ID: 1150007736

View in Genome Browser
Species Human (GRCh38)
Location 17:61479985-61480007
Sequence CTGGGGGTGGGGCGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1723
Summary {0: 1, 1: 2, 2: 20, 3: 194, 4: 1506}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150007719_1150007736 16 Left 1150007719 17:61479946-61479968 CCTGCGTGTGGCCCGACTGCAGA 0: 1
1: 0
2: 1
3: 1
4: 62
Right 1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG 0: 1
1: 2
2: 20
3: 194
4: 1506
1150007724_1150007736 5 Left 1150007724 17:61479957-61479979 CCCGACTGCAGAGGTGGGGCTGC 0: 1
1: 0
2: 1
3: 39
4: 273
Right 1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG 0: 1
1: 2
2: 20
3: 194
4: 1506
1150007725_1150007736 4 Left 1150007725 17:61479958-61479980 CCGACTGCAGAGGTGGGGCTGCG 0: 1
1: 0
2: 0
3: 18
4: 229
Right 1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG 0: 1
1: 2
2: 20
3: 194
4: 1506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150007736 Original CRISPR CTGGGGGTGGGGCGGGCAGA TGG Intronic
900102370 1:967366-967388 CTGGGGGGGGGGTGGGCATGGGG - Intronic
900252514 1:1678494-1678516 CTGGCGGTGTGATGGGCAGACGG - Intronic
900291794 1:1926800-1926822 CTGGGGCCTGGGCGGGCAGGGGG - Intronic
900327122 1:2113846-2113868 CTGGTGTTGGGGCAGGGAGAAGG + Intronic
900388141 1:2419957-2419979 CTGGGGGTGGGGGGGGGACTTGG - Intergenic
900394278 1:2446750-2446772 GAGGGGTTGGGGCTGGCAGAGGG + Intronic
900465734 1:2824681-2824703 CTGGAGGTGGGGCCGGCGGGAGG - Intergenic
900550045 1:3250120-3250142 CTGGGAGTGGGGTGGGGGGAGGG - Intronic
900754630 1:4425034-4425056 CTGAGGGTGGCGCAGGCTGAGGG + Intergenic
900827942 1:4941533-4941555 CCAGGGGTGGGGCGGGCTGCGGG - Intergenic
901022212 1:6261151-6261173 GCGGGGGCGGGGCGGGCCGAGGG - Intergenic
901050172 1:6421986-6422008 CTAGGGGTGCTGTGGGCAGAAGG + Intronic
901125895 1:6928520-6928542 GTTAGGGTGGGGAGGGCAGATGG - Intronic
901229275 1:7633004-7633026 GAGGGGGTGAGGCAGGCAGAGGG - Intronic
901420905 1:9150439-9150461 CTGGGGGTGGGGGTCGCAGCAGG + Intergenic
901441352 1:9280380-9280402 GTGGGGGCGGGGCGGGGAGTGGG - Intergenic
901441362 1:9280398-9280420 GTGGGGGCGGGGCGGGGAGTGGG - Intergenic
901441372 1:9280416-9280438 GTGGGGGCGGGGCGGGGAGTGGG - Intergenic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902481185 1:16712764-16712786 CTGGCAGTGGGGCGGGCTGCGGG - Intergenic
902512506 1:16974149-16974171 CATGGGGTGGGGGGGGCACAGGG - Intergenic
902555218 1:17242876-17242898 GTGGGGGTGGGGCATGCAGGGGG - Intronic
902818476 1:18929345-18929367 CTGGGGGAGGGAGGGGCAAATGG + Intronic
902917059 1:19645331-19645353 CTGGGAGCGGGCCGGGCAGGTGG - Intronic
903010188 1:20324365-20324387 CTGGGGGTGGGGCAGGGGGCAGG - Intronic
903139866 1:21332840-21332862 ATGGGGGTGGGGTGGGCGGATGG + Intronic
903265288 1:22154320-22154342 CTGGGGGTGGAGTGGGCACCGGG + Intergenic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903548767 1:24143173-24143195 CCGGGCATGGGGCGGGGAGAAGG + Intergenic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903667737 1:25018178-25018200 CTAGGGGTGGGGTGAGAAGAGGG - Intergenic
903835347 1:26200062-26200084 CGTGGGATGGGGAGGGCAGAAGG + Intronic
903866060 1:26398702-26398724 ATGGGGGTGTGGGGGGCAGGGGG + Intergenic
903914369 1:26752708-26752730 CTAGGGGCGGGGCGGGGATAAGG + Intronic
903917314 1:26773842-26773864 CTGGGGAAGGGGCTGCCAGAAGG - Exonic
904041823 1:27589900-27589922 GTGGGGGTGCTGAGGGCAGAAGG - Intronic
904054487 1:27661066-27661088 ATGGGGGTGGGTGAGGCAGAGGG + Intergenic
904089675 1:27935957-27935979 GTGGGGGTGAGGTTGGCAGATGG + Intronic
904370441 1:30044589-30044611 CTGGGAGTGGGGCAGGGAGACGG + Intergenic
904619264 1:31765642-31765664 CTGGAGGTGGGAGGGACAGAAGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904916970 1:33977218-33977240 CTGGGTGGGGAGTGGGCAGATGG + Intronic
905123706 1:35702460-35702482 CGGGGGGTGGGGGGGGGAGTCGG - Intergenic
905203222 1:36327853-36327875 CAGGGGGTGGGGAGGGCATGTGG - Exonic
905336058 1:37245349-37245371 CTGCAGGTGGGGCTGGGAGAAGG - Intergenic
905408404 1:37752847-37752869 CTCGGGGTGGGGGGCGCGGACGG + Intronic
905738102 1:40344782-40344804 CTCAGGGTGGGGGCGGCAGAGGG + Intergenic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906111144 1:43322860-43322882 CTGGGGATGGGGTGGGCTTAGGG + Exonic
906293094 1:44632402-44632424 CCGGGGGTGGGGCGGAGGGAGGG - Intronic
906479926 1:46193216-46193238 CTGGGAGTGGGGTGGGAATAGGG + Intronic
906490784 1:46266844-46266866 CTGGAGGTGGGGCAGGGAAAGGG + Intronic
906523440 1:46480216-46480238 CTGGGGCTAGGGGGGTCAGAGGG - Intergenic
906564741 1:46790891-46790913 GTGGGGGTGGGGCCTGCAGAAGG - Intronic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
907240660 1:53079220-53079242 CAGGAGGTGGGTCAGGCAGAGGG + Intronic
907366352 1:53963937-53963959 ATGGGGGGGGGGTGGGCAGGAGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907430238 1:54406952-54406974 CCGGGGGCGGGGCGGGCTGGGGG - Intronic
907493380 1:54825538-54825560 CTGGGGGTGGGGGTGCCAGGTGG + Intronic
907556992 1:55352650-55352672 CTGGGGATGAGGCCGCCAGAAGG - Intergenic
907733639 1:57091011-57091033 TTTGGGGTGGGGCGGGGTGAGGG - Intronic
907752134 1:57272828-57272850 TTGGGTGTGGGGCGGGCAGTAGG + Intronic
907787594 1:57627823-57627845 CTGAGGGTGGGGTGGGCAACAGG + Intronic
908142803 1:61204658-61204680 CCAAGGGTGGGGGGGGCAGAAGG - Intronic
908548996 1:65190448-65190470 TTGGGGGGGGGGCGGGAGGAGGG + Intronic
908643361 1:66249661-66249683 CAGGGGGTGGGGCGGGTGGTGGG - Intronic
908817779 1:68051643-68051665 CTGGCGGTGGGAGGCGCAGAGGG - Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909564406 1:77038895-77038917 CTGGGGGTGGGCAGGGGTGATGG + Intronic
909600404 1:77455765-77455787 CTGGGGGTGGGGCGTGAACGTGG - Intronic
910445640 1:87296895-87296917 CACGGGATGGGGCGGGGAGATGG - Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
911400653 1:97370414-97370436 TTGGGGGTTGGGGGGTCAGAGGG + Intronic
911669932 1:100596426-100596448 CTGGGGGTGGAGTGGGCAGGGGG - Intergenic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
913063913 1:115232255-115232277 ATGGGGATGGGGAGGGCAGAGGG + Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913201245 1:116496612-116496634 CTGGGGGTGGGGTTGGCAAGGGG - Intergenic
913248427 1:116890898-116890920 CAGGGGCTGGGGAGAGCAGAAGG - Intergenic
913283001 1:117203234-117203256 CTGAGGCTGGGGTGGGGAGAAGG + Intronic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
913696334 1:121329484-121329506 CTGGGGTTGGGGCAAGCAGCTGG + Intronic
913975540 1:143451740-143451762 CTGGGGGTGGGGGGGGTGGGGGG - Intergenic
914005559 1:143729651-143729673 CTGGGGGTGGGGGGGGGGGGGGG - Intergenic
914069934 1:144277357-144277379 CTGGGGGTGGGGGGGGGTGGGGG - Intergenic
914109221 1:144688997-144689019 CTGGGGGTGGGGGGGGGTGGGGG + Intergenic
914141227 1:144950569-144950591 CTGGGGTTGGGGCAAGCAGCTGG - Intronic
914300951 1:146376703-146376725 CTGGGGGTGGGGGGGGGTGGGGG + Intergenic
914959602 1:152194680-152194702 GGGGGGGTGGGGAGGGGAGAGGG - Intergenic
915214558 1:154331189-154331211 ATGGGGGTGGGGCTGGGAGTAGG - Intronic
915347879 1:155207351-155207373 CTGGTGGTGGGATGGGCCGATGG - Intronic
915384492 1:155477512-155477534 CTTGGGGTGGTGGGGGCAGGGGG + Intronic
915463809 1:156084328-156084350 CGGGGGGTGGTGGGGGCAGTTGG + Intronic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
915755488 1:158255613-158255635 CTGGTTGTAGGGCAGGCAGAAGG - Intronic
915848924 1:159299979-159300001 GTGGGGGTGGGCTGGGAAGATGG + Intronic
915852701 1:159343049-159343071 GTGGGGGGGGGGCGGGCGGAGGG + Intergenic
916086631 1:161275009-161275031 CGGGGGGTGGGGGGACCAGATGG + Intronic
916472347 1:165136805-165136827 TTGGGGGTGGGGGAGGCACATGG + Intergenic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916719585 1:167474206-167474228 CTGGGGGTGGGGCTGGGAAGGGG + Intronic
917345263 1:174022433-174022455 CAGGAGGCGGGGCGGGCGGAGGG + Intergenic
917452509 1:175158607-175158629 CTGGGTTTGGTGCAGGCAGATGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
917654565 1:177113283-177113305 CTGGGGGTTGGGGGGACAGTGGG - Intronic
917967505 1:180187755-180187777 CTCGGGGTAGGGCTGGCAGTGGG + Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918166572 1:181954937-181954959 CTGGGTGGCGGCCGGGCAGAGGG - Intergenic
918177825 1:182060895-182060917 CTGGAGGTGGGGTGGGGAGCGGG - Intronic
918738452 1:188096876-188096898 CTAGGGGTGGGGAGGGTAGGTGG - Intergenic
919051903 1:192521940-192521962 ATGGGGGTGGGGTGGAGAGATGG + Intergenic
919641371 1:200048146-200048168 TTGGGGGTGGGGTGGGGGGAAGG - Intronic
919814444 1:201428744-201428766 CTGGGGGTGGGTGGGGGAGTGGG - Intronic
919898337 1:202024012-202024034 CTGGGGGTGGGGGAGGCTCAAGG - Intergenic
920035086 1:203060391-203060413 CTGGAGGTGGGTGGGGCAGAGGG - Exonic
920041286 1:203099306-203099328 CTGGGGGTGGGGTAGGGAGAGGG - Intronic
920099420 1:203507717-203507739 CTGAGAATGGGGCAGGCAGAGGG - Intronic
920288513 1:204899388-204899410 CTGGGGCTGAGGCCGGCAGCTGG + Intronic
920458359 1:206117528-206117550 CTGGAGGGAGGGGGGGCAGAGGG + Intronic
920483658 1:206347850-206347872 CTGGGGTTGGGGCAAGCAGCTGG + Intronic
920679647 1:208062736-208062758 CTGGGGGTGAGGGTGGGAGAAGG + Intronic
920687832 1:208123078-208123100 CTAGGGCTGGGGCAGGCAGGAGG - Intronic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921338035 1:214107866-214107888 CTGGGGGTGGGGGTGGGAGGCGG - Intergenic
921472842 1:215568479-215568501 CGGGGGGGGGGGGGGGCGGAAGG - Intronic
921642960 1:217578078-217578100 ATGGGGGTGGGGCGGGGGGCGGG + Intronic
921911360 1:220552839-220552861 CAGGGGGTGGAGTGGGCAGGTGG - Intronic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922536408 1:226384249-226384271 CTGGCGGTGGGGTGGGGAGAGGG + Intronic
922572972 1:226644670-226644692 CTGGGCATGGCGGGGGCAGAAGG - Intronic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922707381 1:227796529-227796551 CTGTGGGTGGGGCCGGCAGTAGG - Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923126913 1:231040721-231040743 CTGGGGGTGAGCCGGGAAGCTGG - Intergenic
923132870 1:231092444-231092466 ATGGGGGTGGGGGGGGCGGTGGG + Intergenic
923493777 1:234507346-234507368 CTTGGGGTGGGGCGGGGGGGGGG - Intergenic
923557707 1:235013723-235013745 CTGGAAGAGGGGTGGGCAGATGG + Intergenic
923669689 1:236029797-236029819 GTGAGCCTGGGGCGGGCAGAAGG - Intronic
923796623 1:237163349-237163371 GTGGGGGTGGGGGGGGTAGGGGG - Intronic
924138796 1:241000257-241000279 CTAGGGATGGGGCGGGGTGAGGG + Intronic
924199022 1:241640414-241640436 CGGGGGGTGCGCCGGGCGGAAGG - Intronic
924744474 1:246818929-246818951 CATGGGGTGGGGGGGGCACAGGG + Intergenic
1062842027 10:679425-679447 CTGGGTGTGGGGAGTACAGATGG - Intronic
1062928951 10:1339959-1339981 CTGGGGGTGGGCAGTGGAGAGGG + Intronic
1063233484 10:4088736-4088758 GAGGGGGTGGAGCGGGCACACGG + Intergenic
1063462300 10:6222502-6222524 CCGGGGCTGGGCCGGGCAGGCGG - Intronic
1063680465 10:8182359-8182381 CTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1063944641 10:11165045-11165067 CGGGGGGCGGGGCAGGGAGAGGG + Intronic
1063966718 10:11351790-11351812 TTGGGGGTGGGGGGGGCAAAGGG + Intergenic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064548278 10:16473230-16473252 TTAGAGGTGGGGTGGGCAGAAGG - Intronic
1065099667 10:22321040-22321062 CTGGGGGGGCGGCGGGGGGAGGG + Intronic
1065168414 10:23004776-23004798 CAGGAGGTGGGGGAGGCAGAAGG - Intronic
1065345560 10:24744862-24744884 CTGGAGGTGGGGCCCGCACATGG + Intergenic
1065744990 10:28832188-28832210 CTAGGGGAGGGGCGGGGAGTGGG + Intergenic
1066474966 10:35738144-35738166 ATGATGGTGGGGCAGGCAGAGGG + Intergenic
1067033575 10:42897387-42897409 CTGAGCGTGGGGCAGGAAGAGGG + Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067523827 10:47026737-47026759 GTGGGGAGGGGGAGGGCAGAGGG + Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067704420 10:48596428-48596450 CTTGGGGTGGGGCTGGCTGGAGG + Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067826721 10:49579396-49579418 CCGGGGGTGGGGCGGGGTGGAGG + Intergenic
1067852096 10:49760866-49760888 GTGGGAGTGGCGCTGGCAGAGGG - Intronic
1068531078 10:58187334-58187356 CTGGGGGTGGGGTGGGTCAAGGG - Intergenic
1068731463 10:60363063-60363085 CTGGGGTTGCGGCGGGCGGGCGG + Intronic
1068866777 10:61903178-61903200 GCGGGGGAGGGGAGGGCAGAGGG + Intronic
1068867655 10:61911743-61911765 CTTGGGGGGCAGCGGGCAGAAGG + Intronic
1069035967 10:63646214-63646236 CGGCGGGTGGGGAGGGCAGGGGG + Intergenic
1069581349 10:69569064-69569086 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1069613837 10:69793429-69793451 CAGTGGTGGGGGCGGGCAGAGGG + Intergenic
1069761813 10:70816253-70816275 CGGGGGCGGGGGCGGGCTGAAGG + Intronic
1069789856 10:71012555-71012577 ATGGGGGTGGCGTGGGGAGAAGG + Intergenic
1069853036 10:71422902-71422924 CTGGGGGAGGGCAGAGCAGAGGG + Intronic
1069881780 10:71597889-71597911 GTGGGGGTGGGGCGGGATCATGG - Intronic
1069901958 10:71711421-71711443 CAGGGGGTGGTGCAGGCAGCTGG - Intronic
1069928143 10:71865501-71865523 GCGGGGGTGGGGCTGGGAGAGGG - Intergenic
1070050768 10:72887396-72887418 CTGGGGGTGGTGGAGGGAGAAGG - Exonic
1070140171 10:73732895-73732917 CTGGGGGCGTGGGGGGCAGTGGG - Intergenic
1070319269 10:75342656-75342678 CCGGTGGTGGGGCGGGGGGAGGG + Intergenic
1070425932 10:76287213-76287235 CTGAGAGTGGGGCAGGCAGATGG - Intronic
1070751263 10:78965318-78965340 CTGGGGGCAGGGCGGGGAGGAGG + Intergenic
1070768256 10:79068559-79068581 CTGGGGCTGGGGCCTGCAGGGGG + Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070806693 10:79274956-79274978 CGAGGGGTGGGGCGGGCAGCAGG + Intronic
1070909009 10:80101018-80101040 GTGGGGGTGGGGAGGGCTAATGG + Intergenic
1070954232 10:80454124-80454146 CTGGGGGAGGGGCGGGGCCAGGG + Intergenic
1070957160 10:80471747-80471769 GTGGGGGTGGGGTGGGTAGCAGG + Intronic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1071899891 10:90108747-90108769 GTGGGGGTGGGACGGGAAGGGGG + Intergenic
1072417655 10:95262582-95262604 GTGGGGGTGGGGGTGGCAGCTGG - Intronic
1072618324 10:97064095-97064117 CAGGGGGTGGGTGGGGCAGGAGG - Intronic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1072915953 10:99537400-99537422 CTGGGGGAGGGGGCGGCAGGGGG + Intergenic
1073036331 10:100566609-100566631 GTGGGGGTGAGGCAGGCTGAGGG + Intergenic
1073095743 10:100978706-100978728 TTGGGGGTGGGGTGGTCAGCTGG - Intronic
1073113041 10:101073966-101073988 CTGGGGGAGCTGCGGGCAGGTGG + Intergenic
1073178503 10:101570414-101570436 CTGGGGGCGGGGCGGGTATTGGG - Intergenic
