ID: 1150010048

View in Genome Browser
Species Human (GRCh38)
Location 17:61494904-61494926
Sequence GAAAAGAATGTGCCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150010043_1150010048 28 Left 1150010043 17:61494853-61494875 CCAGGGGTTTGGGGCTCATCCAG No data
Right 1150010048 17:61494904-61494926 GAAAAGAATGTGCCTCCAGCAGG No data
1150010046_1150010048 9 Left 1150010046 17:61494872-61494894 CCAGGACACAGGACAGCATTCAA No data
Right 1150010048 17:61494904-61494926 GAAAAGAATGTGCCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150010048 Original CRISPR GAAAAGAATGTGCCTCCAGC AGG Intergenic
No off target data available for this crispr