCAC 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1150005021 17:61463922-61463944 AGAGAGGCAGGGCCGGGAAAGGG 0: 1
1: 1
2: 3
3: 75
4: 773
1150005009_1150005017 -3 Left 1150005009 17:61463895-61463917 CCCTGCTTCAGCTGTTGGCCCAC 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1150005017 17:61463915-61463937 CACCAGGAGAGAGGCAGGGCCGG 0: 1
1: 0
2: 7
3: 110
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150005009 Original CRISPR GTGGGCCAACAGCTGAAGCA GGG (reversed) Intronic
900811370 1:4803797-4803819 CTGAGCAAACAGCTCAAGCATGG - Intergenic
901140654 1:7027137-7027159 GTGGGAAAACAGTTGAAGAAGGG + Intronic
901208067 1:7508676-7508698 GTGGGGCAAGAGATGAAGAATGG + Intronic
903499949 1:23795280-23795302 GTGGGGAAACAGCTGAGGGAAGG - Exonic
904748957 1:32729021-32729043 GTGGGGCTGCAGCTGAAACATGG - Intergenic
905301914 1:36991419-36991441 GTAGGCCAACAGCAGAGGCTGGG + Intronic
905510979 1:38519848-38519870 TTGGGGCAAGAGCTGAAGCTGGG + Intergenic
907457367 1:54584340-54584362 TTGGCCCAGGAGCTGAAGCAAGG + Intronic
910350929 1:86296885-86296907 CTAGGCCAAAAGGTGAAGCAGGG - Intergenic
910907133 1:92192811-92192833 GTGGGCCAAAAGGTGAAACAGGG + Intergenic
913939006 1:125085874-125085896 GTGGGCAAAAAGCCGAGGCAGGG + Intergenic
913939353 1:125087115-125087137 GTGGGCAAAAAGCCGAGGCAGGG + Intergenic
914883424 1:151565432-151565454 GTGGCCCAGCAGCTGGTGCAAGG + Intronic
915141549 1:153771432-153771454 GTTGGCCCACAGCTTTAGCAGGG + Intronic
915335336 1:155137649-155137671 GAGGCCCAACTGCTGAAGCCGGG - Exonic
918095105 1:181327938-181327960 ATGGGTCATCAGCTGAGGCAGGG + Intergenic
918095796 1:181333111-181333133 CTGGGCCCACAGCTGATGAAGGG - Intergenic
920255896 1:204654081-204654103 GGGGTCAAACAGCTGAAGCTGGG + Intronic
921121264 1:212139714-212139736 GTGGGGCAAGTGCAGAAGCAGGG - Intergenic
921740482 1:218679139-218679161 GTGGGACAAGAGCAGAAGCTGGG + Intergenic
921767061 1:218984031-218984053 GGGGGACACCAGCTGCAGCAGGG - Intergenic
921939887 1:220828420-220828442 GTGGAGCCACAGCTGAGGCATGG - Intergenic
923306973 1:232697341-232697363 GTGTGTCCACAGCTGAAGTACGG + Intergenic
924037265 1:239950022-239950044 GTGGCCCATCAGTTGAAGCAGGG - Intergenic
1063472240 10:6297416-6297438 GTGGCCCAAGAGCAGGAGCAGGG + Intergenic
1063951648 10:11228953-11228975 GTGGGTCAACAGAGGAAGAAAGG + Intronic
1064166136 10:12987953-12987975 GAGGGGCAAAAGCGGAAGCAGGG - Intronic
1067555442 10:47266588-47266610 TTGGACCAACAGCTGCATCATGG - Intergenic
1070510310 10:77154979-77155001 GTGGGCCATCAGGGGACGCAGGG + Intronic
1070683099 10:78462794-78462816 GAGGGCCAAGAGTGGAAGCAGGG - Intergenic
1072423664 10:95310859-95310881 GAGGGGCAATAGCAGAAGCAGGG + Intergenic