1073288843 10:102403471-102403493 CAGATGGTGGGGTGGGCAGAAGG - Intronic
1073327000 10:102648915-102648937 CTGGGGTAGGGGTGGGCAGCTGG - Intronic
1073465642 10:103693252-103693274 CTGGGGGCCGGGCTGGCAGGGGG - Intronic
1073754876 10:106571018-106571040 CTAGGGGTGGGGGCGGGAGATGG - Intergenic
1074026676 10:109642943-109642965 GTGGGGCTGGGGCAGGAAGAGGG - Intergenic
1074095110 10:110304759-110304781 CTGGGGGCGGGGCGGCGGGAAGG + Exonic
1074116014 10:110458000-110458022 CTGGGTGTGGAGTGGGGAGAGGG + Intergenic
1074153988 10:110782643-110782665 CTGGGGAGGTGGCGGGGAGAAGG - Intronic
1074169602 10:110919545-110919567 GTGGGGGAGGGGCGGGCGGGGGG + Exonic
1074288294 10:112119168-112119190 CTGGGGGTGGGGCTTGCTCAGGG - Intergenic
1074314619 10:112350005-112350027 CTGGTGGCGGGGGGGGCGGAGGG - Intergenic
1074603367 10:114936855-114936877 CTGGGGGTGAGGGATGCAGAGGG - Intergenic
1074704521 10:116119127-116119149 CAGGAGGTGGCGCAGGCAGAAGG + Intronic
1074761533 10:116670308-116670330 CAGGGGGCGGGGCCGGCAGTGGG + Intergenic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1074923819 10:118046804-118046826 CGGGACGTGGGGCGGGCAGCGGG + Intergenic
1075098905 10:119492056-119492078 ATGGGGGTGAGAGGGGCAGAAGG + Intergenic
1075425865 10:122341432-122341454 GAGGGGCTGGGGCGGGCAGGAGG + Intergenic
1075540566 10:123310023-123310045 CTGGGTGTGGGGCCAGCAGTGGG + Intergenic
1075645214 10:124092459-124092481 GTGGGGGCGGGGCGGGGAGGAGG + Intronic
1075664440 10:124220700-124220722 CTGGGTGCAGGGCTGGCAGAGGG - Intergenic
1075723302 10:124599481-124599503 CTGGAGGCGGGACTGGCAGAGGG - Intronic
1075823516 10:125334237-125334259 GTGGGGGTGGGTGGGGGAGAAGG + Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076075867 10:127533451-127533473 CTGGGGGTGGGCCTGGCATCAGG + Intergenic
1076149334 10:128150020-128150042 CTGCAGGTGGGGCGGGCTGGGGG - Intergenic
1076371818 10:129960132-129960154 CTGGGGGAGGGGCGGGAGGCTGG + Intronic
1076483873 10:130803110-130803132 CTGCTGGTGGGGTGGGCAGTGGG + Intergenic
1076507652 10:130988340-130988362 CTGGGGGTGAGGCCGGCTGTGGG - Intergenic
1076508451 10:130994260-130994282 TTTGGGGTGGGGAGGGCAGGGGG + Intergenic
1076596953 10:131629279-131629301 CTGGGGGTGGGGCTGAGGGAAGG + Intergenic
1076653579 10:132006330-132006352 GTGGGGGTGGGGGTGGGAGAGGG + Intergenic
1076696338 10:132249143-132249165 CAGGGGGCGGGGCGTGCAGGGGG + Intronic
1076744046 10:132503945-132503967 CTGGGGGTGTGGTGGACAGGTGG - Intergenic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076826634 10:132972747-132972769 CTGGGGCTGGGCTGGGTAGACGG + Intergenic
1076996873 11:301662-301684 CTGGGGGTGGGGGGGGTGGGGGG + Intergenic
1077020588 11:415587-415609 CTGGGAGAGGGACGGGGAGAGGG - Intronic
1077032742 11:477015-477037 CTGGGTGGGGGGCAGGGAGAAGG + Intronic
1077100898 11:821886-821908 GTGGCGGTGGGGGGGGCAGTGGG + Intronic
1077122588 11:916964-916986 GTGGGGGTGGGGCCTCCAGAAGG + Intergenic
1077143449 11:1034847-1034869 CTGCGGGTGGGGCAGGGCGAGGG - Intronic
1077184121 11:1228837-1228859 CTGGGGGTGGGGAGGCCTGGGGG + Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077233763 11:1470208-1470230 GTGGGGATGGGGCCGGCAGCGGG - Exonic
1077282978 11:1753951-1753973 CTGGGGCTGGGGCTGGCAGGGGG - Intronic
1077302735 11:1854761-1854783 CTGGGGGTGGTGCTGACAGGAGG - Intronic
1077333326 11:1992921-1992943 CTCAGGGTGAGGCGGGCAGGCGG - Intergenic
1077393367 11:2309830-2309852 CTGGGGGTGGGGGGAGCTCAAGG + Intronic
1077455163 11:2673977-2673999 TTGGGGGTGGGGTGGGGGGAGGG + Intronic
1077780081 11:5318264-5318286 GTGGGGGTGGGGGGTGGAGAGGG - Intronic
1078250133 11:9609956-9609978 GTGGGGGAGGGGATGGCAGATGG + Intergenic
1078324754 11:10370395-10370417 CTGGAGCTGGAGAGGGCAGAGGG + Intronic
1078759539 11:14241443-14241465 CTGGAGATGGGGTGGCCAGAGGG + Intronic
1079580390 11:22056125-22056147 GTGGGAGTGGGGCTCGCAGAAGG + Intergenic
1079773675 11:24496949-24496971 CTGGAGGCGGCGCGGGGAGAGGG - Intronic
1080321876 11:31019480-31019502 GTGGGGGTGGGGTGGGGAGGTGG + Intronic
1080330366 11:31130435-31130457 CATGGGGTGGGGTGGGCAGGCGG - Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080505723 11:32911282-32911304 CTGGGGGTGGTGGGGGAAGACGG + Intronic
1080647511 11:34197543-34197565 TGGGGGGCGGGGAGGGCAGAGGG + Intronic
1080700903 11:34643265-34643287 CTGGTGGTGGGGCGTATAGAGGG + Intronic
1080779111 11:35414524-35414546 CGGGGTGAGGGGCGGGCAGAGGG + Intronic
1081442356 11:43094220-43094242 CTTGGAGTGGGCTGGGCAGAAGG - Intergenic
1081537208 11:44004685-44004707 CTGAGGATAGGGCGGGCAGATGG - Intergenic
1081703895 11:45169051-45169073 TTCGGGGTGAGGCAGGCAGAGGG - Intronic
1081968272 11:47182605-47182627 TTGGGGCTGGGGCTGTCAGATGG + Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082175616 11:49055668-49055690 CAGGGGGTGTGATGGGCAGAGGG - Intronic
1082771468 11:57210949-57210971 CTGGGGGTGGGGCAAGGAAAGGG + Intergenic
1083171562 11:60926582-60926604 CTGGGGGTGGGGTGGGGACCAGG - Intronic
1083259921 11:61517372-61517394 CTGTGAGTGAGTCGGGCAGAAGG + Intronic
1083277035 11:61602747-61602769 CTGGGGCTGGGTGGGGCAAAAGG + Intergenic
1083278625 11:61611652-61611674 CTGGGGGTGGGGGTGGCCCAGGG - Intergenic
1083335555 11:61919722-61919744 CTTGGGATGGAGCAGGCAGAGGG - Intronic
1083594219 11:63911414-63911436 CAGGGGGGGAGGTGGGCAGAGGG - Exonic
1083597030 11:63922870-63922892 CTGGGCATGGGGCATGCAGATGG - Intergenic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083656566 11:64232629-64232651 CTGGGGGTGGGGCAAGCTGAGGG - Intronic
1083730293 11:64649099-64649121 CTGGGAGGGGAGCAGGCAGATGG - Intronic
1083741714 11:64714734-64714756 TTGGGTGGGGGGTGGGCAGAGGG - Intronic
1083750704 11:64759204-64759226 GTGGGGGAGGGGCGGGCAGACGG - Intronic
1083923434 11:65792473-65792495 CTGGGGGTGGGCAGGGGCGATGG - Intronic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084063961 11:66692920-66692942 CTGGGGGTGGAGCCGGCTGCAGG - Intronic
1084128394 11:67116356-67116378 TTGGGGGGGGGGCGGGGAGATGG + Intergenic
1084187754 11:67483839-67483861 TTGGGGGAGAAGCGGGCAGAGGG - Intronic
1084220420 11:67674399-67674421 AGGGGTGAGGGGCGGGCAGAGGG - Intronic
1084403084 11:68956138-68956160 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084403101 11:68956168-68956190 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084422002 11:69065176-69065198 CTGTGGGTGGTGGGGGCAGCTGG + Intronic
1084532239 11:69734299-69734321 ATGGGGGTGGGGGGTGTAGATGG + Intergenic
1084563775 11:69918494-69918516 GTGGGGGTGGGGCGTGCTGAGGG - Intergenic
1084621111 11:70270787-70270809 CGCGGCGTGGGGCGGGCAGGCGG + Exonic
1084662519 11:70554542-70554564 CTGGGGGAGGGGGGAGGAGAGGG - Intronic
1084708438 11:70829494-70829516 GTGGGGGTGGGCGGGGCAGAGGG - Intronic
1084741878 11:71145531-71145553 CTGGGGGTGGGCTGAGCAGAGGG + Intronic
1085015144 11:73169134-73169156 ACGGGGGTGGGGCAGGCAGGAGG + Intergenic
1085034719 11:73292966-73292988 CGGGGGGTGGGGGGGGGAGGTGG + Intronic
1085063646 11:73472097-73472119 GTGGAGATGGGGCGGGGAGAGGG - Intronic
1085201502 11:74704924-74704946 TTGGGGTTGGGGTGGGCAGAGGG + Intronic
1085309021 11:75505331-75505353 CTGGGGGTGGGGCTGGGGGCCGG - Intronic
1085699080 11:78730213-78730235 CTGGTGGTGGTGCTGGCAGGAGG + Intronic
1085842567 11:80029233-80029255 CTGGGAGTGTGGCTGGCAGATGG - Intergenic
1086436169 11:86782885-86782907 CTTGGGGTGGGGAGTGGAGAAGG + Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1086976941 11:93142943-93142965 TTGGGGGTGGGGTGGGAGGAGGG + Intergenic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1088433739 11:109787563-109787585 CTGGGGGTGGGTGGGCAAGATGG - Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088905838 11:114155163-114155185 TGGGCGGTGGGGCAGGCAGAAGG - Intronic
1089201869 11:116729533-116729555 CTGGGGGTGGAGCAGGGAGATGG + Intergenic
1089258036 11:117204375-117204397 CTGGGGGAGGGCCGGGCTCAGGG - Exonic
1089377800 11:118007097-118007119 GTGGGGGTGGGGAGTGGAGAAGG - Intergenic
1089402235 11:118171039-118171061 CCAGGGGCGGGGCTGGCAGAAGG - Intronic
1089418484 11:118313681-118313703 TGGGGGGTGGGGTGGGGAGAGGG - Intronic
1089479429 11:118792230-118792252 CTGGGGGTGAGGCGGGGGCAGGG + Intergenic
1089494137 11:118899935-118899957 GTGGTGGTGGGGGGGGCAGCAGG + Exonic
1089504818 11:118956243-118956265 CTGGGGGTGGGAGGGGCTGGAGG - Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089648571 11:119896554-119896576 ATGGGGGTGGAGCTGGCAGGTGG + Intergenic
1089650794 11:119911495-119911517 GTGGGACTGGGGAGGGCAGATGG - Intergenic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089928645 11:122285843-122285865 CTGGGGATGCTGCAGGCAGAGGG + Intergenic
1090065488 11:123499706-123499728 ATGGTGGTGGGGTGGGGAGATGG + Intergenic
1090096401 11:123746002-123746024 CTGGGGGTGAGGTTGGGAGATGG + Intergenic
1090105651 11:123851733-123851755 CTGGGGGTGGGGGCAGCAGACGG + Intergenic
1090233718 11:125129798-125129820 CCAGGAGAGGGGCGGGCAGAGGG + Intergenic
1090257205 11:125293134-125293156 CTGGGGGTGGGGTGGACGAATGG + Intronic
1091146664 11:133286099-133286121 CAGGGGCTGGGTGGGGCAGAAGG - Intronic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091222102 11:133935782-133935804 CAGGGGGTTGGGCGAGCAGAAGG + Intronic
1091273042 11:134331732-134331754 CCGGGGGCGGGGCGGGGACAAGG - Intergenic
1202816306 11_KI270721v1_random:48102-48124 CTCAGGGTGAGGCGGGCAGGCGG - Intergenic
1091408013 12:220991-221013 CTGGGGGTGGCGGGAGCCGAGGG + Exonic
1091586203 12:1818236-1818258 CTGGGTGGTGGCCGGGCAGAGGG - Intronic
1091702768 12:2674692-2674714 CTGGAGGAGAGGCAGGCAGAGGG - Intronic
1091706307 12:2695644-2695666 CTGGGGCTGGGGAGGGCAGTGGG - Intronic
1091711535 12:2743873-2743895 CTGGGGCTGGGGAGGGCAGTGGG - Intergenic
1091718569 12:2795964-2795986 CGGGGTGTGGGGCGGGGAGGAGG + Intronic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1092170602 12:6371562-6371584 GTGGGGGTGGGGCGGGGGGCGGG + Intronic
1092205953 12:6614215-6614237 CACGGGGTGGGGCTGGGAGAGGG - Intergenic
1092728132 12:11504440-11504462 CTGGGGCTGGGAAGGGCAGCAGG + Intergenic
1092793100 12:12086402-12086424 GGGGAGGTGGGGTGGGCAGATGG - Intronic
1092815177 12:12306334-12306356 CTGGGGATGGGGCCAGGAGAGGG + Intergenic
1092880696 12:12885675-12885697 CTGGGTGTGGGGCGGGGGGGCGG + Intergenic
1093081904 12:14822002-14822024 GTGGGGGTGGGGTGGGGAGTAGG + Intronic
1093398648 12:18715167-18715189 GTGGGGGGGGGGGGGGCGGAGGG + Intronic
1093692255 12:22121767-22121789 GTGGGGGTGGAGTGGGAAGATGG + Intronic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1093881928 12:24414588-24414610 CTGGGTGAGAGGCAGGCAGATGG - Intergenic
1093926297 12:24911693-24911715 CGAGGGGTGGGGAGGGAAGAGGG - Intronic
1094497404 12:30997067-30997089 CTGGGGGTGAGGCTTGCAGTAGG - Intergenic
1094554997 12:31490245-31490267 ATGGGGGTGGCGGGGGCAAAAGG + Intronic
1094626855 12:32132607-32132629 TTGGCGTTGGGGCGGGCAGTGGG - Intronic
1095113790 12:38330266-38330288 CTGGGTGGCGGCCGGGCAGAGGG + Intergenic
1095703276 12:45212825-45212847 CGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1095800939 12:46269322-46269344 ATGGGGGTGGGGCGGCTAAAGGG + Intronic
1095818383 12:46450003-46450025 CGGGGGGAGGGGGTGGCAGAGGG - Intergenic
1095952105 12:47787228-47787250 CTGGGGGGGGGCCTGGAAGAGGG - Intronic
1096082642 12:48842763-48842785 CGGGGTGGTGGGCGGGCAGAGGG - Intronic
1096098888 12:48957086-48957108 GTGGGGGTGGGGGGCGCACACGG - Intronic
1096154246 12:49332980-49333002 CCTCGGGTGGGGCGGGCAGGAGG + Exonic
1096215943 12:49797334-49797356 CTGGGGGTGGGGCGGCTGGGGGG + Exonic
1096493247 12:52024215-52024237 GTGGGGCTGGGGCAGGGAGAAGG - Intronic
1096529259 12:52233097-52233119 CGGCGGGGCGGGCGGGCAGAGGG + Exonic
1096602322 12:52738180-52738202 CGGGGGGTGGGGAGGGGGGAGGG + Intergenic
1096651351 12:53063470-53063492 CTGGGGCTGGGGCTGGGAGCTGG - Intronic
1096718915 12:53506965-53506987 CTGGGGGTGGAAAGGGCAGGAGG - Intronic
1096780889 12:53991496-53991518 CTGGGGGTGGGGCAGGTATTTGG + Intronic
1097059531 12:56272224-56272246 TGGGGGGTGGGGAGGTCAGAAGG + Exonic
1097190486 12:57217102-57217124 CTGGGGGCGGGGCGGGCGCACGG - Intronic
1097214325 12:57398110-57398132 GTGGGGGTGGGCAGGGGAGAGGG + Intronic
1097232246 12:57520000-57520022 TTGGGGGTGGGGTAGGGAGAAGG + Intronic
1097246357 12:57609834-57609856 GTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1097264188 12:57736452-57736474 CTGGGGAGGGGGTGGGCAGTGGG + Intronic
1097336016 12:58384089-58384111 CTGGGGGTGTGGCTGGCACAGGG - Intergenic
1098007640 12:66015622-66015644 CTTGGGTTGGGGTGGGCTGAAGG + Intergenic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1098061943 12:66572414-66572436 TTGGGGGTGGGGTGGGAGGAAGG - Intronic
1098733885 12:74071997-74072019 CCGGGGGTGGGGTGGGGGGAGGG + Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1099494992 12:83335755-83335777 ATGGGGGTGGGGTGGGCTGTAGG + Intergenic
1099853724 12:88138193-88138215 ATTGGGGTTGGGTGGGCAGAAGG - Intronic
1099973599 12:89524933-89524955 CTGGGGGCCGGGATGGCAGAGGG + Intronic
1100587656 12:95994879-95994901 CTGGGGGTGGCTCCTGCAGATGG - Intronic
1100588096 12:95998100-95998122 ATGGGGGGGGGTGGGGCAGAAGG - Intergenic
1100607785 12:96165972-96165994 CTGGGGGGTGGGAGGACAGACGG - Intergenic
1100729881 12:97453364-97453386 CTGGGGGTGGAGGGGGCGCAGGG - Intergenic
1100769123 12:97901864-97901886 GTGGGGGTGGGGGAGGCAGTAGG + Intergenic
1101135434 12:101739058-101739080 CTCGGCGTGGAGCGGGCAGGAGG + Intronic
1101371052 12:104130913-104130935 TTGGGGGTGGGGAGGGCAGGCGG + Intronic
1101428306 12:104605880-104605902 CAGGAGGTGGGCGGGGCAGAAGG - Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1102025039 12:109709649-109709671 CTGGGGGTGGGGTGGGAGGCTGG + Intergenic
1102072321 12:110031017-110031039 CTGGGGGAGAGGCGGGGGGATGG + Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102370861 12:112381806-112381828 GTGGGCGCGGGGCGGGCAGGTGG - Intronic
1102426456 12:112847974-112847996 AAGGGGGTGGGGCGGGGAGGTGG - Intronic
1102453765 12:113058557-113058579 CTGGAGGTGAGGCAGGGAGATGG - Intronic
1102472531 12:113167781-113167803 ATGGGCGTGGGAGGGGCAGAGGG - Intronic
1102555463 12:113723855-113723877 CAGGGGTTGGGGTGGCCAGAGGG + Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102654469 12:114469909-114469931 CTGGGGATGGGGGTGGGAGAAGG - Intergenic
1102676760 12:114664726-114664748 CTGGGGGCGGGGTGGGCGGGGGG + Intergenic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1102771500 12:115481233-115481255 CTGGGGGCTGGGAGGGCACATGG - Intergenic
