ID: 1150025615

View in Genome Browser
Species Human (GRCh38)
Location 17:61671085-61671107
Sequence ATTTTGTCCGGGGTGATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150025610_1150025615 3 Left 1150025610 17:61671059-61671081 CCTTGGGACATAGGCAGGAAACA No data
Right 1150025615 17:61671085-61671107 ATTTTGTCCGGGGTGATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150025615 Original CRISPR ATTTTGTCCGGGGTGATAAT GGG Intergenic
No off target data available for this crispr