ID: 1150010570

View in Genome Browser
Species Human (GRCh38)
Location 17:61498806-61498828
Sequence TCTGATGGCCGCAGTACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150010568_1150010570 -6 Left 1150010568 17:61498789-61498811 CCAAAGATGGAGGGTTGTCTGAT No data
Right 1150010570 17:61498806-61498828 TCTGATGGCCGCAGTACAAAAGG No data
1150010564_1150010570 24 Left 1150010564 17:61498759-61498781 CCATGTCTGCTGGTGTTAAGCAC No data
Right 1150010570 17:61498806-61498828 TCTGATGGCCGCAGTACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150010570 Original CRISPR TCTGATGGCCGCAGTACAAA AGG Intergenic
No off target data available for this crispr