ID: 1150016799

View in Genome Browser
Species Human (GRCh38)
Location 17:61565284-61565306
Sequence TTGAATTAGCATTAGTAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150016795_1150016799 7 Left 1150016795 17:61565254-61565276 CCCAGCTGGGAAGCAAACTAGAA No data
Right 1150016799 17:61565284-61565306 TTGAATTAGCATTAGTAGTAGGG No data
1150016796_1150016799 6 Left 1150016796 17:61565255-61565277 CCAGCTGGGAAGCAAACTAGAAT No data
Right 1150016799 17:61565284-61565306 TTGAATTAGCATTAGTAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150016799 Original CRISPR TTGAATTAGCATTAGTAGTA GGG Intergenic
No off target data available for this crispr