1102988667 12:117299016-117299038 CTGGGGCTGAGCTGGGCAGAGGG + Intronic
1103188726 12:118982268-118982290 CTGAGGGTGGGCGGTGCAGATGG + Intronic
1103232156 12:119340512-119340534 CAGGGGGTGGGGCGGCAGGAAGG - Intronic
1103565674 12:121814279-121814301 GTGGTGGTGGGGGGGGCAGCGGG - Exonic
1103602089 12:122060637-122060659 CTGGGGGTGGGGTGGGGTCATGG + Exonic
1103705248 12:122867817-122867839 CTGGTGGTGGGGTGCGCAGCAGG - Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103775666 12:123364832-123364854 CTGGGGGAGGGGCGTCAAGATGG - Intronic
1103804737 12:123563472-123563494 CTGGGGGTGGGGGGCACAGGTGG + Intergenic
1103946879 12:124531877-124531899 CTGGGAGTGGGGTGGGGAGGTGG - Intronic
1103993849 12:124816597-124816619 CCAGGGATGGGGCGGGCAGAGGG - Intronic
1104049268 12:125185453-125185475 TTGGGGGTGGGGCGCCCAGGAGG + Intergenic
1104072806 12:125361132-125361154 CTGAGGGTGGGCTGGGCAGCGGG - Intronic
1104075621 12:125387145-125387167 CTGGGGGTGGGGCGGGGAGATGG + Intronic
1104376198 12:128267121-128267143 CCGGGGGCGGGGCGGGCCGGCGG + Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104568397 12:129904315-129904337 CTGGGCGTGGGGCGGCCAGGGGG - Intergenic
1104656083 12:130574963-130574985 CTGGGGGTGGGGGTGGCGGTGGG - Intronic
1104676851 12:130716979-130717001 CTTGGGGTGGGGAGGGGAGCCGG - Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105281530 13:18965367-18965389 CTGGGGGTGGGACAGGAAGGTGG + Intergenic
1105295672 13:19086338-19086360 CTGGGGCGGGGGCGGGGAGGGGG - Intergenic
1105578613 13:21674348-21674370 GTGGGGGTGGGGGGGACAAAGGG + Intronic
1105626513 13:22118034-22118056 CTGGGGGTGGGGCAGGGGTAGGG - Intergenic
1106018092 13:25888069-25888091 CTGGGGGTGGGGCGGGGGGGGGG - Intronic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106626634 13:31427335-31427357 CTGGTGTTGGGGTGGGCAGCTGG - Intergenic
1106840854 13:33683652-33683674 CCTGGGGTGGGGAGGGGAGAAGG + Intergenic
1107031671 13:35860312-35860334 CAGGGGGTGGGGGGTGCATAGGG + Intronic
1107037017 13:35912397-35912419 CTGGGGGTGGGGTGGGCCATAGG - Intronic
1107132523 13:36911614-36911636 CTGGGGGGGGGGGGGGCGGGTGG + Intronic
1107323758 13:39217478-39217500 ATGGGGGTTGGGAGAGCAGAGGG - Intergenic
1107802580 13:44123209-44123231 GTGGGGTTGGGGAGGGCGGAGGG - Intergenic
1107978937 13:45715908-45715930 CTGGGGTTGGGGAGAGCACAGGG - Intergenic
1108545811 13:51492222-51492244 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
1108585554 13:51867000-51867022 CTGGGGGTGGGGAGATTAGATGG + Intergenic
1108863514 13:54892876-54892898 GTTGGGGTGGGGCAGGGAGAAGG - Intergenic
1109025170 13:57146299-57146321 CTTGGGGTGGGGCGGGGGGGGGG - Intronic
1109630974 13:65045599-65045621 GTGGGGTTGGGGCGGGGAGAGGG + Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110082722 13:71336273-71336295 CTAGAGGTGGGGCAGGGAGAAGG - Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1111640081 13:90957597-90957619 GTGGGGGTGGGGGGGGGAGAGGG - Intergenic
1111920810 13:94409460-94409482 CGGGGGGTGGGTGGGGCAGACGG + Intergenic
1111927388 13:94478151-94478173 CTGGGGGTGGGGGGGGCGGGCGG - Intronic
1111998257 13:95186295-95186317 TTGGGGGTGGAGCTAGCAGAGGG + Intronic
1112235508 13:97632562-97632584 TTGGGGGTGGGTTGGGGAGAGGG - Intergenic
1112265573 13:97920359-97920381 CTGGGGGTCGGGGGAGAAGAGGG - Intergenic
1112327216 13:98449892-98449914 CTGGAGGTGGGGGGAGCATAGGG - Intronic
1112570763 13:100590842-100590864 CTGGGGGTGGGGCCCAGAGATGG + Intergenic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113343538 13:109450424-109450446 CTGGGAGTGCTGGGGGCAGAAGG - Intergenic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113574414 13:111383865-111383887 CTGGCTGTGGGGCTGGGAGAAGG + Intergenic
1113578801 13:111413880-111413902 CTGGGTGTGTGGTGGGCATATGG + Intergenic
1113813851 13:113158589-113158611 CTGGGGGAGGTGCCGGCAGCAGG - Intergenic
1113824339 13:113239497-113239519 CCGGGTGAGGGGCGGGCAGCAGG + Exonic
1113906347 13:113821069-113821091 CCGGGGGTGGGGGGGCCAGGCGG - Intronic
1114388352 14:22279177-22279199 ATACGGGTGGGGTGGGCAGACGG - Intergenic
1114544334 14:23487410-23487432 TGGGGGGGGGGGGGGGCAGAAGG + Intronic
1114940444 14:27603712-27603734 GTGGTGGTGAGGCGGGCAGATGG + Intergenic
1115106554 14:29768978-29769000 GTGGTGGTAGGGTGGGCAGAAGG - Intronic
1115445052 14:33480525-33480547 GTGGGGGCGGGGCGGGGAGGGGG - Intronic
1115474330 14:33799621-33799643 CAGGGGCTGGGGCGGGGAGCAGG - Intronic
1115748559 14:36463873-36463895 ATGGGAGTAGGGCGGGCTGAGGG + Intergenic
1115962563 14:38852048-38852070 CTGGGGTAGGGGCTGGCAGGAGG + Intergenic
1116430083 14:44836127-44836149 CCGGGGTGGGGGAGGGCAGAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117326039 14:54669929-54669951 CAGGGGGCTGGGGGGGCAGAAGG - Intronic
1117391406 14:55266332-55266354 CTGGGGGTGGTGGGGGCGGGAGG - Intergenic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118312904 14:64706002-64706024 CTGGGGATGGGGCAGGAAGTTGG + Intronic
1118330595 14:64812650-64812672 CAGTGGGTGGGGCTGGCAGCTGG - Intronic
1118610561 14:67536300-67536322 CTGGGGATGAGGCTGGGAGAAGG - Intronic
1118744024 14:68761330-68761352 TTGGAAGTGGGGCGGGCAGTAGG + Intergenic
1118835245 14:69473351-69473373 CTGCAGCTGGGGCGGGGAGAGGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118980200 14:70710083-70710105 CTGGGAGGTGGGTGGGCAGACGG - Intergenic
1119115982 14:72021922-72021944 TTGAGGGTGGGGGTGGCAGAAGG - Intronic
1119180173 14:72600172-72600194 ATGGGGCTGGGCTGGGCAGAGGG - Intergenic
1119296591 14:73537993-73538015 GTGGTGGTGGGGCGGGAGGAGGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119743639 14:77029053-77029075 TTGGGGGTGGGGTGGGGAGCAGG - Intergenic
1120098773 14:80420438-80420460 CAAGGGGAGGGGCGGGCAAATGG - Intergenic
1120359843 14:83485422-83485444 GCGGGGGGGGGGGGGGCAGAGGG - Intergenic
1121036983 14:90714349-90714371 CTGGGGCAGGGGGTGGCAGAAGG + Intronic
1121050482 14:90816429-90816451 CTGGGGAAGGGGCGGGGAGGCGG + Intronic
1121077789 14:91083865-91083887 ATAGGGGTGGGGTGGACAGAGGG - Intronic
1121120458 14:91372750-91372772 GTGGTGGTGGAGCCGGCAGAGGG - Intronic
1121216831 14:92254964-92254986 CTGGGGATGGAGCCAGCAGATGG - Intergenic
1121568027 14:94925323-94925345 ATGGGGATGGGGCAGGCAGCAGG + Intergenic
1121667866 14:95686338-95686360 GTGGGGGCGGGGCCGGCAGTGGG - Intergenic
1121975092 14:98396098-98396120 TTGGGGGTGGGGAGTGAAGAGGG - Intergenic
1122081046 14:99268272-99268294 GTGGCGGTGGGGAGGGGAGAGGG - Intronic
1122134425 14:99624708-99624730 CTGGGAGTGGTGCGGGGAGGAGG - Intergenic
1122145338 14:99685307-99685329 CTGCGGGGGGGGCGGGGGGAGGG - Intronic
1122349277 14:101078140-101078162 CTGGGGGGGGGGGGGGGTGAGGG + Intergenic
1122412697 14:101534020-101534042 CTGGGGGTGGGGGGGGCACTGGG + Intergenic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122542883 14:102507845-102507867 CTGGGGGTGGCGCGGACGGCGGG - Exonic
1122634889 14:103125171-103125193 CTTGGGGTGGGGCAGACAGGTGG + Intronic
1122741731 14:103875470-103875492 GTGGGGGTGGGGTGGGTGGATGG + Intergenic
1122746383 14:103899484-103899506 CTCCGGGTGGGGTGGGGAGATGG + Intergenic
1122785836 14:104162915-104162937 CTTGGGGCGGGGCGGGGGGAAGG - Intronic
1122791614 14:104186213-104186235 CTGGGCCTGGGGCAGCCAGAAGG + Intergenic
1122825749 14:104369660-104369682 CTGGGGGTGGGGTGAGGGGAGGG - Intergenic
1122837580 14:104437656-104437678 CATGGGGTGGGGCGGGGTGAGGG - Intergenic
1122840470 14:104460028-104460050 CTGGGGGCGGGGCGGGGGGAGGG + Intergenic
1122852785 14:104546025-104546047 CCAGGGGTGGGGCCGGCAGCCGG - Intronic
1122853446 14:104548702-104548724 CTGGGGCTGGGGTGGGGAGTGGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122905378 14:104799338-104799360 GTGGGGGTGGTGCTGGAAGAGGG - Intergenic
1122919217 14:104873201-104873223 CTGGGAGTGGGCGGGGCAGCTGG + Intronic
1122969731 14:105147670-105147692 CAGGGGGAGGGGCTGGCAGAAGG + Intronic
1123039126 14:105483218-105483240 CTGGGGGCAGGGCTGGCTGAGGG + Intergenic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123922141 15:25077690-25077712 CTGGTGGTGGGAAGGGGAGAGGG + Intergenic
1124619366 15:31265170-31265192 CAGGGAGTGGAGGGGGCAGAGGG + Intergenic
1124930445 15:34114604-34114626 TGGCGGGTGGGGCGGGCAGTAGG - Intergenic
1125556620 15:40591033-40591055 CTGGGGGCGGGGCGGGGGGGAGG + Intergenic
1125599243 15:40906572-40906594 CTGGGGGTGTGGCCGCCGGAGGG + Intergenic
1125728587 15:41880616-41880638 GTGGGGGTGGAGCAGGCAGAGGG - Intronic
1125888967 15:43251656-43251678 CTGGGTGTGGGGCAGGGTGAGGG + Intronic
1125919564 15:43517593-43517615 GTGGGAGTGGGGCGGGCGGTGGG - Intronic
1126343472 15:47668842-47668864 GTGGAGGTGGGGCTGGAAGATGG - Intronic
1127157327 15:56141272-56141294 CTGGGGGTGGGGGTGGGAGTGGG + Intronic
1127254816 15:57280715-57280737 TTGGGGGTGGGGTGGGGACATGG + Intronic
1127281566 15:57497676-57497698 GTGTGGGTGGGCCAGGCAGAGGG + Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127595311 15:60476262-60476284 CTGGGGATGGGGGGGTAAGAAGG - Intronic
1127838901 15:62812797-62812819 CCGAGGGGCGGGCGGGCAGATGG + Intronic
1127916229 15:63457841-63457863 GGGGGGGGGGGGCGGGGAGAGGG + Intergenic
1127932058 15:63603547-63603569 CTGGGGGTAGGTTGGGCTGAGGG - Intergenic
1127983401 15:64050511-64050533 CCGGGGGTGGGGGGGGTAGCAGG - Intronic
1127995984 15:64153334-64153356 CTGGGGGTAAGGGGGGCCGATGG + Exonic
1128179638 15:65590474-65590496 GTGGGTGTGGGAGGGGCAGATGG - Intronic
1128302508 15:66575402-66575424 CTGGGGTTGGTGCGGGTGGAGGG + Intergenic
1128987237 15:72230539-72230561 CAGGGGGAGGGGCGGCGAGAGGG + Intronic
1128990284 15:72254052-72254074 CTAGGGGTGGGGCAGCCACATGG - Intronic
1129010147 15:72408596-72408618 CTGGGGGCGGGGCGGGGGGAAGG - Intergenic
1129150282 15:73684184-73684206 CTGGGGGCGGGGCGGGGCGGGGG + Intronic
1129153882 15:73705520-73705542 TTGGGGAAGGGGTGGGCAGAAGG - Intronic
1129181183 15:73876903-73876925 CTGGGGGTGGGAGGGGCAGTGGG - Intronic
1129255272 15:74330757-74330779 CTGGGGCTTGTGGGGGCAGAGGG + Intronic
1129333502 15:74839523-74839545 CTGGGGCTGGGGTGGGCTGAGGG - Intronic
1129393557 15:75232598-75232620 CTGGGGCTGGGTGGGGCAGAGGG + Intergenic
1129455907 15:75676124-75676146 CTGGAGGTGGGCAGGCCAGAGGG - Exonic
1129464251 15:75715129-75715151 GAGGGGGTGGGGGGGGGAGATGG - Intergenic
1129599258 15:76988760-76988782 GTGGGGGTGTGGCGCTCAGATGG - Intergenic
1129698582 15:77754648-77754670 CTGGGGGTGGGGCTCTGAGAAGG + Intronic
1129759374 15:78120662-78120684 CTGGGTGGGGGCAGGGCAGAGGG + Intronic
1129821156 15:78602835-78602857 ATGGGGGTGGGGAGGGTACAGGG - Intronic
1130135866 15:81181500-81181522 ATGGGGGTGAGGGGTGCAGAGGG + Intronic
1130321972 15:82849124-82849146 CTGGGGGGGCGGGGGGCAGGGGG + Exonic
1130568036 15:85014928-85014950 CTGGGGGTGTAGCGGGTAAAGGG - Intronic
1130990936 15:88875232-88875254 GCGGGGGTGGGGAGGGGAGAAGG - Exonic
1131035940 15:89222018-89222040 CTGGGGGAGGGGTGGGCAATAGG - Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131155618 15:90073407-90073429 TTGGGGGTTGGGAGGGCAGGCGG + Intronic
1131420065 15:92297980-92298002 CTGGGGTAGGGGCGGGTAGGTGG - Intergenic
1131436488 15:92426629-92426651 CTGGGGGTGGGGCTGTGAGGAGG + Intronic
1131546367 15:93319306-93319328 CAGAGGGTGGGGCCGGCAGAGGG - Intergenic
1131841554 15:96442653-96442675 CTGGGTGTTAGGCGGGAAGAAGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132152859 15:99474956-99474978 CTGCGGGGGGGGCGTGCAGAAGG - Intergenic
1132205456 15:99983400-99983422 TTGGGGGTGGTACGGGCAGGTGG - Intronic
1132554264 16:565697-565719 CTGGGGGTGGGGCGGGACATCGG + Intergenic
1132656216 16:1043034-1043056 CTGGCCGAGGGGCGGGCAGAGGG - Intergenic
1132678640 16:1130846-1130868 GTGGGGGTGGGGGGGGCCGGGGG + Intergenic
1132683443 16:1153015-1153037 CCGGGGGCGGGGCGGGCGGGGGG - Intergenic
1132832026 16:1933105-1933127 CTGGGGGAGGGGCAAGCAGCAGG + Intergenic
1133233045 16:4375284-4375306 CTGGGAGAGGGGCAGGCACAGGG - Intronic
1133268822 16:4600536-4600558 GTGGGGGTGGGGGGGGCATATGG - Exonic
1133299320 16:4772603-4772625 CAGAGGCTGAGGCGGGCAGATGG + Intergenic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133394350 16:5434026-5434048 TTGGGGTAGGGGCGGGGAGAAGG + Intergenic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134005825 16:10818439-10818461 CTGGAGGCGGGGCGGGACGAGGG - Intronic
1134007679 16:10828924-10828946 GTTGGGTTGGGGCGGGCAGCGGG + Intergenic
1134070322 16:11256273-11256295 CTGGGGGCGGGGCCGGCAGGGGG - Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134240576 16:12503098-12503120 CTGGGGGTGGGGGTGGTGGATGG - Intronic
1134520779 16:14918372-14918394 CTGTGAGTGCGGCGGGCGGATGG + Intronic
1134521054 16:14919425-14919447 CGGGGGGTGGGGCAGGCACCTGG - Intronic
1134550796 16:15137601-15137623 CTGTGAGTGCGGCGGGCGGATGG - Intronic
1134708451 16:16317023-16317045 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134708730 16:16318076-16318098 CGGGGGGTGGGGCAGGCACCTGG - Intergenic
1134715666 16:16357056-16357078 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134838906 16:17385228-17385250 ATGGGGATGGGGCAGGCAGCGGG - Intronic
1134950875 16:18350569-18350591 CGGGGGGTGGGGCAGGCACCTGG + Intergenic
1134951151 16:18351622-18351644 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1134959091 16:18395103-18395125 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1135390538 16:22089608-22089630 CGGGGGGTGGGGTGGGGTGAGGG - Intergenic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1135563175 16:23492344-23492366 GAGGTGGTGGGGCGGGCAGGGGG + Intronic
1135572957 16:23563346-23563368 GCGGGGGTGGGGCAGGCAGAGGG - Intronic
1135856878 16:26019908-26019930 CTGGGGATGGGGTAGGCAGCTGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136247923 16:28985812-28985834 TTGGGGATGGGGCTGGAAGATGG - Intronic
1136284605 16:29233615-29233637 CTCGGAGTGGGAAGGGCAGACGG + Intergenic
1136296955 16:29309221-29309243 CTGGCAGAGGGACGGGCAGAGGG - Intergenic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136416639 16:30108265-30108287 CTGGGGGTGGGGTGGGGACGTGG + Intronic
1136417387 16:30112425-30112447 CTGGGGGTGGTGTGGGAAAAGGG + Intronic
1136510676 16:30736635-30736657 CCAGGGGTGGGGCTGGCAGTTGG + Intronic
1136591902 16:31222804-31222826 CTGGGGGTGGGGAGGGGAAGGGG - Intronic
1136685340 16:31990802-31990824 GTGGGGCTGGGGCAGGCAGGAGG - Intergenic
1136785954 16:32934338-32934360 GTGGGGCTGGGGCAGGCAGGAGG - Intergenic
1136883821 16:33919467-33919489 GTGGGGCTGGGGCAGGCAGGAGG + Intergenic
1136932434 16:34431703-34431725 CGGGTGGGGGGGCGGGTAGAGGG - Intergenic
