ID: 1150009023

View in Genome Browser
Species Human (GRCh38)
Location 17:61487854-61487876
Sequence CTTATCACAGCAGCCTGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150009018_1150009023 10 Left 1150009018 17:61487821-61487843 CCAGGTTTACATGATGCAGCTCA No data
Right 1150009023 17:61487854-61487876 CTTATCACAGCAGCCTGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150009023 Original CRISPR CTTATCACAGCAGCCTGACG GGG Intergenic
No off target data available for this crispr