1072775196 10:98184258-98184280 GTGAGCAAAGAGCTAAAGCATGG - Intronic
1075255469 10:120923087-120923109 GTGAGCCACCACTTGAAGCAAGG + Intergenic
1076986213 11:237352-237374 GAGGGCCAAGAGCTGTAGCCAGG + Intronic
1077042654 11:531388-531410 GTGGGCCCCCAGCAGAAGCCAGG + Intergenic
1077163214 11:1122911-1122933 GTGGGTCCACGGCTGACGCAGGG - Intergenic
1077501360 11:2911092-2911114 GTGGCCCACCATCTGCAGCAGGG + Intronic
1079291495 11:19192120-19192142 CTGGGCAAGCAGTTGAAGCAAGG + Intronic
1079562274 11:21836923-21836945 GAGGGCCAAGAGCAGAAACAGGG + Intergenic
1083462560 11:62824198-62824220 GTGTGCCAACTGCTGAAAGATGG + Exonic
1085454371 11:76657337-76657359 GTGGGGCAAGAGGTGTAGCAGGG + Intergenic
1087285888 11:96264900-96264922 GTGGGCTTATAGCTGAAGAAAGG - Intronic
1091784844 12:3237085-3237107 GTGGGGCGGCAGCTGAAGCATGG + Intronic
1093349254 12:18077215-18077237 GAGGGGCAACAGCTGAGGAAGGG - Intergenic
1094070041 12:26402981-26403003 GTGGGTCAGCAGCTGAACAAGGG + Intronic
1098929662 12:76396658-76396680 GTGGGAGAACTGCTTAAGCACGG + Intronic
1099551502 12:84050377-84050399 GTGTGCCAACAGCAGATGCAAGG + Intergenic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1106975664 13:35210315-35210337 GTGAGCCAACAGCTAAAGACTGG + Intronic
1108206676 13:48096820-48096842 GTTAGCCAACAGCAGATGCAGGG - Intergenic
1108530702 13:51324820-51324842 GGGTGCCAGCAGCTGATGCAGGG - Intergenic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110437772 13:75494611-75494633 ATAAGCCAACAGCTGAAGAAGGG + Intergenic
1113376509 13:109769324-109769346 GTGGGCTAACATCAGTAGCACGG + Intronic
1115912620 14:38273048-38273070 GGAGGCCAAAAGCTGAAGGATGG - Intergenic
1118773109 14:68955509-68955531 GTGGGCCAACCAGGGAAGCAGGG + Intronic
1121324220 14:93010501-93010523 GTGGGCCAGCAGGTGAAGGGTGG + Intronic
1122459051 14:101880037-101880059 GTGGGCCAGCAACTGAGGCAGGG + Intronic
1128721192 15:69949770-69949792 GTGGGCAATCAGCTGTAGCCTGG + Intergenic
1132632714 16:927603-927625 AAGGGCCATCAGCTAAAGCAGGG + Intronic
1132847503 16:2007207-2007229 GTGGGGGGACAGCAGAAGCAGGG + Intronic
1132915790 16:2342374-2342396 GTGGGTCAAGATCTGAAGCCAGG - Intergenic
1133035919 16:3034228-3034250 GAGGGCCAGCAGCTGACCCAGGG + Intronic
1134468620 16:14501567-14501589 GTTGGCCAACAGCTGATAGAGGG + Intronic
1134681193 16:16126941-16126963 GAGGGACAACAGCTGATCCAAGG + Intronic
1135109333 16:19678446-19678468 CAGTGCCAACAGCTGAAGTAAGG - Intronic
1135125086 16:19802789-19802811 GTGGGACAACAGCAAACGCATGG - Intronic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1137421092 16:48334697-48334719 GAGGGCAAACAGCTGAAGGATGG - Intronic
1138020056 16:53470574-53470596 GGTGGCCAACAGCAGAAGCAAGG + Exonic
1138501870 16:57451077-57451099 TTAGCCCCACAGCTGAAGCATGG - Exonic