1136972138 16:34980111-34980133 CGGGTGGGGGGGCGGGTAGAGGG + Intergenic
1137036680 16:35574692-35574714 CTCGAGGTGGGAGGGGCAGAGGG - Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1137733674 16:50708733-50708755 CTGTGTGTGGTGCTGGCAGATGG + Intronic
1137889641 16:52145560-52145582 CTGGGGGTGGGGCGGGAAGTAGG + Intergenic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1138033575 16:53580286-53580308 CTGGGGGTTGGGAGTGCTGAAGG - Intergenic
1138190387 16:55009446-55009468 CTGGGGGTGTGGCAGTCACAGGG + Intergenic
1138488917 16:57364783-57364805 TTGGGGGGGGGGTGGGGAGAGGG - Exonic
1138503801 16:57466083-57466105 CTGGGGGTGAGGCTGGAAGGAGG - Intronic
1138533243 16:57646336-57646358 CTGGGGGTGGGGCGGGGGATGGG + Intronic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1139008852 16:62607742-62607764 GTGGGGGTGGGGTGGGGAAATGG - Intergenic
1139495839 16:67316827-67316849 GTGGGGGTTGGGTGGGCAGGTGG + Intronic
1139534476 16:67562900-67562922 GTGGGGGTGGGGGGGGCGGCCGG - Intronic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1139614056 16:68078547-68078569 CTTGGGGTGGGGCGGAGAGTGGG + Intronic
1139675366 16:68519701-68519723 CTGGGGGTGGGGTGTGGACAGGG + Intergenic
1140256885 16:73345384-73345406 CGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1140580278 16:76223255-76223277 CTGGGGGGTGGGGGGGCAGGGGG + Intergenic
1140670634 16:77274947-77274969 CTAGGGTTGGAGAGGGCAGAAGG - Intronic
1141138750 16:81483605-81483627 CTGGGGGAGGGTCAGGGAGAGGG - Intronic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1141430411 16:83968188-83968210 CCGGGGCTGGAGCCGGCAGAGGG + Intergenic
1141489394 16:84361798-84361820 GTGGGGGTGGGGCTGGGAGAAGG + Intergenic
1141518840 16:84564157-84564179 CAGGGAGTGGGGTGGGCAGTGGG + Intergenic
1141600702 16:85124381-85124403 CCCGAGGTGGGGCGGGCAGCGGG - Intergenic
1141961446 16:87411963-87411985 GCGGGGGTGGGGCGGGCTGCGGG + Exonic
1142006444 16:87691593-87691615 CTGGGGGTGGGGCTGGCAGGAGG - Intronic
1142058507 16:88015325-88015347 CTGGCAGAGGGACGGGCAGAGGG - Intronic
1142194569 16:88733478-88733500 CTGGGCTTGGGGAGGGCAGTGGG + Intronic
1142292979 16:89201218-89201240 CTGGGGGCGGGGAGGGCTGCGGG + Intronic
1142356039 16:89602515-89602537 CGGTGGGTGGGGGGGGCAGCTGG + Intergenic
1203088189 16_KI270728v1_random:1195998-1196020 GTGGGGCTGGGGCAGGCAGGAGG - Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142669161 17:1479571-1479593 GGGTGAGTGGGGCGGGCAGAGGG - Exonic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1142869343 17:2810022-2810044 CCTGGGGTGGGGCGGGGGGAGGG - Intronic
1143014417 17:3884037-3884059 CTGGTGGTGGGTAGTGCAGATGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143111949 17:4557988-4558010 ATGGGGGTGGGTCTGGCAGAAGG - Exonic
1143379345 17:6486310-6486332 GTGGGGGTGGGGTGTGAAGAAGG - Intronic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143619622 17:8073458-8073480 CTGGGGGTGGGGCTGGGTGTGGG + Intronic
1143758026 17:9080681-9080703 CCGGAGGTGGGGCAGGGAGAGGG - Intronic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144164906 17:12601213-12601235 GTGGGGGTGGGGCGGGGAGAGGG - Intergenic
1144206431 17:12982895-12982917 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
1144432466 17:15206769-15206791 CAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1144577191 17:16436569-16436591 CTGGGGGTGGCAGGGGCAGGGGG + Intronic
1144786933 17:17837129-17837151 CTGGAGGAGGGGCCGGCTGAGGG - Intergenic
1144816988 17:18041196-18041218 CGGGGGGTGGGGCGGGGGGGAGG - Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145252276 17:21303160-21303182 CTGGCGGTGGGGTGGGGAGGAGG - Intronic
1145266900 17:21383998-21384020 CTGGGGGTGGGGGAGGCAGGGGG - Intronic
1145877830 17:28333243-28333265 CTGGGGGCAGTGGGGGCAGAGGG - Intronic
1145878872 17:28339747-28339769 CTCGGGGTGGGGAGGGCAGGAGG + Intronic
1145980148 17:29006204-29006226 CTGGGGGTGGGCAGCGCAGAAGG - Exonic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146489003 17:33266536-33266558 CTGGGGGTGGGGGGTGGGGATGG - Intronic
1146873414 17:36389922-36389944 CTGGGGCTGGGGCTGGCACTGGG + Intronic
1147148106 17:38497885-38497907 TTGGGGGTGGGGCAGGCAGCGGG + Intronic
1147244435 17:39110825-39110847 CTGGGGTTGGGGCAGGCTGGGGG + Intronic
1147276717 17:39324009-39324031 CAGGGGGTGGGGGGGGGAGGGGG - Intronic
1147310316 17:39592230-39592252 CTGGAGGTGGGGGAGGCAGCGGG - Intergenic
1147325534 17:39667863-39667885 CTGGAGGAGGGGCGGGGAGGGGG + Intergenic
1147357065 17:39906469-39906491 CTGGGGGTGAGCTGGGGAGATGG - Intronic
1147422999 17:40331880-40331902 CCGGGGGTGGAGCTGGCAGGGGG - Intronic
1147656042 17:42091637-42091659 GTGGGGGTGGAGAGGCCAGAGGG - Intergenic
1147670571 17:42174655-42174677 TTGGGTGTGGGGCGGGCAAGTGG - Intronic
1147967216 17:44199757-44199779 CGGGGGGAGGGGCGCGCGGACGG - Intronic
1147968191 17:44205542-44205564 CTGGGGGTGGGGAGGCCTGGGGG - Exonic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148738057 17:49875841-49875863 GTGGGGGTGGGGCAGGTGGAAGG + Intergenic
1148855064 17:50574557-50574579 GTGGGGGTGGGGGGGGCACATGG - Intronic
1148863271 17:50615532-50615554 CTGGAGGTGGGGGGGCCAGATGG - Intronic
1149208436 17:54276336-54276358 TTGGAGGTGTGGGGGGCAGAGGG + Intergenic
1149349774 17:55774869-55774891 CAGGAGGTGGGGCGGGGGGAGGG + Intronic
1149355380 17:55834346-55834368 TTGGGGGTGGAGCAGGGAGAGGG - Intronic
1149596715 17:57868578-57868600 CTAGGGGAGGGGCGGGAAGGCGG - Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150091735 17:62332438-62332460 CTGGGGGTGGGCTGGGAGGAAGG + Intergenic
1150280242 17:63925873-63925895 CTGGGGAGGGGGCAGGCAGAGGG + Intergenic
1150643714 17:66965541-66965563 CTGGGGTTGGGGGGAGCGGACGG + Intronic
1150737663 17:67754183-67754205 CTGGGGCTGCAGCGGGCAGGCGG + Intergenic
1151175296 17:72283455-72283477 GGGGGGGTGGGGCGGGAAGGTGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151365378 17:73613344-73613366 GCGGGGGTGGGGAGAGCAGAGGG - Intronic
1151453561 17:74213505-74213527 CCGGGGGCGGGGCGGGCACGGGG + Exonic
1151661623 17:75522020-75522042 CTGGGGCTGGGGCGCGCAGAAGG - Exonic
1151666034 17:75545578-75545600 CTGGGGAGGGGCAGGGCAGACGG - Intronic
1151797038 17:76353437-76353459 CAGGAGGTGGGGCGGGTGGAGGG + Intronic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1151932465 17:77241292-77241314 CAGGGGGTGCGGCGGGGGGAGGG + Intergenic
1151956302 17:77381794-77381816 CTGGGGGTGGGAGAGGCAGTTGG + Intronic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1152278808 17:79373223-79373245 GTAGGGGTGGGGAGGACAGAGGG - Intronic
1152292138 17:79445967-79445989 CTGGGGGTGATGCTGGCACATGG + Intronic
1152337215 17:79705787-79705809 CAAGAGGTGGGGCGGGCAGGAGG + Intergenic
1152352573 17:79791757-79791779 CTGGGGGTGTGGCGCGCTGGAGG + Intergenic
1152464277 17:80457023-80457045 CTCGGGGTGGGGCGGGCAGGAGG - Intergenic
1152585206 17:81186220-81186242 CTGGGAGTGGGGTGGGAAGGGGG - Intergenic
1152593955 17:81229245-81229267 CTGGGGGTGGGGTGGGCACAGGG + Exonic
1152617494 17:81344798-81344820 CTGCGGTTGGAGCGGGCTGAAGG - Intergenic
1152617726 17:81345684-81345706 CTGGCCGTGGGGCGAGCAGCCGG - Intergenic
1152645116 17:81465221-81465243 AAGGGGTTGGGGCAGGCAGAGGG - Exonic
1152699230 17:81810953-81810975 CTGTGGGGGGGGCGGGCCCAGGG + Intronic
1152701928 17:81823651-81823673 GTGAGGCTGGGGTGGGCAGAGGG - Intronic
1152739039 17:82011128-82011150 CTGGGCATGGGTGGGGCAGAGGG + Intronic
1152789838 17:82273120-82273142 CCAGGGGTGGGGAGGGCAGTGGG - Intronic
1152791762 17:82283813-82283835 CTGGGGCTGGAGCAGGCTGAGGG + Intergenic
1152931842 17:83113960-83113982 CTGGTGGTGGGGGGCACAGAGGG + Intergenic
1153226617 18:2905288-2905310 CTGTGGGTGGGGCGGGGGGGGGG + Intronic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1154440172 18:14382704-14382726 CGGGGTGTTGGCCGGGCAGAGGG + Intergenic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1155208392 18:23580286-23580308 CTGGGGGTAGGGGAGGCAGGAGG - Intronic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1155277149 18:24199288-24199310 CTGGGGGTGTGGCGAACAGTGGG + Intronic
1155297371 18:24397713-24397735 CTCGACGTGGGGCGGGCGGACGG - Exonic
1155453498 18:25987186-25987208 TGGGGGGTGGGGCAGGAAGAAGG - Intergenic
1155602791 18:27568844-27568866 CAGGGGGTGGGGCTGGGAGTGGG + Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156346186 18:36259076-36259098 GTGGGGGTGGGGGGTGCAGAGGG + Intronic
1156469305 18:37367454-37367476 GTGGGGATGGGGAGGACAGAGGG + Intronic
1156489401 18:37487376-37487398 TTGGAGGTGGGGAAGGCAGAGGG - Intronic
1157248195 18:46071862-46071884 CTGGGGGCGCGGGCGGCAGAGGG + Intronic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157473704 18:48008352-48008374 CTGGGGGTGGGGCGCGCCCCCGG + Intergenic
1157597136 18:48870790-48870812 CTGGGAGTGGGGCCGGCACGGGG + Intergenic
1157626614 18:49056063-49056085 CTGGGGGAGGTGCAGGCTGAAGG + Intronic
1157721831 18:49931352-49931374 GTGGGGCTTGGGAGGGCAGAGGG - Intronic
1157727445 18:49975773-49975795 CTGGGGGTGGGGCGGGGGCCTGG - Intronic
1157781195 18:50440754-50440776 TTGGGGGGTGGGGGGGCAGAAGG - Intergenic
1157959200 18:52133639-52133661 GTGGGGGTGGGGGGGTGAGAGGG + Intergenic
1157968392 18:52236706-52236728 CTGGTGGAGGGGTGGGCAGGGGG + Intergenic
1158215567 18:55097367-55097389 TTGGGGGTGGGGTAGGCAGGGGG - Intergenic
1158364559 18:56718108-56718130 CTGGTGGTGGGGTGTTCAGATGG + Exonic
1158732197 18:60036240-60036262 TTGGGGGCGGGGCGGGGACAGGG + Intergenic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1159768753 18:72522794-72522816 GTGGGGGAGGGTCGGGGAGAGGG + Intergenic
1159798256 18:72868279-72868301 CTGGGGGAGGGGCGGGGAGGGGG + Intergenic
1160068618 18:75604110-75604132 CTGGGGTTGGGGGTGGCAGAAGG + Intergenic
1160272971 18:77404172-77404194 TGGGGGCTGGGGCGGGCAGAAGG - Intergenic
1160404823 18:78638146-78638168 CTGGGGCTGGGGAGGGCGGCTGG + Intergenic
1160418902 18:78731026-78731048 CAGGGGGTGGGACGGGCACAGGG - Intergenic
1160523145 18:79520422-79520444 GTGGGGGTGGGGGAGGCAGGTGG - Intronic
1160532818 18:79575475-79575497 CTGCGGCTGGGCTGGGCAGACGG + Intergenic
1160657937 19:282860-282882 CTGTGGGCGGGGCGGGGACAAGG - Intronic
1160690837 19:460302-460324 CGTGGGGAGGGGCGGGGAGAGGG - Intronic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160738776 19:676525-676547 CGGTGAGTGGGGCGGCCAGAGGG + Exonic
1160779648 19:872144-872166 CTGGGGCGGCGGGGGGCAGATGG + Intronic
1160797610 19:953134-953156 CTAGGGGTGGTCCGGGCAGCCGG + Intronic
1160834946 19:1120184-1120206 ATGGGGGGCGGGCGGGCAGGCGG + Intronic
1160853422 19:1205651-1205673 GCGGCGGCGGGGCGGGCAGAGGG + Intronic
1160868269 19:1265706-1265728 CCGGGGGTGGGGCGGGGTGGCGG + Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160960514 19:1718749-1718771 GTGGGGGAGGGGCGGGGGGATGG - Intergenic
1160976608 19:1796025-1796047 CCCAAGGTGGGGCGGGCAGACGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161114587 19:2489401-2489423 CGGGGCGTGGGGCGGGCGGCCGG - Intergenic
1161151420 19:2712060-2712082 GTGGGGGCTGGGCTGGCAGATGG + Intergenic
1161161052 19:2762119-2762141 CTGGGGGTGAGTGGGGCAGGTGG - Intronic
1161264851 19:3359489-3359511 CCGGGGGGAGGGCGGGCCGAGGG + Intergenic
1161267261 19:3370051-3370073 GTGGGGGTGGGGGAGGCAGCAGG + Intronic
1161283877 19:3459162-3459184 TTGGGGGAGGAGGGGGCAGAGGG - Intronic
1161306530 19:3572267-3572289 CTGGGTGTGGGTCAGGCAGGGGG - Intronic
1161448262 19:4329811-4329833 CTGGGGGTGGGGGAGGGGGAGGG - Intronic
1161498155 19:4598479-4598501 CTGGCGGTGGGGAGGTCAGAGGG - Intergenic
1161673010 19:5624562-5624584 CTGGGGGGTGGGCGGCCAGGCGG - Intronic
1161746907 19:6065993-6066015 CTGGGGGCGGGGCTGGGAGGAGG + Intronic
1161820999 19:6531369-6531391 CTGGGGGTGCGGGAGGGAGAAGG - Intronic
1161846300 19:6713642-6713664 CTGGGGGTGGGGCCAGGTGAGGG - Intronic
1161846333 19:6713713-6713735 CTGGGGGTGGGGCCAGGTGAGGG - Intronic
1161846379 19:6713808-6713830 CTGGGGGTGGGGCAAGGTGAGGG - Intronic
1161853555 19:6751327-6751349 TTGGGGGTGGAGGGGGCAGCAGG - Exonic
1161871301 19:6872452-6872474 CAGGGGGTGGGGTTGGGAGAGGG + Intergenic
1161926154 19:7301679-7301701 CTGGGGCTGGGGAGGGGAGGTGG - Intergenic
1161959593 19:7516290-7516312 CTGGGTGGGGGGCGGGCGGGCGG + Intronic
1161981694 19:7633375-7633397 CTGGGGGTGGGGTGGGGGCAGGG + Intronic
1161991996 19:7689452-7689474 CAGGGGATGGGGCGGGGAGAAGG + Intronic
1162013657 19:7832115-7832137 CTGGGAGTGGGGAGGGCGGCGGG - Intronic
1162086882 19:8254655-8254677 CTGGGGGTGGGGCGTGGGGATGG + Intronic
1162134091 19:8544581-8544603 TTGGGGGTGGGGAGGGCACCAGG + Intronic
1162181389 19:8871441-8871463 TGGGGGGTGGGGCAGGGAGATGG + Intronic
1162323632 19:9985811-9985833 CTGGGGGTGGGGGGTGGAGATGG - Intronic
1162421043 19:10566196-10566218 CAGGGGGTGGGGCGGGTGGGCGG - Intergenic
1162575171 19:11495113-11495135 CTGAGGGTGGGGCGGTCACCAGG - Intronic
1162683762 19:12365344-12365366 CTGGGGGCTGGGCCGGCAGCCGG - Intronic
1162716301 19:12636625-12636647 CTTGGGGAGGGGAGGGCAAAGGG - Intronic
1162760631 19:12886298-12886320 CTGGGGGGGGAGCGGGGAGAGGG - Intronic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1162931829 19:13961347-13961369 CTGGGGGCGGGCAGGGCAGGGGG - Exonic
1163102480 19:15106945-15106967 CTTGGGGTGGGGTGGGTAGTGGG + Intergenic
1163117593 19:15197739-15197761 CTGGGGCTGGGGCGGGGGGGGGG - Intronic
1163160035 19:15458770-15458792 CGGGGGGTGGGGGGGGCACGGGG - Intronic
1163185036 19:15631888-15631910 CTGGGCGGGGGGCGGGCGGGGGG + Intronic
1163364384 19:16867979-16868001 CTGGGGCTGGGGCTGACAAAGGG + Intronic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1163424965 19:17236114-17236136 GGGGGGGGGGGGCGGGCAGCAGG + Intronic
1163469777 19:17489355-17489377 CTAGGGGTGGGGTGGGGAGCGGG + Intronic
1163499797 19:17669510-17669532 CTGGGGCTGGGGCTGGGTGAAGG + Intronic
1163563143 19:18032869-18032891 TGGGGGGTGGGGAGGTCAGAAGG - Intergenic
1163668461 19:18613849-18613871 CTGGGGGAGGGGAGGACAGGGGG - Intronic
1163828326 19:19535913-19535935 CTGGGCCAGGGGTGGGCAGAGGG - Exonic
1164476836 19:28582040-28582062 CTGGGGGTGGTGAGGGCGGGGGG - Intergenic
1164693873 19:30228974-30228996 CTGGGTCGGGGGCGGGCAGTCGG + Intronic
1164792795 19:31002457-31002479 CGGGGGGTGGGGCAAGCACAGGG + Intergenic
1164824336 19:31273424-31273446 CTGGGAGTGGGGTGAGGAGATGG + Intergenic
1164989963 19:32676057-32676079 CTGCGGACGGGGCGCGCAGAGGG - Exonic
1164999702 19:32751098-32751120 CGGGGGGTGGGGAGGGGGGAGGG - Intronic
1165079729 19:33300531-33300553 CTGGCTGTGGGGCGGGCATGGGG - Exonic
1165112577 19:33510961-33510983 CTGGGGGTGGGTAGGGGAGGTGG - Intronic
1165159640 19:33808466-33808488 CAGGGGATGGGGGTGGCAGATGG + Intronic
1165160206 19:33811570-33811592 CCGGGGGTGCGGCGGGGAGGGGG - Intronic
1165186911 19:34030626-34030648 ATGGGGGTGGGGAGTGGAGAGGG + Intergenic
1165249117 19:34515524-34515546 CGGGGGGGGGGGGGGGAAGAAGG - Intergenic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1165278388 19:34774288-34774310 CTGGGGGCTGGAGGGGCAGATGG - Intergenic
1165374339 19:35431267-35431289 CTGGGGGTGGAGGGGGTGGAGGG - Intergenic
1165406468 19:35633980-35634002 CTGGGGGTGGCTCTGGCCGAGGG - Exonic
1165435385 19:35792207-35792229 CTGGGGTGGGGGCAGGCCGAGGG + Intergenic
1165461394 19:35946053-35946075 CATGGGGTGGGGCAGGAAGATGG + Intergenic
1165709938 19:38003892-38003914 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1165734945 19:38170020-38170042 CTGGAGGGGGGCCAGGCAGAGGG + Intronic
1165773384 19:38390721-38390743 CTGGGGTTGGAGCGGGGAGGAGG - Intronic
1165808400 19:38596044-38596066 CTGGGGGTGGTGTGGGGAAAGGG - Intronic
1165832226 19:38735765-38735787 CTGGGGGCGGGGCGGGGCGGGGG + Intronic
1165832240 19:38735790-38735812 CTGGGGGCGGGGCGGGGCGGGGG + Intronic
1165832318 19:38735935-38735957 CTGGGGGCGGGGCGGGGCGGGGG + Intronic
1165862423 19:38916183-38916205 CTGGGGACGGGGTGGGCAGGAGG - Intronic
1165925002 19:39321096-39321118 CTGGGGGTGGGGCTGGGGAAGGG - Intergenic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166304717 19:41931181-41931203 CTGGGGGTGGGGGGTGCTGAGGG - Intergenic
1166359573 19:42247615-42247637 CTGAGGGTGGGGGGAGTAGAGGG - Exonic
1166493705 19:43282890-43282912 CGGGGGGTGGGGCAGGCATGTGG - Intergenic
1166670356 19:44706179-44706201 GTGGGGTGGGGGCGGGTAGAGGG - Intronic
1166756751 19:45197076-45197098 CTGGGAGTGGAGGGGGCTGAGGG + Intronic
1166882940 19:45940211-45940233 CGGGCGGCGGGGCGGGCGGAGGG - Exonic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1167062958 19:47162584-47162606 TAGGGGGTGGGGAGGGTAGAGGG - Intronic
1167088062 19:47324141-47324163 CAGGGCGTGGGGCGGGAAGGAGG - Intergenic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167112353 19:47469797-47469819 GTGGGAGCGGGGAGGGCAGATGG + Intronic
1167382443 19:49146350-49146372 TTGGCGGTGGGGAGGGTAGAGGG + Intronic
1167461060 19:49624998-49625020 CTGGGGCTGGGGCTGGGAGTGGG + Intronic
1167473169 19:49686551-49686573 GTGGGGTTGGGGGGGGCAGCAGG + Intronic
1167502071 19:49854121-49854143 CTGGAGGTGGGGCTGGCTGAAGG + Intronic
1168104250 19:54156899-54156921 CTGGGGCTGGGCCGGGCGGGGGG + Exonic
1168243455 19:55098549-55098571 CTGGTGGTGGGGGCGGCAGAAGG - Intronic
1168314200 19:55476863-55476885 CAGGGGGTGGGGCGGGGGGGGGG + Intronic
1168317053 19:55489052-55489074 TGGGGGGGGGGGCGGGCAGATGG - Intronic
1168402148 19:56091594-56091616 CTGGGAGTGGGGAAGGCAGGAGG + Intronic
925042751 2:746269-746291 TTGGTGGTGGGGCGGGGGGAGGG - Intergenic
925045185 2:767593-767615 CCGGGGATGGGGCCAGCAGATGG - Intergenic
925234539 2:2266485-2266507 ATGGGGGTGGGGTGGGGTGAGGG + Intronic
925303752 2:2835082-2835104 CTGGGGGCGCAGCAGGCAGAAGG - Intergenic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
926063620 2:9820338-9820360 CTGGGGGTGGGGGCGGGAGTGGG + Intergenic
926099205 2:10103307-10103329 GTGGGTGTGGGGAGGGCACAGGG + Intergenic
926104483 2:10141784-10141806 CTGGGGCTGGGGCTGGGAGGCGG + Intronic
926153331 2:10436456-10436478 CTGGGGGTGAGGGGGGCAAGTGG - Intergenic
926250913 2:11155202-11155224 CTGGGGGCGGGGCGAGATGAGGG + Intronic
926373494 2:12204092-12204114 CTGGGTGTGGGAGGGGCTGAAGG + Intergenic
926471071 2:13259214-13259236 CGGGGGGGGGGGCGGGGAGGTGG - Intergenic
926500927 2:13651016-13651038 ATGGGGGAGGGGCGGGCTGTAGG + Intergenic
927095089 2:19742378-19742400 TTGGGGGGGGGGCGGGGAGGGGG - Intergenic
927156774 2:20225219-20225241 CCGGGGGTGGGGCGTTCCGAAGG - Intronic
927513092 2:23656757-23656779 CACGGGGTGGGGCCTGCAGAGGG + Intronic
927596651 2:24403208-24403230 CTGGGGGGAGGGCGGGCGGGGGG - Intergenic
927755093 2:25702029-25702051 CTGGGATTTGGGAGGGCAGAGGG + Intergenic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927809237 2:26172813-26172835 CGGGGGCAGGGGCGGGCGGACGG + Intergenic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927893013 2:26764231-26764253 CCGGGGGCGGGGCGAGCAGGAGG + Intergenic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928404649 2:31005272-31005294 GTGGGGGTGGGGAGTGGAGATGG + Intronic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928683507 2:33726574-33726596 CTAGGGCGGGGGCGGGCAGAAGG + Intergenic
929375405 2:41280981-41281003 CTGGGGGTAGGGGGAGTAGATGG + Intergenic
929510117 2:42559800-42559822 CGGGGCGGGGGGCGGGCAGGGGG + Intronic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
930534554 2:52630139-52630161 CTGGGGGTGGGGCGGGGACAGGG - Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931253769 2:60553828-60553850 CCGGGGGAGGGGCGGGCCGAGGG + Intergenic
932217427 2:69976006-69976028 CTGGGGGTGGGGTGGGGAAGGGG - Intergenic
932337504 2:70939292-70939314 GAGGGGGTGGGCCGGGCAGCTGG + Intronic
932338272 2:70943422-70943444 CTGGGGGAGGGCCAGGCAGAGGG - Intronic
932369317 2:71174470-71174492 CTGGGAGTGGGGTGGGTGGATGG - Intergenic
932570388 2:72935460-72935482 CAGGGGGTGGAGCAGGCAGCTGG - Intronic
933695717 2:85215760-85215782 GTGGGGGTGGGGGGGGGTGAGGG + Intronic
933772320 2:85752463-85752485 CTAGGGGTGGAGGAGGCAGATGG - Intronic
933780198 2:85795865-85795887 CTGGGGCTGGGGGCTGCAGATGG - Intergenic
933780778 2:85799453-85799475 CTGGGGGTGGGGGAGGCACCTGG + Intergenic
933806026 2:85998494-85998516 CTGGGGGTGGGGACGAGAGAGGG + Intergenic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
933878264 2:86642197-86642219 GTGGGGGAGGGGCAGGCAGGTGG - Intronic
933893462 2:86790730-86790752 CAGGGGATGGGGCGGGCGGGGGG - Intronic
934045515 2:88170264-88170286 CTGGGGATGGGGCGGGGGGCGGG - Intergenic
934299558 2:91769019-91769041 CTGGGGGAGGGGCGGGGGGGAGG - Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934516747 2:94993251-94993273 GTGTGGGTGGGCCGGGCAAAGGG + Intergenic
934692661 2:96373578-96373600 CTAGGAGAGGGGAGGGCAGAGGG + Exonic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934893365 2:98089509-98089531 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
934942931 2:98515463-98515485 CGGTGGGTGGGGCAGGGAGAGGG + Intronic
935050229 2:99518966-99518988 CTGGGGGTGAGGTGGGGAGTGGG - Intergenic
935101326 2:99998482-99998504 ATGGGGGAGAGGTGGGCAGAGGG + Intronic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936449814 2:112625690-112625712 CATGGGGTGGGGTGGGCAGCAGG - Intergenic
936468730 2:112777845-112777867 ATGGGAGTGGGGTGGGCAGGTGG + Intronic
936519857 2:113204858-113204880 GTCGGGGTGAGGGGGGCAGAGGG + Intronic
936657540 2:114505720-114505742 CAGGGTGTGGGGCAGGCAGCTGG - Intronic
937070888 2:119062098-119062120 CTGGGGTAGGGGCAGCCAGATGG - Intergenic
937106732 2:119322850-119322872 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
937196625 2:120163252-120163274 TTGGGGGGGGGGGGGGCAGAGGG - Intronic
937257241 2:120564275-120564297 CTGGGGGCGAGGCGGGCAGAGGG + Intergenic
937309980 2:120896224-120896246 CTCAGGGTGGGGCGGAGAGAGGG - Intronic
937952769 2:127401272-127401294 CGGGGCGTGGGCCGGGAAGAGGG + Intergenic
937977927 2:127593036-127593058 CTGGGGCCGGGGAGGGCAGCGGG - Intronic
937993203 2:127675287-127675309 GTGGGGGTGGGGGTGGCAGGTGG + Intronic
938100278 2:128493468-128493490 CTGGGGGCGTGGCTGACAGAAGG + Intergenic
938258324 2:129877692-129877714 CTGGGGAGGGGGCGGGGACAGGG + Intergenic
938467551 2:131533252-131533274 CTCAGGCTGGGGCGGGTAGAGGG - Exonic
938500933 2:131831083-131831105 CTGGGGGTGGGCAAGGCGGAGGG + Intergenic
939099646 2:137880916-137880938 CTGGGAGTGGGACGGGGAGCTGG + Intergenic
939608373 2:144279941-144279963 AAGGGGGTGGGGCTGGGAGAAGG + Intronic
939618394 2:144386919-144386941 GAGGGGGTGGGGGGGGCAGGGGG - Intergenic
939629849 2:144517558-144517580 CTGGGGGTGGGGGGCGGGGAGGG - Intronic
939693237 2:145292155-145292177 ATGGGGGTGGGGGCGGCGGAGGG - Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
939981330 2:148785325-148785347 TCGGGGGTGGGGCGGGCAGTGGG - Intronic
939995061 2:148912193-148912215 CAGGGGCAGGGGCTGGCAGAAGG + Intronic
940127051 2:150338332-150338354 GGGGGAGTGGGGCGGGCTGAAGG + Intergenic
940962391 2:159799882-159799904 CAGGGGTTGGGGTGGGAAGAAGG + Intronic
941211966 2:162651357-162651379 TTGGGGGTGGGGTGGGAGGAGGG - Intronic
941225146 2:162838829-162838851 GTGGGGGTGGGGTGGGAAGGGGG + Intergenic
941901121 2:170679506-170679528 CTGTGGGTGGGGCGGGGCGGGGG - Intergenic
942055535 2:172179026-172179048 CTGGGGATGGGGGGGATAGAGGG - Intergenic
942265232 2:174217685-174217707 CTGGGGGAGGGGCAGAGAGAGGG - Intronic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
942695508 2:178638699-178638721 GTGGTGGTGGGGTGGGGAGAAGG - Intronic
943331863 2:186569484-186569506 CGGGGGGTGGGGTGGGGGGAGGG + Intergenic
943725134 2:191245341-191245363 CTGGCGGAGGGGCCGGCCGAGGG - Intronic
943767448 2:191678086-191678108 CAAGGGGAGGGGCGGGCCGAGGG + Intronic
943978922 2:194521460-194521482 GTGGGGGTGGGTGGTGCAGAGGG + Intergenic
944026941 2:195181880-195181902 GTGGGGGTGGGGTGGGGGGAGGG - Intergenic
944680422 2:202072319-202072341 TTGGGGGTGGAGGGGTCAGAGGG + Intergenic
945091727 2:206182106-206182128 CTCGGGGTGGTAGGGGCAGAGGG + Intronic
945124281 2:206491146-206491168 CAGGGGTAGGGGCAGGCAGAGGG - Intronic
945694637 2:213087635-213087657 CAGGGAGTGGGGAGGGTAGAGGG - Intronic
945699287 2:213150702-213150724 AGGGGGGGGGGGCGGGTAGAGGG + Intronic
945915052 2:215694806-215694828 CTGGGGATGGGAGGGGAAGAGGG + Intergenic
946026790 2:216676708-216676730 CTGGGGGTGGGAGGGGGTGAGGG + Exonic
946089760 2:217210527-217210549 CGGGGGGTGGGGTTGGGAGAGGG - Intergenic
946227700 2:218272970-218272992 CTTGGGATGGGAGGGGCAGAGGG + Intronic
946231103 2:218291832-218291854 CTGGAAGTGGGACTGGCAGAGGG + Intronic
946309650 2:218876287-218876309 AGGGGGGTGGGGCAGGCACAGGG + Intergenic
946374553 2:219300165-219300187 CTGGAGGTAGGGCTGGCAGTGGG + Exonic
946396203 2:219444904-219444926 CTGGTGGGGCAGCGGGCAGACGG + Exonic
946408942 2:219507018-219507040 CTGGGGGTGGGGGCGGAAGCGGG + Intergenic
947353722 2:229271560-229271582 CCGGGGGTGGTGGGGGCAGCGGG + Intergenic
947500692 2:230668753-230668775 CTGGGGCCGGGCCGGGCAGAGGG - Intergenic
947710912 2:232315200-232315222 ATGGGGGTGGGGAGGGCTGGAGG - Intronic
947712069 2:232321954-232321976 CTGGGGCTTGGCCGGGCAGGTGG + Intronic
947731310 2:232433073-232433095 CTGGGGGGTGGCCGGGCAGGTGG + Intergenic
947927658 2:233935769-233935791 AAGTGGGTGGGGCAGGCAGAAGG + Intronic
948200571 2:236127245-236127267 CAGGTGCTGGGACGGGCAGATGG + Exonic
948265520 2:236632848-236632870 CAGGGGGTAGTGCAGGCAGAAGG + Intergenic
948306310 2:236949604-236949626 GTGGGGGTGGGGCGGGGAGGCGG - Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948359799 2:237412229-237412251 CTGGGGGTGGAGGGCGCTGAAGG - Intronic
948397766 2:237660299-237660321 TGGGGCGTGGGGTGGGCAGATGG - Intronic
948422326 2:237867484-237867506 GTGGGGGTGGGGGTGGGAGAGGG + Intronic
948492288 2:238320995-238321017 CCGGGTGTGGGCCGGGCACAGGG + Intronic
948600692 2:239106106-239106128 CTGGGCCAGGGGCTGGCAGAGGG - Intronic
948777327 2:240296570-240296592 CTGGGGGTGGGGGGTGGAGGGGG + Intergenic
948800327 2:240430527-240430549 CTGGGGGTGGGGGGGGTTGGGGG - Intergenic
948807934 2:240460977-240460999 CTGGTGGGGGGGCGGACACAGGG - Intronic
948817690 2:240521141-240521163 CTGGGGGTAGGGGGCCCAGATGG + Intronic
948846904 2:240687610-240687632 CTGTGGGTGGGGGGTGCACACGG + Intergenic
949032097 2:241802137-241802159 TTGGGGGCGGGGCGTGCAGAAGG + Intronic
949052318 2:241903828-241903850 CTGGGCATGGGGAGGGCAGCTGG - Intergenic
949058958 2:241945490-241945512 GTGGGAGTGGGCCGGGCAGGTGG + Intergenic
1168771809 20:420688-420710 ATGGGGGTGGGGCTGGGGGATGG - Intronic
1168818505 20:757269-757291 TTGGGAGTGGGGCGGGGGGAGGG + Intergenic
1168876889 20:1177943-1177965 CTGGTGATGGGGCGGGGAGGAGG + Intronic
1168949797 20:1789272-1789294 CTGGGGGTGGGGTGGGGAAGAGG + Intergenic
1168981231 20:2005737-2005759 ATGGGGGTGGGTGGGGGAGAAGG - Intergenic
1169074137 20:2751177-2751199 CTTGGGCTGGGGCGGGAGGATGG - Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169924110 20:10765429-10765451 CTGGGGTTGGTGGGGGCAGAAGG - Intergenic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1171265710 20:23770981-23771003 CTGGGTGCTGGGCAGGCAGAAGG - Intergenic
1172090754 20:32430544-32430566 ATGGGGGTGGGGTGGGGTGAGGG - Intronic
1172097266 20:32466560-32466582 CTGGGGGAGGGGAGGCCAGGAGG + Intronic
1172101136 20:32484305-32484327 GTGGGGGTGGGGCGGGGGTACGG - Intronic
1172130343 20:32650816-32650838 TTGGCGGTGGGGCGGGAAGGAGG - Intergenic
1172280437 20:33703983-33704005 TAGGGGTTGGGGAGGGCAGAGGG - Exonic
1172320676 20:33993545-33993567 GCGGGGCTGGGGCGGGAAGAGGG - Intergenic
1172434574 20:34920043-34920065 TTAGGGGTGGAGTGGGCAGAAGG - Intronic
1172463235 20:35135889-35135911 CTGGGGCTGGGGTGGGCACAGGG - Intronic
1172590389 20:36113566-36113588 CTGGGGGTGGTGGGGGTAGGGGG + Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172766880 20:37355768-37355790 GTGAGGGTGGGCCGGGAAGAAGG + Intronic
1172904472 20:38358650-38358672 CTGGGGGCTGGGAGGGCAAAGGG - Intronic
1173399291 20:42710375-42710397 CTGAGGCTGGGCAGGGCAGAAGG - Intronic
1173437751 20:43048156-43048178 CTGGGAGTTGGCTGGGCAGAGGG + Intronic
1173601121 20:44296201-44296223 CGGGGGGTGTGCCTGGCAGATGG + Intergenic
1173725330 20:45293396-45293418 CTGGGGGAGGGGAAGCCAGACGG - Intergenic
1173966360 20:47115679-47115701 CTGAGGGTGGTGGAGGCAGAGGG - Intronic
1174135520 20:48376188-48376210 CCGGGGGTGGGGGGCGGAGATGG + Intergenic
1174404980 20:50297019-50297041 CAGGGGGTGGGGCAGGCATGGGG - Intergenic
1174433847 20:50491255-50491277 ATGGGGGAGGGGTGGGGAGAGGG - Intergenic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1174506971 20:51023175-51023197 CTGAGCGCGGGGCGGGGAGAAGG + Intergenic
1174645298 20:52080232-52080254 CAGGGGGTGGGGGAGACAGAGGG + Intronic
1174777712 20:53361055-53361077 CTGGGGGCTGGGCGGGCAGCGGG - Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175124814 20:56743292-56743314 GTGGGGCTGAGGCGGGAAGATGG - Intergenic
1175140937 20:56859909-56859931 CTCGGGGTGGGGGCGGGAGAGGG + Intergenic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175392762 20:58637505-58637527 CTTGGGAAGGGGTGGGCAGAAGG - Intergenic