1138529415 16:57627013-57627035 GTGGGCCAATACCTGGGGCAGGG - Intronic
1141152316 16:81572707-81572729 GTGGGCCACCAGGGCAAGCAGGG - Intronic
1141860964 16:86715977-86715999 GTGAGCCAATAGCAGAGGCATGG - Intergenic
1143047669 17:4095151-4095173 ATGGGCCCAGAGGTGAAGCATGG - Intronic
1147550340 17:41437446-41437468 GTGGGCCCACAGGTGGTGCAGGG + Exonic
1150005009 17:61463895-61463917 GTGGGCCAACAGCTGAAGCAGGG - Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1151430194 17:74057118-74057140 GTGGGCCAGCAGCCAAGGCATGG + Intergenic
1152204820 17:78968971-78968993 GTGGGTGAACAGGTGAAGAAGGG + Intergenic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1156449174 18:37257116-37257138 GTGGGCTAACAGCTTAAAGAGGG + Intronic
1156451217 18:37267408-37267430 GTGGGCAAAAGCCTGAAGCATGG + Intronic
1160678591 19:403360-403382 GTGGGCCAAGACCTGAGGCAGGG + Intergenic
1164933008 19:32189660-32189682 GGGAGCTAATAGCTGAAGCAAGG - Intergenic
1168102892 19:54150305-54150327 GGGGGCTAACAGCTGCAGGAAGG + Intronic
930635153 2:53796551-53796573 GTGGGAGAACAGCTTGAGCATGG - Intronic
930710835 2:54549806-54549828 GAGGGCCAAGAGCAGAGGCATGG + Intronic
936668317 2:114624870-114624892 GTGGAGCAACAGATGAACCAAGG - Intronic
937453230 2:122019640-122019662 GTGGGCCACCTGCTGCTGCAGGG + Intergenic
938294832 2:130171702-130171724 GTGGGCCAGCATCTGCAGGAAGG + Intronic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1170498526 20:16950686-16950708 CTGTGCCACCAGCTGATGCAGGG - Intergenic
1171423409 20:25033964-25033986 TGGGCCCAAGAGCTGAAGCAGGG + Intronic
1173268191 20:41506174-41506196 GTGGGGCAAGAACTGAAGCAGGG - Intronic
1174000795 20:47373172-47373194 GTTGTCCAACAGGTAAAGCAGGG + Intergenic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1174347358 20:49940309-49940331 ATGGGCCAACATCTGTAACAAGG + Intronic
1175687827 20:61044316-61044338 GAGGCCCAGAAGCTGAAGCAGGG - Intergenic
1175832826 20:61976461-61976483 GTAGGCCCACAGCTGGAGCTGGG + Intronic
1175852712 20:62102412-62102434 CTGGCCCAAGAGCTGAAGCCCGG + Intergenic
1178375036 21:32059628-32059650 GTGTGCAAAGAGCTGAAGGACGG + Intergenic
1178611690 21:34087757-34087779 GTGGGCCAAGGGCAGAAGCATGG + Intronic
1181114099 22:20620581-20620603 GTGGGCCAGCATCTGCAGGAAGG + Intergenic
1181982505 22:26775466-26775488 GTGGGACATCAGCAGGAGCAAGG + Intergenic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
949892814 3:8745874-8745896 GTGGGGCAACAGCGGTGGCAGGG + Exonic
949930850 3:9077330-9077352 GTGGGCCCAGAGCTGCAGTAGGG - Intronic
958058234 3:88441436-88441458 TTGGTACAACAGCTGAAGGAAGG - Intergenic
958081072 3:88747055-88747077 GTGGAGCACAAGCTGAAGCAGGG + Intergenic
959515886 3:107266687-107266709 CTGGGCCAGCAGCTGAATGATGG + Intergenic
962257676 3:133883602-133883624 GAGGGCAAACAGGGGAAGCAAGG - Intronic
963093577 3:141510964-141510986 GAGGGCCAAAAGTGGAAGCAGGG + Intronic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
963387985 3:144620591-144620613 GTGAGCCATGAGCTAAAGCAAGG - Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967693633 3:192506064-192506086 GTGGGTCAAAAGGTGAAGCAGGG + Intronic
969284889 4:6196961-6196983 GTGGGGCAACATCTGAGGCCCGG + Intronic
969938012 4:10702193-10702215 GTGGGTAAAGACCTGAAGCAAGG + Intergenic
969987061 4:11223358-11223380 TTGGGGCAACTGCTGGAGCAGGG + Intergenic
972287917 4:37666255-37666277 CTGGGCCAACATTTGAACCAAGG + Intronic
979431905 4:120642468-120642490 GTGGGCCAACAGGCAAAGAAAGG - Intergenic
980985722 4:139692399-139692421 GCTGGCAAGCAGCTGAAGCAAGG + Intronic
981223257 4:142261622-142261644 GTGGGGAAATAGCTCAAGCAAGG - Intronic
981938592 4:150258388-150258410 CTAGGCCCACAGCTGTAGCAGGG + Intergenic
983553927 4:169043254-169043276 GAGGGGCAAGAGTTGAAGCAAGG - Intergenic
985999699 5:3620699-3620721 GTGGGACAAGAGCTTAAGCTGGG + Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
986111196 5:4720149-4720171 TTGGGCAAAGAACTGAAGCATGG - Intergenic
986402963 5:7396648-7396670 GCGGGCCAGCAGGAGAAGCAGGG - Intronic
987710540 5:21497290-21497312 GTGAGCCCAAAGCTGAAGCAAGG - Intergenic
987952039 5:24687753-24687775 GGGGGCCTACAGCTGCAACAGGG + Intergenic
987962834 5:24832422-24832444 GTGGGGTAAAGGCTGAAGCAGGG - Intergenic
988479058 5:31614217-31614239 GAGTGCCAACAGCTGAGGCCTGG - Intergenic
991760870 5:69916349-69916371 GTGAGCCCAAAGCTGAAGCAAGG - Intergenic
991786460 5:70201752-70201774 GTGAGCCCAAAGCTGAAGCAAGG + Intergenic
991840099 5:70791400-70791422 GTGAGCCCAAAGCTGAAGCAAGG - Intergenic
991878903 5:71202137-71202159 GTGAGCCCAAAGCTGAAGCAAGG + Intergenic
993052403 5:82940699-82940721 GTGGGCAATCAGCTCAAGCTAGG - Intergenic
994131466 5:96234037-96234059 GTGTGCCCACTTCTGAAGCAGGG - Intergenic
995341592 5:111066922-111066944 GTGAGCCAACAGCTGGAGAGTGG + Intergenic
995590056 5:113690094-113690116 GTGAGCCACCAAATGAAGCAAGG - Intergenic
1000072811 5:157756689-157756711 GTGGGGAAAAAGCTGAGGCACGG - Exonic
1003206967 6:4021484-4021506 GTGGGCCAGAAGCTGGAGCCCGG + Intronic
1003295751 6:4825921-4825943 GTGGTCTCACAGCTGAAACAAGG - Intronic
1003345616 6:5263558-5263580 TTGGGCCAGAAGCTGAAGAATGG + Intronic
1005547149 6:26883227-26883249 GTGAGCCCAAAGCTGAAGCAAGG + Intergenic
1006026928 6:31152901-31152923 GTGGGACAACAGGTGAAGGCGGG - Intronic
1006327415 6:33364974-33364996 GTGGGGAAACAGCTGAGGGAAGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006432672 6:34007570-34007592 GACGGCCAAGAGCTGAAGCGGGG + Intergenic
1009017911 6:57924301-57924323 GTGAGCCCAAAGCTGAAGCGAGG + Intergenic
1009598887 6:65772194-65772216 GTGGGGCAACAGCAGAAGTTGGG - Intergenic
1014586299 6:123202092-123202114 CTGGGCCAGCAGCTGCAGAAGGG + Intergenic
1016920518 6:149288796-149288818 GAGGGGCAAGAGCAGAAGCAGGG - Intronic
1019640910 7:2103191-2103213 GTGGGCTGAGAGCTGAAGCGTGG - Intronic
1020673229 7:11146383-11146405 ATGGGGCAACAGCTGGAGAAGGG - Intronic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022380570 7:29855558-29855580 GGGAGCCAACAGCTGCTGCATGG - Intronic
1023674620 7:42616855-42616877 GTGGGGCCACAGGTGAAGCAGGG + Intergenic
1034432371 7:151047575-151047597 GTGGCCCAGCAGTTGCAGCATGG + Intronic
1034936632 7:155204338-155204360 GTGTGGCACCAGGTGAAGCAGGG + Intergenic
1039880980 8:41625529-41625551 GTGGGCCAATAGCTGAAGACTGG + Intergenic
1040101882 8:43513040-43513062 GTGGGCCACCAGCAGCAGCCAGG + Intergenic
1041053251 8:53957535-53957557 GTGGGCCAGCAGGGGAAGCCTGG + Intronic
1041489008 8:58411236-58411258 GTGGGCCAGCACCGGAAGCGGGG + Intergenic
1042229473 8:66541883-66541905 GTGCGGCTACAGCTGGAGCATGG + Intergenic
1047258722 8:123236969-123236991 GCGGGCAAACAGCTGGAGGATGG + Intronic
1047755691 8:127916736-127916758 GTGGGCCATCACCTTAAGCTTGG + Intergenic
1049168091 8:141139429-141139451 GTGTGCCAAGAGCAGAACCAAGG + Intronic
1049169246 8:141148349-141148371 ATGGACCAACAGCCGGAGCAGGG + Intronic
1051476607 9:17515784-17515806 ATAGAGCAACAGCTGAAGCAGGG - Intergenic
1052791260 9:32877354-32877376 GTGTTCTAACAGCTGAGGCATGG + Intergenic
1055011615 9:71572638-71572660 GTGGGAGAACAGCTTAAGCCTGG + Intergenic
1056847873 9:90056157-90056179 TTGGGCCAACACCTGAGGGAAGG - Intergenic
1059213839 9:112540946-112540968 GTGGGCCAACCGCTTGAGCCAGG - Intronic
1059358424 9:113719363-113719385 ATGGGCCCACAGTTGAGGCAGGG - Intergenic
1060770415 9:126327629-126327651 CTGGGACAAGAGCTGAGGCATGG + Intronic
1060824221 9:126678441-126678463 GTGGGGCCCCAGCTGAAGCTGGG + Intronic
1061722866 9:132563927-132563949 GGGGTCCCACAGCTGAAGAAAGG - Intronic
1062463806 9:136672540-136672562 GTGGGCCCTCAGCTGAGGGAAGG + Exonic
1185760768 X:2688787-2688809 ATGGGCCAATAGATGAGGCAGGG + Intergenic
1188543137 X:31271395-31271417 AAGGGCCAACAGCTGAAACTAGG + Intronic
1190216127 X:48480596-48480618 GAGGGCCAAGGGCAGAAGCAGGG + Intronic
1192312760 X:70030077-70030099 GTGGCCACACAGCTGTAGCAAGG - Intronic
1192493635 X:71598323-71598345 GTGGGTCAAGAGCTGAGGCTAGG + Intronic
1196765961 X:119243165-119243187 GTGGGCAAACTGCTGAAGGAGGG + Exonic
1202303239 Y:23440312-23440334 GTGGGTCATCAGCTGAACCCTGG + Intergenic
1202567572 Y:26230282-26230304 GTGGGTCATCAGCTGAACCCTGG - Intergenic