1175403812 20:58714794-58714816 CTGGGGGTGGTGGGGACAGCGGG - Intronic
1175667059 20:60869769-60869791 CAGGAGGCGGGGCAGGCAGAGGG + Intergenic
1175883189 20:62272225-62272247 CAGGGGCTGGGGCTGGCAGGAGG - Exonic
1175902558 20:62365893-62365915 AAGGGGGTGGGGCAGGCAGAGGG + Intronic
1175942244 20:62542836-62542858 TGGGGTGTGGGGCAGGCAGAGGG + Intergenic
1175992499 20:62796697-62796719 GTGGGGGCGGGGCGGGCAACCGG + Intronic
1176062873 20:63179898-63179920 CTGGGGTGGGGGTGGGAAGATGG - Intergenic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176163642 20:63661557-63661579 CTGAGGGTGGGGTGGGCCCATGG + Intronic
1176172426 20:63701992-63702014 ACGGGGGGGGGGGGGGCAGAGGG - Intronic
1176180491 20:63747374-63747396 GTGGAGGTGGGGGGGGCAGGTGG + Intronic
1176206201 20:63889544-63889566 CCGGGGGTAGGGCGGGAGGAAGG - Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1178365392 21:31985623-31985645 CAGGGGGCGGGGCAGCCAGAAGG + Intronic
1178477540 21:32950479-32950501 CATTGGGTGGGGCGGGCAGAGGG + Intergenic
1178727473 21:35066793-35066815 TTGGGGGTGGGGCGGGGTGGGGG + Intronic
1178743552 21:35226098-35226120 CTGAGTGTGGGGCCAGCAGATGG + Intronic
1178822086 21:35984466-35984488 GTGGGGGTGGGGTGGGGAGGAGG + Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179181464 21:39048794-39048816 CTGGGGCTGGGGCTGGCATAGGG - Intergenic
1179266754 21:39810325-39810347 CTGGGGGTTGGTAGGGCACAGGG - Intergenic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179879983 21:44289517-44289539 CTGGGGTGGGGGCGGGCTGGAGG + Intronic
1179882653 21:44300004-44300026 CCCGGGGCGGGGCGGGCGGAAGG + Intergenic
1180042707 21:45288255-45288277 CTGGGGGCCGGGAGGGCTGACGG + Intergenic
1180099194 21:45576565-45576587 CGGGGGCTGGGTGGGGCAGAAGG - Intergenic
1180110079 21:45643462-45643484 CTGGGGGCGGGGCGGGGACCTGG - Intergenic
1180136731 21:45866809-45866831 ACGGGGGTGGGGTGGGCAGGAGG - Intronic
1180733900 22:18001509-18001531 CCGGGGGATGGGCGGGCACATGG + Intronic
1180794160 22:18593849-18593871 CTAGAGGTGGAGGGGGCAGATGG + Intergenic
1180839246 22:18951204-18951226 CTGGTGTTGGCGGGGGCAGAGGG - Intergenic
1181007196 22:20019518-20019540 CTGGGGGTGGGGATGGCCCAAGG + Intronic
1181031638 22:20150939-20150961 CTGGGGGTGGGGGTGGCCGCAGG + Intergenic
1181062644 22:20289252-20289274 CTGGTGTTGGCGGGGGCAGAGGG + Intergenic
1181227578 22:21401471-21401493 CTAGAGGTGGAGGGGGCAGATGG - Intergenic
1181251072 22:21533368-21533390 CTAGAGGTGGAGGGGGCAGATGG + Intergenic
1181444985 22:22963436-22963458 ATGGGGGTGGGAAGGGGAGAGGG - Intergenic
1181527776 22:23500043-23500065 GTGGAGGTGAGGCGGGAAGAGGG - Intergenic
1181627748 22:24133090-24133112 CTCAGGGTGGGGCAGGCAGGGGG + Intronic
1181636681 22:24177884-24177906 ATGGGGGTGGGGGTGGCAGGAGG + Intronic
1181697916 22:24603118-24603140 CTGGGGGCGGGGCGGGGGGAGGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181902765 22:26169622-26169644 CTGGCTGTGGGGCGGGCGGACGG - Exonic
1181902820 22:26169774-26169796 CGAGGGGCGGGGCGGGCAGGGGG + Intronic
1182030774 22:27157692-27157714 CTGGGGGTGGGGCCGGCGGTTGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182222947 22:28773013-28773035 CTGGGAGTGCGGCGCGCGGACGG + Exonic
1182327315 22:29523427-29523449 GTGGTGGTGGGGTGGGTAGAGGG - Intronic
1182355015 22:29719028-29719050 CTGGGAGTGGTGTGGGCATATGG - Intergenic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182364235 22:29767083-29767105 CTGGGCGGAGGGCGGGGAGAAGG + Intergenic
1182396625 22:30040899-30040921 CTGGGCATGGGGGGCGCAGAAGG - Intergenic
1182550923 22:31100373-31100395 CTGAGGGTGAGGTGAGCAGACGG - Intronic
1182556979 22:31134416-31134438 CTGAGGGTGGGGTAGGCAGATGG + Exonic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183050593 22:35257742-35257764 AAGGGGCTGGAGCGGGCAGAAGG + Intronic
1183058987 22:35323854-35323876 GTATGGGCGGGGCGGGCAGAGGG - Exonic
1183225702 22:36548615-36548637 CTGGGGGTGAGGTGATCAGATGG + Intergenic
1183339362 22:37271072-37271094 ATGGGGGTGAGGAGGGTAGAGGG + Intergenic
1183370045 22:37427182-37427204 GTGGGGGTGGGGCTTGGAGAGGG - Intronic
1183404467 22:37623681-37623703 CTGGGGGAGGTGGGGGCAGGAGG - Intronic
1183530433 22:38350599-38350621 CTGGAGATGGGGCGGGCAGTAGG - Intronic
1183666548 22:39249428-39249450 GTGAGGGTGAGGCAGGCAGAGGG - Intergenic
1183730059 22:39613395-39613417 CTGGGGGTGGGGTCTGGAGAGGG + Intronic
1183732359 22:39625830-39625852 CTGGGGGTGGGGTGGGGCGGGGG - Intronic
1183740166 22:39664685-39664707 CCGCGGGAGGGGCGGGCAGGTGG - Intronic
1184070296 22:42142881-42142903 CTGGGGGCGGGACGGGCACGTGG + Intergenic
1184072033 22:42152500-42152522 CTGGGGGCGGGACGGACACATGG + Intergenic
1184092369 22:42299412-42299434 CTAGGAGTGGGGAGGGGAGATGG - Intronic
1184100067 22:42337310-42337332 CTGGGGGAGGGACAGGCAGGAGG - Intronic
1184265169 22:43342794-43342816 CGCGGGGCGGGGCGGGCGGAGGG - Intronic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184286460 22:43474479-43474501 CTGAGAGAGGGGCGGGCAGGAGG - Intronic
1184286484 22:43474646-43474668 CTGAGAGAGGGGCGGGCAGGAGG - Intronic
1184418043 22:44363553-44363575 CCGGGGCTGTGGCGAGCAGAGGG - Intergenic
1184434367 22:44461153-44461175 TTGGGGGTGGTGGGGGCAGCAGG + Intergenic
1184473246 22:44707549-44707571 ATGGGGCTGGGGGAGGCAGAAGG - Intronic
1184514315 22:44952480-44952502 CTGGGGGTGGAGGGAGCACAGGG + Intronic
1184554203 22:45224580-45224602 CTGGGGATGGCGGGGGCAGCAGG - Intronic
1184554646 22:45226532-45226554 GTGGGGTCGGGGCGGGCAGCAGG - Intronic
1184709392 22:46239643-46239665 CTGGGGGCGGTGCGGGGAGGGGG - Exonic
1184834286 22:47012007-47012029 CTGGGGGCGGGGTGGGGACAAGG - Intronic
1184861661 22:47176233-47176255 CTGAGGGTGGGGCACCCAGACGG - Intergenic
1184881555 22:47307627-47307649 TTGGGGGTGGGTCTGGCAGCTGG - Intergenic
1185074492 22:48676013-48676035 CTGGCGGTGGGGCAGGCAGTGGG + Intronic
1185413670 22:50698399-50698421 CTGGGGGTGGGGGCAGCAGCAGG + Intergenic
949920870 3:8999531-8999553 TAGGGGGTGGGGTAGGCAGAGGG - Intronic
950042817 3:9931133-9931155 CTAGGGGTGGGGCGGGGGCAAGG - Intronic
950110722 3:10417067-10417089 GGCGGGGGGGGGCGGGCAGAGGG + Intronic
950123314 3:10496085-10496107 CTGGGGGTGGGATGGGGAGAAGG + Intronic
950153931 3:10708323-10708345 GTGGGGGTGGGGCGGGGACAGGG - Intergenic
950263401 3:11558451-11558473 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
950419154 3:12886753-12886775 CTGGGGGTGCTACGGGAAGAAGG + Intergenic
950438518 3:12994250-12994272 CGGGCGGTGGGGCGGGCAGGAGG - Intronic
950525328 3:13519620-13519642 CTGGGGCTGGGGCGGGGCCAGGG + Intergenic
950635122 3:14308716-14308738 CAGGGGGTGGGGAGGACAAAGGG + Intergenic
950652132 3:14413703-14413725 CCGGGGGTGGGGCTGGGGGAAGG + Intronic
950887075 3:16371956-16371978 TTGGGGCTGGGGTGGGCAGGAGG + Intronic
952377697 3:32781067-32781089 CTGGGGTGGGGGAGGGCCGAGGG - Intergenic
952827671 3:37537664-37537686 GTGGGAGGGGGGCAGGCAGACGG + Intronic
953385598 3:42504160-42504182 CTGGGGTTGGGAGGGCCAGATGG - Intronic
953392134 3:42540003-42540025 CTGGGAGTGGGCGGGGCAGGGGG - Intergenic
953759297 3:45674253-45674275 CGTGGGGTGGGGAGGGAAGAGGG - Intronic
953797190 3:45995041-45995063 GCGGGGGTGGGGCGGGGAGGGGG - Intronic
953990119 3:47477048-47477070 CGGGGGCTGGTGCGGTCAGAAGG - Intronic
954048436 3:47952353-47952375 CTGGGTGGTGGCCGGGCAGAGGG - Intronic
954063399 3:48088161-48088183 GTGGGGGTGGGGAGGGTACAGGG - Intronic
954109007 3:48424027-48424049 TTGGGGGTCGGGCGGCCACAGGG + Exonic
954317195 3:49807529-49807551 TTGGGGGTGGGGATGGCTGACGG + Intronic
954681239 3:52347144-52347166 CTGGGGGTGGGTCAGGGAGGAGG + Intronic
954681823 3:52350103-52350125 CTGGAGGTGAGGCAGGCACACGG + Exonic
954749704 3:52806536-52806558 CTGGGGGTGGGGAGTGCCCAGGG + Intronic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954801384 3:53189035-53189057 CTGGCGGTGGGGAGAGCAGCAGG - Intronic
955350402 3:58189270-58189292 CTGGGGGTGGGGTGGGTGAAGGG - Intergenic
956084678 3:65597253-65597275 CTGGGGGTGGGAGGGGGAGGGGG - Intronic
956750370 3:72340047-72340069 GTGGGGGTGGGGCGGGCCACGGG + Intergenic
956861299 3:73326656-73326678 CTGGGGAGGGGGATGGCAGAGGG - Intergenic
957060720 3:75479350-75479372 CGGGGAGTGGGGCTGGGAGATGG + Intergenic
959110058 3:102112054-102112076 GTGGGGGTGGGGTGGGGAGTGGG + Intronic
959156643 3:102674497-102674519 CAGTGGCTGGGGCGGGCAGAAGG - Intergenic
959596815 3:108137406-108137428 GTGGGGGGGGGGCGGGGGGAGGG + Intergenic
959784102 3:110272679-110272701 CAGGGTGTGGGGCAGGAAGAGGG - Intergenic
960058846 3:113298113-113298135 ATGGGGGTGGGGCTAGCTGAGGG - Intronic
960081684 3:113548142-113548164 ATGGGGGTGGGGTGGAGAGAAGG - Intronic
960159813 3:114338404-114338426 GTGGGGGTGGGAAGGGCAGTGGG - Intronic
961173964 3:124818910-124818932 CTGGGGGTGGAGGGTGGAGAGGG + Intronic
961426008 3:126848650-126848672 CTGGGGGTGGAGAAGGTAGAGGG + Intronic
961428796 3:126865349-126865371 GTGGTGGTGGTGGGGGCAGAAGG - Intronic
961492147 3:127263620-127263642 CTGGGTGGGGGGTGGGCAGCTGG - Intergenic
961496210 3:127293770-127293792 CTGGGTGGCGGCCGGGCAGAGGG + Intergenic
961509817 3:127393995-127394017 CTGGGGGTGGTGTGGACATATGG - Intergenic
961564629 3:127754668-127754690 CTGAGGCTGGGTCGGGCAGGAGG + Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961736613 3:129005671-129005693 CTGGGGGTGGAGCAGCCAGAAGG + Intronic
961755111 3:129122438-129122460 CTGGGTGGGGGGCGAGCAGGAGG - Intronic
961813735 3:129536789-129536811 TTGGGGTTGGGGCGGGGAGCTGG - Intergenic
961907371 3:130276805-130276827 GTGGGGGTGGGGGCAGCAGATGG - Intergenic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
962264409 3:133935093-133935115 CTGGGGGTGGCTGGGGCAGCTGG - Intronic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962382239 3:134907647-134907669 GTGGGGAGGGGGCGGGCAGGGGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962514051 3:136132010-136132032 CAGGGGGTGGGGGGGGCTGGGGG + Intronic
963331404 3:143920040-143920062 CTGGGCCTGGGGCAGGCAGGAGG + Intergenic
963758491 3:149259978-149260000 CTGGGGATGGGGATGCCAGATGG - Intergenic
965137000 3:164784762-164784784 CTGGGTGGCGGCCGGGCAGAGGG - Intergenic
965193860 3:165568461-165568483 CTGGGGGTGGGCTGGAGAGAGGG - Intergenic
965271637 3:166623421-166623443 CTGGGGGTGGGGGTGGGGGAGGG + Intergenic
965751516 3:171979436-171979458 CTGGAGGTCGGGCAGGGAGAGGG - Intergenic
965828100 3:172751002-172751024 CTGGGGGTGGGGTGCGGCGAGGG - Intronic
966234219 3:177682823-177682845 TTGGGGGTGGGGAAGGCAGAAGG - Intergenic
966869961 3:184283968-184283990 CTGCAGGTGGGGCAGGCAGGGGG + Exonic
966893593 3:184426107-184426129 CTGGGGGTGGGGTGGGAGTAGGG + Intronic
967806616 3:193719723-193719745 CTGGAGGTGGGTGGGGCAGCAGG + Intergenic
967847913 3:194058528-194058550 CGGGTGGCGGGGCGGGCAGCGGG + Intergenic
968186953 3:196639621-196639643 GCGGGGGTGGGGCGGGCCGGGGG - Intergenic
968408221 4:361520-361542 CGTGGGGTTGGGCGGGGAGAGGG - Intronic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968533935 4:1112593-1112615 CTGGGGGAGAAGCGGGCAGGCGG - Intronic
968534469 4:1114116-1114138 GTGGGGGTGGGGGGGGCAGTTGG + Intergenic
968574186 4:1357342-1357364 CTGGGGCTGGGGCAGCCAGGTGG + Intronic
968625061 4:1623323-1623345 GTGGGGGTGGGGGTGGCAGCAGG - Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968768073 4:2485049-2485071 ATGTGGGTGGGGTGGGCGGAAGG - Intronic
969274194 4:6124165-6124187 ATGGGGGTGGGCCGTGCGGACGG + Intronic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
969557186 4:7919789-7919811 TTGGGGGTGGGGCGAGGGGAGGG - Intronic
969622134 4:8283958-8283980 CCCGGGATGGGGAGGGCAGAGGG - Intronic
969662578 4:8538776-8538798 TTGGATGTGGGGCAGGCAGAAGG + Intergenic
969720910 4:8892690-8892712 CTGCGGGCGGGGTGGGCCGAGGG - Intergenic
970300819 4:14679792-14679814 CAGGGGCTGAGGCAGGCAGAAGG - Intergenic
970365542 4:15354436-15354458 CTGGATGTGGGGAGGCCAGATGG + Intronic
970371563 4:15412311-15412333 GTGGGGGTGGGGGTGGGAGATGG - Intronic
970751369 4:19367152-19367174 CTGGGGGTGGGTGTGGAAGAGGG + Intergenic
971354478 4:25882668-25882690 TTGGGGGTGGGGTGGGACGAGGG + Intronic
971594742 4:28514723-28514745 CGGGGTGGTGGGCGGGCAGAGGG + Intergenic
972397809 4:38672583-38672605 CTGGGGGTGGGCAGGGCAGCCGG + Intronic
972691500 4:41403202-41403224 CTGGGGGTGGTGGGGGAAGATGG + Intronic
972738232 4:41866054-41866076 CTGGGGTTGGGGAAGGCAGGTGG - Intergenic
972939232 4:44177272-44177294 CTGGGGGTGGGGTGGGGTTAGGG - Intronic
973613461 4:52658450-52658472 CTAAGGGTGGGGCGGGCTGTGGG - Intronic
973634789 4:52851987-52852009 CTGGTGGTGGGGAAGTCAGAGGG - Intergenic
973706000 4:53581079-53581101 TTGGGGGTGGGGTGGGGACACGG - Intronic
973876652 4:55226822-55226844 CTGGGGGTGGGGGTGACAGGTGG - Intergenic
974069374 4:57110217-57110239 CGGGGGCAGGGGCGGGCAGGAGG + Exonic
974435136 4:61846835-61846857 GGTGGGGTGGGGCGGGAAGAAGG + Intronic
974505867 4:62771735-62771757 TGGGGGGTGGGGCGGGCAATGGG - Intergenic
975379463 4:73681533-73681555 CTGGGGGTGGTGGGGGTAGGGGG + Intergenic
975707788 4:77128134-77128156 ATGGGGATGGTGCGGGAAGAAGG + Intergenic
978047331 4:104146817-104146839 CTGGAGGTGGGGCGGGTACATGG - Intergenic
978747792 4:112213314-112213336 CTGGGGGTGGGGCGGGAGCCAGG - Intergenic
979193394 4:117890857-117890879 CCGGGGGTGGGGTGGGCGGCAGG + Intergenic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
980075299 4:128287824-128287846 GTGGGGTTGGGGAGGGCAGGGGG - Exonic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980836730 4:138203108-138203130 ATTGGGGTGGGGAGGGAAGAAGG - Intronic
980935216 4:139219624-139219646 CGGGGGGTGGGGATGGCAGTGGG + Intergenic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
981542648 4:145861676-145861698 CTGGGGTGGGGGCGTGCTGAAGG - Intronic
982091673 4:151884877-151884899 CTGGAGGTGGGGGTGGTAGAGGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982584787 4:157222470-157222492 GTGGGGGTGGGGCGGGGAGGCGG + Intronic
983019424 4:162656460-162656482 CGGGGGGTGGGGTGGGGGGAGGG + Intergenic
983823767 4:172231001-172231023 CTGGGGGTGGGGCGTGGGGCAGG - Intronic
984255066 4:177381371-177381393 ATGGGGGAGGGGCGGGCCAAAGG + Intergenic
984368279 4:178827444-178827466 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
984580570 4:181505024-181505046 CCAGGTGTGGGCCGGGCAGATGG + Intergenic
984873605 4:184348605-184348627 CAGGGGGTGGGGTGGGGAGGCGG - Intergenic
984885111 4:184442894-184442916 GTGGGGGTGGTGGGGGCAGCGGG + Intronic
984918415 4:184743475-184743497 TTGGGTGAGGGGAGGGCAGAGGG + Intergenic
985451573 4:190066251-190066273 GTGGGGATGGGGCGGTCAGGCGG - Intergenic
985452563 4:190069545-190069567 GTGGGGATGGGGCGGTCAGGCGG - Intergenic
985482911 5:128582-128604 CTGGAGGTGGGGCTGCCAGTGGG + Intergenic
985515908 5:344388-344410 CTGCGGGTGGGGAGGGCTGCGGG + Intronic
985574162 5:665878-665900 CTGGGGGAGGGGTGGTCAGGAGG - Intronic
985669996 5:1202136-1202158 CTGAGGGTGGGGCCGGGGGAAGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985863882 5:2496188-2496210 CTGGAGGTGGGGCCTGCAGGAGG + Intergenic
985926658 5:3024678-3024700 CTGGCGGTGGGGCAGGCTGGGGG + Intergenic
986600109 5:9464667-9464689 CTGGGGCTGCTGCCGGCAGATGG - Intronic
986623603 5:9702831-9702853 TTGGGGGTGGGGGTGTCAGATGG + Intronic
986685500 5:10272459-10272481 CTGTGGGTGGAGGGAGCAGAAGG - Intergenic
987232937 5:15913930-15913952 CGGGGGTTGGGGAGGGCAGGGGG + Intronic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
989102990 5:37837955-37837977 GAGGCGGTGGGGCGGGGAGACGG + Intronic
990609410 5:57442348-57442370 GTGGGGGTGGGGGCAGCAGAGGG - Intergenic
990683833 5:58277853-58277875 ATGGGGGTGGGGCAGGCCGTAGG - Intergenic
991166951 5:63574720-63574742 ATGGGGGTGGGGTGGGGGGAAGG - Intergenic
991172670 5:63646611-63646633 ATGGGGTGGGGGCGGGAAGATGG + Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991659704 5:68938015-68938037 GTCGGGGTGGGGTGGGAAGAGGG - Intergenic
991938815 5:71830277-71830299 CAGGGGGTGGGTCTGGCAGCTGG + Intergenic
992134890 5:73734344-73734366 CTGGGGTTGGGATGAGCAGAAGG + Intronic
992399871 5:76402671-76402693 CTGGGGCGGGGGCGGGCACAAGG + Intergenic
992624685 5:78626494-78626516 CTGGGGGTGGGGCGTGGAGAGGG - Intronic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993217973 5:85049459-85049481 CTGGAGGTGGGGGGGACACAAGG + Intergenic
993519513 5:88883496-88883518 CTGGGGGTGGTGGGGGCGGGGGG + Intronic
993545232 5:89203523-89203545 CGTGGGGTGGGGCGGGGAGCTGG + Intergenic
993901057 5:93584618-93584640 CGGGGGGTGGGGAGGGGGGAAGG + Exonic
993989705 5:94641175-94641197 GGGGGGGTGGGGCGGGCGGGAGG - Intronic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994104637 5:95933201-95933223 CTGGGGGTGGGGGATTCAGATGG + Intronic
994184980 5:96807404-96807426 GGCGGGGTGGGGCGGGCAGCTGG - Intronic
994591884 5:101783892-101783914 CTGGGAGTGGGGCTGCAAGAAGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995594741 5:113735690-113735712 TTGGGGGTGAGGTGTGCAGAGGG - Intergenic
997266261 5:132496908-132496930 CTGGCGGTGGGGCGGGGCGCAGG + Intergenic
997468252 5:134102328-134102350 TTTGGGGTGGGGGGGGTAGAGGG - Intergenic
997470480 5:134114639-134114661 CTGGGGGCGGGCCGGGCCGGGGG - Intergenic
997470490 5:134114657-134114679 CCGGGGGCGGGGCGGGCACTGGG - Intergenic
997521195 5:134525583-134525605 GTGGGGTGGGGGCGGGCAGGAGG - Intronic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997615178 5:135241142-135241164 CCAGGGGTGGGGCCGGCAGGTGG + Intronic
997823164 5:137084122-137084144 GTGGAGGTGGGGCTGGCAGAGGG - Intronic
997829136 5:137133951-137133973 CTGGGGGTGGGGGGGGTAGCGGG + Intronic
998038400 5:138935626-138935648 CTGGGGGCGTGGCGGGGAGGAGG + Intergenic
998040884 5:138950429-138950451 CTGGGGGAGGCGTGTGCAGAGGG + Intronic
998205272 5:140153180-140153202 CTGGGGGAGGGGTGAGGAGATGG - Intergenic
998251610 5:140557327-140557349 CTGGGGCTGGGGGAGACAGAGGG + Intronic
998461826 5:142315156-142315178 CTGGGGGTGGGGTGGGGAAAAGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
999143006 5:149375034-149375056 GTGGGGGTGGGGCAGGCAGAGGG - Intronic
999151674 5:149430444-149430466 CTGGGGGTGGGGGCGCCAGAGGG + Intergenic
999322644 5:150624821-150624843 CTCGGGGCGGGGCGCGCTGACGG + Intronic
999731463 5:154478962-154478984 GTAGGGGTGGGGCGGGAAGGAGG + Intergenic
999742687 5:154568549-154568571 CTGGGGGTGGGAGGGGAGGAGGG + Intergenic
999767908 5:154755224-154755246 CTGGGCGACGGGCGGGCAGGAGG - Intronic
999768086 5:154755739-154755761 CGGGGGGGCGGGCGCGCAGATGG + Intronic
1000266235 5:159640896-159640918 CTGGCAGGGGGGCGGGCTGAGGG + Intergenic
1000303055 5:159972611-159972633 CGGGGGGAGGGCCGGGGAGAGGG + Intergenic
1000751719 5:165103362-165103384 CTGGGGGTATTGCGGGCAAATGG - Intergenic
1001035158 5:168292022-168292044 CGGGGGGTGGCGCCCGCAGATGG - Intronic
1001093743 5:168760589-168760611 GTAGGGGTGGGGTGAGCAGAGGG + Intronic
1001122402 5:168991537-168991559 CTGGGGGTGGTGGGGGCAGTGGG - Intronic
1001204903 5:169753351-169753373 CAGGGGGTGGGGGGGGGTGAGGG - Intronic
1001264880 5:170266939-170266961 CTGGGGGTTGGGCGGGGCTAGGG + Intronic
1001383339 5:171318213-171318235 CTGGGGGTGGTGGGGGCGGGGGG - Intergenic
1001496260 5:172189229-172189251 CTGGGGGTGGGGGGGGGGGGCGG + Intergenic
1001503777 5:172260059-172260081 GTGGGGGTGCGGCGGGGAGGGGG - Intronic
1001907847 5:175487819-175487841 CTGGAGGTGGAGAGGGCCGAGGG - Intronic
1001995895 5:176157784-176157806 ATGGATGTGGGGCGGGGAGATGG - Intergenic
1002053377 5:176584526-176584548 CTGGGGGCTGGGTGGGCTGAGGG + Exonic
1002069831 5:176672605-176672627 TTGGGGCTGGGGGGGGCAGCAGG + Intergenic
1002483944 5:179522389-179522411 CTAAGGGTGGGGTGGGCAGTGGG - Intergenic
1002500619 5:179645092-179645114 CTAAGGGTGGGGTGGGCAGTGGG + Intergenic
1002564345 5:180101354-180101376 GGGGGGGGGGGGCGGGCAGCAGG + Exonic
1002571754 5:180143510-180143532 CTCAGCGTGGGGCTGGCAGAAGG + Intronic
1002579335 5:180198194-180198216 CTGGGGCTGGGGCCTGCAGAAGG - Intronic
1002670477 5:180861835-180861857 CCGGCGGTGGGGTGGGCAGGGGG - Intergenic
1002754731 6:148287-148309 CTGGGGGTGGGGCGCGGTGCAGG + Intergenic
1002887503 6:1310382-1310404 CTGGGGTTGGGCAGGGCAGGAGG - Intergenic
1002888793 6:1317033-1317055 CTGGGGGGGAGGCGGGAGGAGGG - Intergenic
1003058029 6:2840866-2840888 CTGGGGGTGGGGCGGGGGTAAGG + Intronic
1003092825 6:3118597-3118619 TTCGGGGCGGGGCGGGCAGAGGG + Intronic
1004356442 6:14933520-14933542 CTGAGGGTGGGAAGGCCAGAGGG + Intergenic
1004450419 6:15739995-15740017 CTGGCGGTGGGGGGGACAGAAGG - Intergenic
1004529377 6:16439366-16439388 CCGGGGGCGGGGCGGGAATAAGG + Intronic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1005709424 6:28489559-28489581 GTGGGGGAGGGGCGGGGAGCAGG + Intergenic
1005959323 6:30684710-30684732 CTGGGGGTGGGGGAGACAGAGGG + Exonic
1006052278 6:31354417-31354439 CTGGGGGTGGGTGGGGCAGAGGG - Intronic
1006300980 6:33193385-33193407 CTGGGGGCGGGGCCGGCCGGAGG - Intergenic
1006369212 6:33633808-33633830 CTGGGGGCGGGGCGGGCGCGGGG + Intronic
1006472125 6:34235364-34235386 CTGGACGTGGGGCGGGGAGCCGG + Intergenic
1006514631 6:34539151-34539173 TGGGGGCAGGGGCGGGCAGAGGG - Intronic
1006516154 6:34546813-34546835 CTGGGGATGTGGGGGACAGAGGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006808729 6:36806205-36806227 CTGGAGCTGGGGCGGGCAGCAGG - Intronic
1007282111 6:40720440-40720462 GTGGGGGTGGGGAGGCCTGAGGG - Intergenic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007450023 6:41935666-41935688 CTGGGGGTGGGCCAGGCTGATGG - Exonic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007615815 6:43179390-43179412 TGGGAGGTGGGGCGGGAAGAAGG - Exonic
1007693919 6:43719713-43719735 CTGGCAGTGGGGCGGGGAGAGGG + Intergenic
1007764459 6:44152570-44152592 CTGGGGGGGAGACGGGCAGGAGG - Intronic
1007791517 6:44311552-44311574 CATGGGGTGGGGGGGGAAGACGG + Intronic
1008071927 6:47106854-47106876 ATGGGGGGGGGGCGGGGAGGGGG - Intergenic
1009738892 6:67718200-67718222 CTGAGAGTGGGGCTGGAAGATGG + Intergenic
1010261640 6:73824084-73824106 GTTGGGGTGGGGTGGGCAGTAGG - Exonic
1010564943 6:77399413-77399435 GTGGGGGTGGGGCGGGGAGTGGG + Intergenic
1010717671 6:79248477-79248499 TTGGGGGGGGGGCAGGCAAAGGG - Intergenic
1012062960 6:94511475-94511497 CCGGGGGTGGGGCGCGGGGAGGG - Intergenic
1012968138 6:105697592-105697614 TAGGGGGAGGGGTGGGCAGAGGG + Intergenic
1014218560 6:118777093-118777115 CTGGGGCTGGGGAGGGCATGGGG + Intergenic
1014513462 6:122353966-122353988 GGGGGGGTGGGGAGGGCAGGGGG + Intergenic
1014632455 6:123803647-123803669 GCGGGGGTGGGGCGGGGAGCGGG - Intergenic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016034464 6:139372505-139372527 ATGGGGGTGGGGGGGGCGGCGGG + Exonic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1016827777 6:148404581-148404603 CTGGGGGTGGGGCAGGTGGTGGG - Intronic
1017036931 6:150275330-150275352 CTGGGGATGGGGTGGGGACAGGG - Intergenic
1017117753 6:150995153-150995175 ATGGGGGAGGGGTGGGGAGATGG + Intronic
1017196705 6:151709130-151709152 CTGGGGCAGTGTCGGGCAGAGGG - Intronic
1017359181 6:153545973-153545995 GGGGTGGTGGGGAGGGCAGAAGG - Intergenic
1017384935 6:153872429-153872451 TTGGGGGGGGGGCGGGGGGATGG - Intergenic
1017859056 6:158378487-158378509 GTGGGGGTGGGGGTGGGAGATGG + Intronic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1017980648 6:159398342-159398364 TTTGGGGTGGGGTGGGCAGTGGG + Intergenic
1018331123 6:162728032-162728054 CTAGGGGCGGGGCGGGAAGAGGG - Intronic
1018628792 6:165805019-165805041 CTGGGCGTGGGGCGAGCACAGGG + Intronic
1018735064 6:166681680-166681702 CGGGGGGGGGGGCGGGCAGGGGG - Intronic
1019207685 6:170376482-170376504 GTGGGGGGGAGGCGGGCAGCGGG + Intronic
1019341650 7:511373-511395 CTGGGGGTGGCAGGGGCAGAGGG + Intronic
1019359294 7:596478-596500 CTGGGGGTGGGGTGAGCACTGGG - Intronic
1019406383 7:886250-886272 CTGGGGCTGTGGGTGGCAGAGGG + Intronic
1019429338 7:991464-991486 AGGGGTGTGGGGCGGGCAGGAGG + Intergenic
1019497339 7:1346653-1346675 CTGGGGGTGGGACGGTCAGGTGG - Intergenic
1019539673 7:1545987-1546009 CCGCGGGTGGGGCTGGCACAAGG + Exonic
1019559925 7:1650922-1650944 CTGGGGGAGGGGTGGGCAAGTGG - Intergenic
1019701414 7:2476461-2476483 CTGGGGGTGGGGAGCGCCGGGGG + Intronic
1019786116 7:2978605-2978627 GTGGGGGTGGCGCGGGCACCGGG + Intronic
1020026888 7:4905660-4905682 CTGGGCCTGGGGCTGGGAGAGGG - Intergenic
1020049689 7:5073161-5073183 CTGGGGGTGGGGTCTGGAGAGGG - Exonic
1020125928 7:5532463-5532485 GGGGGGGTGGGGTGGGCAGTGGG + Intronic
1020204723 7:6105379-6105401 CTGGGGGCCGGGCAGGCAGGCGG + Intronic
1020309875 7:6859515-6859537 CTGGGGGGGGGCAGGGCAGGTGG - Intergenic
1020468410 7:8507183-8507205 TTGGGGGTGGCGTGGGGAGAAGG + Intronic
1020899537 7:13988542-13988564 GTGGGGGTGGGGTGGGGAGGAGG - Intronic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1021866375 7:24962388-24962410 AGGGGGGAGGGGAGGGCAGAAGG + Intronic
1021877210 7:25060034-25060056 ACGGGGGTGGGGCAGGCAGGGGG - Intergenic
1022275694 7:28853891-28853913 CCGGGTGTGGAGCGCGCAGAGGG + Intergenic
1022283762 7:28935615-28935637 CTGGGGGTGGGGCAGGCAGAGGG + Intergenic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1022422078 7:30232777-30232799 TTGGGGGTGGTGAGGGCAGAAGG + Intergenic
1022509072 7:30923662-30923684 CAGGGGCAGGGGCGGGCGGAGGG + Exonic
1022522840 7:31019140-31019162 CTGGGTGTGGGTAGGGCAGGAGG + Intergenic
1022766633 7:33419913-33419935 TTGGTGGTGGTGGGGGCAGATGG + Intronic
1022801478 7:33781063-33781085 CTGAGGGTGGGGGCTGCAGATGG - Intergenic
1023040952 7:36172894-36172916 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
1023220561 7:37916912-37916934 CTGGGGGTGGGGCGGCCGAGGGG - Exonic
1023558164 7:41444894-41444916 CTGGGGGTGGGGTGGGGAGTTGG + Intergenic
1023780416 7:43650189-43650211 CTGGGACAGGGGTGGGCAGATGG + Exonic
1023807712 7:43885704-43885726 ATGGGGATGGGGCGAGGAGAGGG - Intronic
1023863279 7:44227595-44227617 CAGGGGGTGTGGGGGACAGAGGG + Intronic
1024521017 7:50304304-50304326 CAGGGAGCGGGGCGCGCAGAAGG - Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1025839845 7:65136184-65136206 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1025883221 7:65559781-65559803 CTTGGGGTGGGGTGGGGGGAGGG + Intergenic
1025890225 7:65642825-65642847 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1026015711 7:66669295-66669317 CTGGGGAGGGAGCTGGCAGAAGG - Intronic
1026025440 7:66740677-66740699 CCGGGGGCGGGGCGAGCAGGAGG + Intronic
1026264319 7:68783173-68783195 GTGGGGGTGGGGTGGGGGGATGG - Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026414432 7:70163343-70163365 GTGGGGGGGGGGGGGGCAGAGGG + Intronic
1026443148 7:70460968-70460990 CTGGGTTTGGGAAGGGCAGAAGG + Intronic
1026828302 7:73597116-73597138 CAGGGGGTGGGGAGGACAGGGGG - Intronic
1026828894 7:73599961-73599983 CTGGGGCTGGGGAGGGGAGGGGG - Intronic
1026840423 7:73667759-73667781 CTGGGGGTGGGGCAGGGAGGAGG - Intergenic
1026840942 7:73669616-73669638 CTGGGGCTGGTGGGGGCAGTTGG + Intronic
1026892133 7:73988464-73988486 CTGGGGAGGGAGCTGGCAGAAGG - Intergenic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027232614 7:76281568-76281590 CGGCGGGCGGGGCGGGCAGGCGG + Exonic
1027722476 7:81761800-81761822 GTGGGGGTGGGCCGGGGAGCGGG + Intronic
1028332482 7:89611673-89611695 CTGGGGGTGGGGCTGGGGGAGGG + Intergenic
1028748002 7:94349375-94349397 CGGGGGGTAGGGTGGGTAGAGGG + Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028867810 7:95733709-95733731 CTTGGGGTGGGGTGGGAACAAGG + Intergenic
1029201430 7:98841863-98841885 CGGGGGGCATGGCGGGCAGAGGG - Intergenic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029465352 7:100721373-100721395 CTGGGGGTGGGGTGTGCACACGG + Intronic
1029605593 7:101597863-101597885 GTGGGGGTGGGGAGGATAGAAGG - Intergenic
1029737437 7:102472620-102472642 CGCGGGATGGGGCGGGCAGGGGG - Intronic
1030166989 7:106565124-106565146 GGGGGGCTGAGGCGGGCAGATGG - Intergenic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031833918 7:126659031-126659053 CTGGGGGCGGGGCGGGGGGCGGG - Intronic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1031980695 7:128122497-128122519 CGGGGGGTGGGGGGGGCATTGGG - Intergenic
1032054367 7:128672642-128672664 CTGGGGGAGGGGGGGGCGGGGGG + Intronic
1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG + Intergenic
1032388344 7:131539678-131539700 CTGAGGGCGGGGCTGGAAGAAGG + Intronic
1032805253 7:135347869-135347891 TTTGGGGTGGGGGTGGCAGAGGG - Intergenic
1033226031 7:139563118-139563140 CTTGGGGTGGGGCGGGGCGGGGG + Exonic
1033227382 7:139572758-139572780 GGGGGGGGGGGGGGGGCAGAGGG - Exonic
1033570947 7:142627545-142627567 CAGGGGGTGGGGCGGGGGGGAGG + Intergenic
1033598202 7:142871155-142871177 AGAGGGGTGGGGCCGGCAGATGG + Intergenic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1034162327 7:149002622-149002644 TTGGGGGTGGTGGGGGCAGGAGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034313495 7:150110443-150110465 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313514 7:150110512-150110534 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313532 7:150110581-150110603 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034322682 7:150199071-150199093 CGGGGGGGCGGCCGGGCAGAGGG - Intergenic
1034421331 7:150992604-150992626 CTGGGTGGGGGGCCGGCAGGCGG - Intronic
1034469542 7:151248117-151248139 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1034490819 7:151392292-151392314 CTGGGGGTGCAGGGGGCACATGG - Intronic
1034574785 7:151987613-151987635 CTGGGGGTGGGGTGGGCGGGAGG + Intronic
1034725444 7:153331371-153331393 CTGGGGCTGGGGCAAGGAGAGGG + Intergenic
1034793365 7:153990221-153990243 CTGAGGGTGGGGCTGGAAGAGGG - Intronic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035118998 7:156549353-156549375 CTGGGCGGTGTGCGGGCAGATGG - Intergenic
1035288245 7:157819730-157819752 CGGGTGATGGGGCGTGCAGAGGG - Intronic
1035289949 7:157831465-157831487 CTGGGGCTGGGGCTGGGAGACGG + Intronic
1035520136 8:269165-269187 GTGGGGGTGGAGCGGGGAGAGGG + Intergenic
1035795791 8:2355528-2355550 CTGGGAGTGAGGCGCACAGAGGG + Intergenic
1035795812 8:2355608-2355630 CTGGGAGTGAGGCGCACAGAGGG + Intergenic
1036620784 8:10423499-10423521 CTTGGGGTGGGGCGGGGAGGGGG + Intronic
1036637781 8:10563806-10563828 TAGGGGGTCGGGCGTGCAGAGGG - Intergenic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037026271 8:14041734-14041756 CTGGCGGTGGGGTGAGGAGAGGG + Intergenic
1037582140 8:20251994-20252016 CTGGGGGTGAGGCAGGCACGTGG + Intronic
1037693380 8:21202880-21202902 AAGGGGGTGGGGCGTGGAGAGGG + Intergenic
1038003213 8:23407839-23407861 CTGGGGATGGGGTGGACAGGAGG - Intronic
1038284697 8:26196501-26196523 CTGGAGATGGGGCGGGAGGAGGG - Intergenic
1038484101 8:27921496-27921518 CTTGGGGAGGGGCGTGCAGGAGG + Intronic
1038536043 8:28353284-28353306 CTGGGGGTGGGGGGGCGAGGGGG + Exonic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1038568167 8:28637005-28637027 GAGGGGGTGGGGCGGGGAGAGGG + Intronic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1039650793 8:39338963-39338985 CGGGGTGTCGGCCGGGCAGAGGG + Intergenic
1039954432 8:42196147-42196169 CTAGGGGTGGGGGGACCAGATGG + Intronic
1039961903 8:42254832-42254854 CTGTGGGGCGGCCGGGCAGAGGG - Intergenic
1040572731 8:48624679-48624701 CTGGGGGTGGGGGAAGGAGAGGG - Intergenic
1040620992 8:49092791-49092813 CGGGGGATGGGGGGGGCACAGGG - Intergenic
1041029742 8:53724591-53724613 GTCGGGGTGGGGCGGGGAGGAGG - Intronic
1041242599 8:55861046-55861068 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042723614 8:71849188-71849210 CTGGGGGTAGGCTGGGGAGAGGG + Intronic
1042832700 8:73049244-73049266 CTGGGGCTGGGGACGGCAAACGG + Intergenic
1043147706 8:76677982-76678004 ATGGGGGTGGGGCAGGGAGTGGG + Intergenic
1043479291 8:80637049-80637071 CTGGGGGTGGGGGAGGGGGACGG - Exonic
1043736010 8:83745111-83745133 TTGGGGGTGGGGCGGGGTGGGGG - Intergenic
1044434936 8:92150830-92150852 GTGGGGGTGGAGGGGGCAGGGGG + Intergenic
1044995916 8:97838101-97838123 CTGGGAGTGAGCCAGGCAGATGG + Intronic
1045021041 8:98044774-98044796 TTGGGGGTGGGTCGGGGAGACGG + Intronic
1045111085 8:98940206-98940228 CCGGGGGAGGAGCGGGCGGAAGG - Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046473931 8:114715845-114715867 CGGGAGGTGGGGCAGGCGGAGGG + Intergenic
1047430288 8:124785260-124785282 CTCGGGGTGGGGAGCGCTGAGGG - Intergenic
1047761927 8:127960936-127960958 TTGGGGGTGGGGGGGGCGGGCGG + Intergenic
1047904588 8:129459713-129459735 CTGGGGATGGGGCTGGTAGCAGG - Intergenic
1048048952 8:130799127-130799149 TGGGGGGTGGGGTGGGAAGAGGG + Intronic
1048186104 8:132242287-132242309 ATGGAGGTGGGGTGGGTAGAAGG + Intronic
1048443346 8:134476168-134476190 GTGTGGGTGGGGCAGGCAGGAGG - Intergenic
1048490281 8:134885601-134885623 ATGGGGATGGGGAGGGCAGTAGG + Intergenic
1048846201 8:138605577-138605599 CTGGCAGTGGGGCATGCAGAGGG + Intronic
1048879522 8:138861044-138861066 CTGGGGGTGGAGTGGGGTGATGG - Intronic
1049189301 8:141278173-141278195 CTGGTGCTGGGGCTGTCAGAGGG - Intronic
1049194382 8:141307737-141307759 CTGGGGGCGGGGAGGACTGATGG + Intronic
1049264964 8:141662843-141662865 CAGGGGGTGTGACGGGCGGAAGG + Intergenic
1049382655 8:142325162-142325184 CTGGAAGTGAGGCCGGCAGAGGG + Intronic
1049423017 8:142525171-142525193 CTGGGGGTTGGAGGGGCAGTGGG + Intronic
1049664533 8:143837098-143837120 CCGGGGGTGGGGCCAGCACACGG + Exonic
1049684597 8:143934231-143934253 CCGGGGGCGGGGCGGGGAGGGGG + Intronic
1049706948 8:144047418-144047440 CTGGGTGAGGGGCGGGGAGGGGG + Intergenic
1049756632 8:144313791-144313813 CCGGGGGCGGGGCGGGGAGGCGG - Intronic
1049789559 8:144466551-144466573 GTGGGGGTGGGGCAGGCGGCGGG - Intronic
1049801482 8:144519705-144519727 ATGGTGCTGGGCCGGGCAGACGG - Exonic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1050069127 9:1792011-1792033 CTGGGGGTGGAGTGGGCACAGGG - Intergenic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1050231108 9:3526439-3526461 TCCGGGGCGGGGCGGGCAGAGGG + Intergenic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1052254671 9:26441073-26441095 TGGGGGGTGGGGATGGCAGATGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052409637 9:28106432-28106454 CTAGGGGTGGGGCACGGAGAGGG - Intronic
1052879226 9:33590474-33590496 CTGGGGGTGGGGGTGAAAGATGG + Intergenic
1053269295 9:36739334-36739356 TTGGGGGTTGGGGGAGCAGAAGG + Intergenic
1053281926 9:36826124-36826146 CTGGGGGTGGGGGGGGGAGGGGG - Intergenic
1053496752 9:38553745-38553767 CTGGGGGTGGGGGTGAAAGATGG - Intronic
1053612512 9:39729192-39729214 TTGGGGGTCGGGGGGGCAGGGGG + Intergenic
1053870544 9:42487163-42487185 TTGGGGGTCGGGGGGGCAGGGGG + Intergenic
1054085743 9:60741964-60741986 TTGGGGGTCGGGGGGGCAGTGGG - Intergenic
1054555135 9:66647725-66647747 TTGGGGGTCGGGGGGGCAGGGGG - Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1054820356 9:69515689-69515711 CTGGGGGGGGGGGGGGCGGGGGG + Intronic
1056262512 9:84862903-84862925 CCTGGGGTGGGGAGGGCAGGTGG + Intronic
1056710766 9:88990855-88990877 CTGGGGGTAGAGCGCGGAGAGGG + Intronic
1056853367 9:90103443-90103465 CTGGGGTGGGGGCGGGGAAAGGG - Intergenic
1057015503 9:91647476-91647498 CAGGGGCTGGGGCGGGGGGACGG - Intronic
1057163660 9:92909169-92909191 GTGGGGAGGGGGCTGGCAGATGG - Intergenic
1057254381 9:93532891-93532913 CTGGGAGTGGGGGGTGCAGGTGG + Intronic
1057615693 9:96587863-96587885 GTGGGGGCGGGGCGGGGAGTTGG - Intronic
1057676667 9:97141301-97141323 CTGGGGGTGGGGGTGAAAGATGG - Intergenic
1057757868 9:97852248-97852270 CGGGGGAAGGGGCGGGCAGTCGG - Intergenic
1058341049 9:103897061-103897083 GGGGTGGCGGGGCGGGCAGAGGG + Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059404595 9:114092111-114092133 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1059404717 9:114092587-114092609 CAGGGTGGGGGCCGGGCAGATGG + Exonic
1059471162 9:114505535-114505557 GTGGGGAGGGGGCGGGCAGGAGG - Intergenic
1059490972 9:114667094-114667116 GGGGGGGTGGGAAGGGCAGAAGG + Intergenic
1059939043 9:119339980-119340002 CTTGGGGAGGGGCAGGGAGAGGG - Intronic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060044897 9:120332158-120332180 CTGCGGGTGGGGCGTGCTGCTGG - Intergenic
1060046400 9:120344769-120344791 GTGGGGGCGGGGAGGTCAGATGG - Intergenic
1060185981 9:121564531-121564553 CTGGGGGTTGAGGAGGCAGAAGG - Intergenic
1060199951 9:121646505-121646527 GTGGGGGTGGGGGGGACAGAGGG - Intronic
1060203841 9:121670065-121670087 ATGGTGGTGGGGCAGGCAGGTGG - Intronic
1060223935 9:121780256-121780278 CTGGGGGTGGGGTGGCAGGAGGG - Intronic
1060557411 9:124515523-124515545 CTGGGGGTGGGGTGGGGTGGGGG + Intergenic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060975363 9:127762042-127762064 ATGGGGGTGGGGTGGGAGGAGGG - Intronic
1061002441 9:127910059-127910081 CTGGGGGTGGCGGGGGGACAGGG + Intronic
1061084312 9:128390320-128390342 CTAGGGGTGGGGGGAGCAGGAGG - Exonic
1061100250 9:128486685-128486707 CTGGGGGTGGGGCAGGCAGCTGG + Intronic
1061222326 9:129259303-129259325 ATGGGGATGGGGCTGGGAGAAGG - Intergenic
1061230923 9:129315425-129315447 GTGGGGGTGGGGTGGGGAGGTGG + Intergenic
1061256463 9:129456434-129456456 GTGGAGGTGAGGCGGGAAGAAGG + Intergenic
1061287248 9:129631096-129631118 GAGGGGGTGGGGCAGACAGAGGG - Intronic
1061320121 9:129823486-129823508 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320203 9:129823694-129823716 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320263 9:129823855-129823877 CTGGGGCTGGGGCTGGGCGATGG - Intronic
1061342684 9:129995770-129995792 GTGGAGGTGGGTGGGGCAGAAGG + Intronic
1061497015 9:130980913-130980935 CGGGGGGGTGGGCGTGCAGATGG + Intergenic
1061562627 9:131415948-131415970 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1061563179 9:131419795-131419817 CCGGGGGTGGTGTGGGGAGAAGG + Intronic
1061569916 9:131470852-131470874 CTGGGGGTGGTGTGGGTAAAAGG - Exonic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1061727571 9:132589921-132589943 CTGGCGGGGGCGCGGGGAGAGGG - Exonic
1061742897 9:132720290-132720312 CTGGGAGTGGGGTGGGGAGGAGG + Intergenic
1061921954 9:133787388-133787410 CTGGGGGTGGGGTGATCAGTGGG + Intronic
1062061312 9:134496814-134496836 CTGGGGGAGAGGTGTGCAGATGG - Intergenic
1062254437 9:135614421-135614443 CAGGGGGTGGGGCAGACAGGGGG + Intergenic
1062264433 9:135680258-135680280 GTTGGGGTGGGGCTGGCAGGCGG + Intergenic
1062270843 9:135707642-135707664 CAGGGGGTGGGGACAGCAGAAGG + Intronic
1062331317 9:136046120-136046142 CAGGAGGTGGGCCGGGCAGAGGG - Intronic
1062465150 9:136677623-136677645 CTGGGGGTGGGGTGTGGAGGAGG + Intronic
1062489112 9:136795939-136795961 CTGGGGGTGGGGGGTGCAGAGGG + Intronic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1062533149 9:137010492-137010514 CTGGGGGTGGGGCCTGCATGGGG - Intronic
1062722176 9:138050253-138050275 CTGGGAGCGGGGCGGGGAGCTGG + Intronic
1203654532 Un_KI270752v1:10101-10123 CTGGGGCTGGGGCGGGTGGGGGG + Intergenic
1185464344 X:346049-346071 GTGGGGGTGGGGGTGGGAGAGGG + Intronic
1185476664 X:419522-419544 CTCGGGCTGGGGCAGGGAGAGGG - Intergenic
1185672766 X:1825500-1825522 TTGGAGGTGGGGCTGGCTGAGGG - Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186196115 X:7111492-7111514 CTGGGGGTGGGGTGGGGCGGGGG + Intronic
1186344308 X:8675851-8675873 CGGGGGGTGGGGTGGGGGGAGGG - Intronic
1186393324 X:9182907-9182929 CCGGGGGTGGTGCTGGCAGCAGG - Intergenic
1186502197 X:10060428-10060450 GAGGGGGTGGGGGGTGCAGAGGG + Intronic
1186771412 X:12821444-12821466 CTGGGGGTGGGGGGGGCAGTGGG + Intronic
1186786430 X:12960108-12960130 CTTGGGGTGGGGCGGGGAGTGGG + Intergenic
1187272797 X:17793815-17793837 CTGGGGGAGGGAGGGGGAGATGG + Intergenic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187380033 X:18793683-18793705 CGGGGGGTGGGGGGAGCGGAGGG - Intronic
1187415757 X:19092133-19092155 CTGTGGATTGGGCTGGCAGAGGG - Intronic
1187461073 X:19487122-19487144 CTGGGGGTGGGGGGGGGGAAGGG + Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1187719974 X:22140000-22140022 CTAGGGGTGGGGCTGGCAATTGG - Intronic
1187915510 X:24149695-24149717 CGGCTGGTGGGGCGGGCGGAGGG - Intronic
1188005065 X:25011368-25011390 GTGGGGGTGGGGCGGGGAAGAGG + Intronic
1188570917 X:31584251-31584273 CGGGGGGTGGGGCGAGGGGAGGG - Intronic
1188761810 X:34041654-34041676 GTGGGGGTGGGGTGGGCATCTGG - Intergenic
1188871866 X:35382642-35382664 GTGGGGGTTGGGCTGTCAGAAGG + Intergenic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189336150 X:40172015-40172037 CTGGGGTTGGCGAGGGCAGCTGG + Intronic
1189336754 X:40175157-40175179 CTGGGGGTGGGGTGGGGCGGGGG + Intronic
1189377100 X:40474652-40474674 GGGCGGGGGGGGCGGGCAGAGGG + Intergenic
1189472824 X:41327489-41327511 CTGGGGGTGGGGTGGTAAAAGGG + Intergenic
1189478668 X:41376462-41376484 CAGAGGGTGAGCCGGGCAGAAGG - Intergenic
1189519534 X:41751570-41751592 GAGGGGGTGGGGTGGTCAGATGG + Intronic
1190325880 X:49206624-49206646 CTGGGGGTGGGTGGGGCACCAGG + Intronic
1190466468 X:50729007-50729029 TTGGGGGTGGGGGTGGGAGATGG + Intronic
1190848497 X:54215748-54215770 CTGGGTGGCGGCCGGGCAGAGGG - Intronic
1190879044 X:54479670-54479692 CTGGGGGTGGGGTGGGGAAAGGG + Intronic
1191927395 X:66328396-66328418 CTGGGGGGGGGCGGGGGAGAGGG + Intergenic
1192034035 X:67544664-67544686 CTCGGGGTGGGGAAGGCAGGAGG - Exonic
1192138858 X:68630802-68630824 CTGACGGTGGAGCTGGCAGATGG - Intergenic
1192166883 X:68832037-68832059 CTCGGGGTGGTGGGGGCAAATGG + Intronic
1192174603 X:68877955-68877977 CTGGGGCTGGGTAGGGCCGAAGG + Intergenic
1192220590 X:69195103-69195125 CTGGGGGTGGGGGCTGCAGGAGG + Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192451256 X:71246452-71246474 CTGGGGGTGGTGGGGGTGGAGGG + Exonic
1192452215 X:71251650-71251672 CGGGGGTTGGGCCGGGGAGAGGG - Intronic
1192821457 X:74649969-74649991 CTGGGTGGGGGGCGAGGAGAGGG - Intergenic
1192928609 X:75781928-75781950 CTGGGGGAGCGGCAGGGAGAAGG - Intergenic
1193481088 X:82029829-82029851 CTGGGGGTGGGGGGGGGGGGTGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194978653 X:100417630-100417652 GTGGGGGTGGGGTGGGAAGGAGG + Intergenic
1195329198 X:103782947-103782969 CTGGGGATGGGGGGAGAAGAAGG - Intronic
1195717094 X:107827449-107827471 CTGAGTGTGGGGCGGATAGATGG + Intronic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1195938831 X:110150030-110150052 GTGGGGGTGGAGTGGGGAGATGG + Intronic
1195957882 X:110352530-110352552 CTAGGGGTGGGGTGGAGAGAGGG + Intronic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196728041 X:118914680-118914702 TTGGGGGGGGGGCGGGTAGAGGG + Intergenic
1196782989 X:119399572-119399594 CACCGGGTGTGGCGGGCAGAGGG + Exonic
1196836728 X:119820462-119820484 GTGGTGGTGAGGGGGGCAGATGG + Intergenic
1196916861 X:120545868-120545890 GTGGGGGTGGGGAGGGGTGATGG + Intronic
1197357467 X:125453262-125453284 GTGGGGGTGGGGCGGGGGGAAGG + Intergenic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1198099634 X:133413543-133413565 CTCCGGGTGGGGCGGGCAGGGGG - Intronic
1198189077 X:134285869-134285891 CAGGGTGGGGGCCGGGCAGAGGG + Intergenic
1198327324 X:135586629-135586651 GTGGGGGTGGCAGGGGCAGAGGG - Intergenic
1199006059 X:142697474-142697496 CTGGGGGTGGTGGGGGTAGAAGG - Intergenic
1199738785 X:150711720-150711742 CTGGTGCTGGGGCGGGGAGCGGG + Intronic
1199744889 X:150766218-150766240 CTGGGGGCGGGGCGGGGGGAGGG + Intergenic
1199782333 X:151073923-151073945 CAGATGGTGCGGCGGGCAGAGGG + Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200133457 X:153863610-153863632 CTGGGGGTGCGGGGCGTAGAGGG - Intronic
1200834876 Y:7723701-7723723 TTGGGGCTGGGGTGGGCAGGAGG + Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic