ID: 1150028968

View in Genome Browser
Species Human (GRCh38)
Location 17:61711474-61711496
Sequence TGGGATTTCTAGGGAAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150028961_1150028968 6 Left 1150028961 17:61711445-61711467 CCTTCAGTGCAACTTGATTCCAA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG 0: 1
1: 0
2: 6
3: 40
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150028968 Original CRISPR TGGGATTTCTAGGGAAAAAA GGG Intronic
900006330 1:56167-56189 TGGGTTTTCTAGGCAGCAAAAGG - Intergenic
902357145 1:15912432-15912454 TGGAATTTATAGGGTAAACATGG + Intronic
903105032 1:21070319-21070341 TGGGATTTGAAGGGTAAAGAGGG - Intronic
903397862 1:23016023-23016045 AGTTATTTCTGGGGAAAAAACGG + Intergenic
904818020 1:33220131-33220153 TGGGCTTTGTAGGGAAGGAAAGG + Intergenic
906167550 1:43698201-43698223 AGGTACTTCTAGGGAAAATAGGG - Intronic
907531611 1:55104456-55104478 TGGACTTTCTATGAAAAAAATGG + Intronic
907844481 1:58191390-58191412 TGGGATTCCGATTGAAAAAAAGG - Intronic
908356811 1:63330228-63330250 TGGGATCTCTGGGGGAAATAGGG + Intergenic
909902810 1:81159579-81159601 AGCAATTTCTGGGGAAAAAATGG - Intergenic
911032417 1:93503800-93503822 TAAGATTTCTAAGTAAAAAAAGG + Intronic
911672313 1:100620948-100620970 AGAGCTTTCTGGGGAAAAAATGG - Intergenic
911672396 1:100621620-100621642 AGGGATTTCTGGGCAAATAAGGG - Intergenic
911736353 1:101340789-101340811 TGAAATATCTAGGCAAAAAATGG + Intergenic
913623767 1:120638667-120638689 AGGAAATTCTAGAGAAAAAAAGG - Intergenic
914046202 1:144095062-144095084 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
914131908 1:144865623-144865645 TTAGTTTTCTAGAGAAAAAAAGG + Intergenic
914927914 1:151905303-151905325 TGGAATTTATTGGGCAAAAAAGG - Intronic
917564500 1:176198771-176198793 TGCAATTTTAAGGGAAAAAATGG + Intronic
918202506 1:182280362-182280384 TGTGTTCTCTAGGGAAAAAAAGG - Intergenic
918267542 1:182858957-182858979 TAGTATGTCTAGGTAAAAAATGG + Intronic
918746157 1:188202906-188202928 TGCATTTTCTAGGGAAAAGATGG + Intergenic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919192927 1:194246802-194246824 TCTTATTTCTAGGGAAACAAGGG + Intergenic
919900584 1:202041383-202041405 TCTGATTTCTATGGACAAAATGG + Intergenic
921209675 1:212883702-212883724 TGGGCTTTATAGGCAGAAAAAGG + Intronic
921428300 1:215031410-215031432 TGAGATCTCTAGGAAGAAAATGG - Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921979180 1:221236428-221236450 CAGGATTTCTAGAGAACAAAAGG - Intergenic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
923798810 1:237186704-237186726 TGGGATTTCTGGGGACATGAGGG - Intronic
923869871 1:237980053-237980075 TAGAAACTCTAGGGAAAAAATGG + Intergenic
923888971 1:238189974-238189996 TGAGCTCTCTAGGGAAAAGAAGG - Intergenic
924357876 1:243202834-243202856 TGTGTTTTCCATGGAAAAAATGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924662467 1:246034255-246034277 TCAGATTCATAGGGAAAAAAAGG - Intronic
924686013 1:246290720-246290742 TGGGATGTGAAGGAAAAAAAAGG - Intronic
924687197 1:246306385-246306407 TTTTATTTCAAGGGAAAAAATGG - Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063544765 10:6970122-6970144 AGCAATTTCTAGGGACAAAAAGG + Intergenic
1063978370 10:11434792-11434814 TGGAATTTATTGGGAGAAAACGG + Intergenic
1064334176 10:14423432-14423454 TGGAATTTATTGGGCAAAAAGGG - Intronic
1065016518 10:21467562-21467584 AGGGCTTTGTAGGGAAAAACAGG - Intergenic
1065586394 10:27222188-27222210 AGGGATGTCAAGGGAAAAAAAGG + Intronic
1067128035 10:43536778-43536800 TGAGATTTCTAAGCAAAACAAGG - Intergenic
1067179858 10:43976793-43976815 AGGGATGTCTAGGGATGAAATGG + Intergenic
1067511801 10:46902043-46902065 TATGATTTTTAGGGAAAAAAAGG + Intergenic
1067650446 10:48149781-48149803 TATGATTTTTAGGGAAAAAAAGG - Intergenic
1067957250 10:50805991-50806013 TAGGAGTTCTAGGGAAAAATAGG + Exonic
1068137674 10:52966176-52966198 GGGGATTTCCAGGTAGAAAAGGG - Intergenic
1070704785 10:78629755-78629777 TGTGATTTCTTGGGAAGAAGTGG - Intergenic
1071284999 10:84136430-84136452 AGGGATTCCAAGGGAAAACAAGG + Intergenic
1072919950 10:99568469-99568491 TGGGATTTTCAGTGATAAAATGG - Intergenic
1072948513 10:99832425-99832447 TGGGAGTACAAAGGAAAAAAAGG + Intronic
1073338805 10:102729822-102729844 TGTGGTTTGTAGGGAGAAAAAGG - Intronic
1073427449 10:103464333-103464355 TGGGAGTTATAGGGAAGAGATGG - Intergenic
1073646055 10:105305348-105305370 TGAGGTTTCTAGGGAAAAGAAGG - Intergenic
1074165132 10:110868450-110868472 TGGGGTATCTTGAGAAAAAAAGG + Intergenic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1077878976 11:6332822-6332844 TCAGATTTCTAAGGAACAAAGGG - Intergenic
1078515635 11:12019740-12019762 TGAGATTTTGAGGAAAAAAAAGG - Intergenic
1079611121 11:22433501-22433523 TGGGATTTGGAGGTATAAAAAGG + Intergenic
1080296802 11:30739084-30739106 TGGTGTTTCTAGGGAAAGGAAGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080952576 11:37052309-37052331 TGTAATTTATAAGGAAAAAAAGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083396949 11:62398858-62398880 TGGAATTTCTAGGGAAGACAGGG - Intergenic
1084041990 11:66547678-66547700 TGGGGTATCTTGGGAAAGAATGG - Intronic
1084582869 11:70035102-70035124 GGGGATTTCCAGGAAAGAAAAGG - Intergenic
1085591645 11:77767717-77767739 TGGGTGTTCCAGGGACAAAAAGG - Intronic
1085818211 11:79763943-79763965 CTGGATTGCAAGGGAAAAAATGG + Intergenic
1086253509 11:84846564-84846586 TGTGATTGCTAGGGAGAGAATGG - Intronic
1086293500 11:85338189-85338211 TGTTAACTCTAGGGAAAAAAGGG + Intronic
1087069081 11:94057795-94057817 TGTGATTAATAGAGAAAAAAAGG - Intronic
1087462843 11:98466974-98466996 TGGAATTTATTGGGAAAAAAGGG - Intergenic
1087523497 11:99276003-99276025 TGGGCTTTCTAGGAAAAGAGTGG - Intronic
1087646937 11:100818936-100818958 TGGCTTTAGTAGGGAAAAAATGG + Intronic
1088282609 11:108150798-108150820 TGAAAATTCTGGGGAAAAAATGG - Intergenic
1088761541 11:112933752-112933774 TGGGCATTCTAGGGAAAAAATGG + Intergenic
1088864472 11:113834467-113834489 TGTTATTTCTAAGGAAATAATGG + Intronic
1090963885 11:131581497-131581519 TTGGCTTTATAGGCAAAAAAGGG + Intronic
1092089481 12:5792763-5792785 TGGGTTTTCTGGGAAATAAAGGG - Intronic
1092720493 12:11435929-11435951 TGGAATTTATTGGGCAAAAAGGG + Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1093518020 12:20013941-20013963 TGGGATATCAATGGAACAAATGG + Intergenic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094145199 12:27221375-27221397 TGGGCTTTATAGGCAGAAAAGGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096606652 12:52771312-52771334 TGGGATTTCTAAGGAAAGGGAGG - Intronic
1096861302 12:54530420-54530442 TGGGACTACTAGAGAAAAGAAGG + Intronic
1097634536 12:62106470-62106492 TGGGGTTTCTGGGAAAATAAAGG + Intronic
1097726022 12:63076774-63076796 TGGGATTTCTAGAAGCAAAATGG + Intergenic
1097806124 12:63966941-63966963 TGGAAATTCTTAGGAAAAAAAGG - Intronic
1097949675 12:65413810-65413832 TGGGAATGCTAGGGAAGACAGGG + Intronic
1098295802 12:69003028-69003050 TTGGATTTCTAGGGCAAGTATGG + Intergenic
1098323386 12:69275411-69275433 TGAGATCTGTAGGAAAAAAATGG + Intergenic
1098606353 12:72395505-72395527 TGGGAATTCTAGGGAGAAGGAGG - Intronic
1098631227 12:72724555-72724577 AGGCATTTCTAAGGAAACAAAGG - Intergenic
1098833990 12:75398394-75398416 TGCGTTTTCTAGGTCAAAAATGG - Intronic
1098861804 12:75718975-75718997 TGGGATTTTTAGGTAAAGTAAGG + Intergenic
1099369220 12:81810029-81810051 TATTACTTCTAGGGAAAAAAAGG + Intergenic
1099974457 12:89532148-89532170 AGGGATTACTAATGAAAAAATGG + Intergenic
1100959296 12:99944820-99944842 AGGGATTGCTAGGGAAAAACTGG + Intronic
1101141877 12:101803847-101803869 TGAGATTTTTATGGAAATAAAGG + Intronic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1101774709 12:107783026-107783048 TGGGAATTTTAGAGAAATAAGGG + Intergenic
1101905365 12:108820776-108820798 TGGTAATTCTAGGGAAAAAAAGG + Intronic
1102760164 12:115377801-115377823 TGGTATTTCTAGGAAGATAAAGG + Intergenic
1103331507 12:120157683-120157705 TGGGTTTTTTAAGGCAAAAACGG - Intronic
1103428969 12:120865086-120865108 AGGGATTTCCAGGGAAATAGGGG + Intronic
1103643692 12:122373653-122373675 TTTCATTTCTAGGGGAAAAATGG + Intronic
1105893703 13:24700311-24700333 GATGATTTCTAGGGAAAAAAGGG - Intronic
1106024292 13:25942220-25942242 TGGCAACTGTAGGGAAAAAAAGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107337024 13:39365999-39366021 AGGGTTTTCAAGGGAAGAAAGGG - Intronic
1108587117 13:51879889-51879911 AGGGCTTTCTAGAGAATAAAAGG + Intergenic
1108932509 13:55844157-55844179 GGGAATTTGTAGGGAAAAAAAGG - Intergenic
1109832843 13:67814593-67814615 TAGGAGTTGTAGGGAGAAAAAGG + Intergenic
1110094458 13:71499048-71499070 TGAAATTTCTTGGAAAAAAATGG + Intronic
1110413327 13:75226493-75226515 TGGGATTTATTGGGCAAAAAAGG - Intergenic
1110981532 13:81905989-81906011 TGGGTTTTATAGAAAAAAAATGG - Intergenic
1111310966 13:86485158-86485180 TTGGATAACTGGGGAAAAAATGG - Intergenic
1113401970 13:110002482-110002504 TGGGATTTACAGGAAAATAATGG + Intergenic
1114844367 14:26303261-26303283 TGGGAGTTCTGAGGAAATAATGG + Intergenic
1115057831 14:29152406-29152428 TGGAATTTCTGGAGGAAAAAAGG - Intergenic
1116186953 14:41609525-41609547 AGGGAATTCAGGGGAAAAAAAGG - Intronic
1116374569 14:44182590-44182612 GGGGATTTCTAGAGATGAAAAGG - Intergenic
1117285007 14:54278459-54278481 TGGGTTTTATTGGGTAAAAAGGG - Intergenic
1117657590 14:57972489-57972511 TGGCTTTGGTAGGGAAAAAAAGG + Intronic
1117815042 14:59589015-59589037 TTAAATGTCTAGGGAAAAAAAGG + Intergenic
1118940937 14:70337000-70337022 AAGGGTTTCCAGGGAAAAAATGG - Intronic
1119130019 14:72163572-72163594 TGGGATTTGTCAGTAAAAAATGG + Intronic
1120468476 14:84892307-84892329 TGGTGTTTCTAAGGAAGAAATGG - Intergenic
1120541405 14:85755331-85755353 TGGGATATGTGGGGAAAGAAGGG - Intergenic
1120735706 14:88049625-88049647 TGGGATGTCTACAGAAGAAATGG + Intergenic
1121000553 14:90449334-90449356 TGGGGTTTCTTGGGAATAAGTGG + Intergenic
1121976197 14:98406211-98406233 TGGGCCTCCTAGGGAAATAAAGG + Intergenic
1125033462 15:35096306-35096328 GGAGATTCCTAGAGAAAAAAGGG + Intergenic
1125338781 15:38654064-38654086 AGGGATTTCTAGGGCTAGAAAGG + Intergenic
1125406832 15:39361303-39361325 TGGGGTAATTAGGGAAAAAAAGG + Intergenic
1125433297 15:39619889-39619911 GGAGGTCTCTAGGGAAAAAAGGG + Intronic
1126333794 15:47564652-47564674 GAGGAATTCTAGGGAGAAAAGGG + Intronic
1126440954 15:48687894-48687916 TGGAAAATCTAGGGAAAAAATGG + Intergenic
1126472715 15:49031357-49031379 TGGGATGTATAGGCAGAAAATGG - Intronic
1126617748 15:50603058-50603080 TGGTATTTCAAGGAAAAATAGGG - Intronic
1127225979 15:56929746-56929768 TGGTTTTTTAAGGGAAAAAAAGG - Intronic
1127231145 15:56996980-56997002 TGGCAATGCTATGGAAAAAAGGG + Intronic
1127969750 15:63949112-63949134 TGGGTTTTCTGGGAAAAACATGG - Intronic
1128281514 15:66398422-66398444 GGTGATATCAAGGGAAAAAAAGG + Intronic
1128958383 15:71973608-71973630 TGGCATTTCTAGGGAAAGTTGGG - Intronic
1130806235 15:87326505-87326527 AGGGAATTCTGGGGGAAAAAAGG + Intergenic
1131442346 15:92468422-92468444 TGGGCTTTGAAGGGAAGAAAAGG - Exonic
1131722264 15:95182699-95182721 TGATATTTCTAGGGGAAAATAGG + Intergenic
1131747509 15:95464903-95464925 TGGTATTTCTTGAGAAAAAAAGG - Intergenic
1131957984 15:97758140-97758162 TAAGAGTTCTAGGGAAAAACCGG - Intergenic
1132447191 15:101934791-101934813 TGGGTTTTCTAGGCAGCAAAAGG + Intergenic
1133185026 16:4089889-4089911 TGGCTTTTCCAGGGAACAAAAGG - Intronic
1133727882 16:8554247-8554269 TGTGATTTCAGGGAAAAAAAGGG + Intergenic
1134617198 16:15660792-15660814 GGCGGTTTCAAGGGAAAAAAGGG - Intronic
1135739011 16:24957364-24957386 GGGGATTTCTAGGGAAAAGGGGG + Intronic
1136137031 16:28262419-28262441 AGGCATTTGTAGGGAAAGAAAGG + Intergenic
1136247620 16:28984797-28984819 TGGGAATTCTGGGGTACAAAGGG - Intergenic
1137346953 16:47671605-47671627 TGTGATTTTGAAGGAAAAAATGG - Intronic
1139282573 16:65783364-65783386 TTTGATTTCTTGGGAGAAAAAGG + Intergenic
1141149789 16:81556054-81556076 TGCATTTTCCAGGGAAAAAATGG - Intronic
1141758708 16:86012522-86012544 TGTGATTTCTACTGAGAAAAGGG + Intergenic
1142911305 17:3094323-3094345 TAGGCTTTCGAAGGAAAAAAAGG - Intergenic
1144481326 17:15631800-15631822 TGGGCTTCCTGGGGAAAGAAGGG + Intronic
1144916979 17:18731931-18731953 TGGGCTTCCTGGGGAAAGAAGGG - Intronic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1146307850 17:31744409-31744431 TGTGATTATTAGGGACAAAAAGG + Intergenic
1148579752 17:48735379-48735401 AGGGATTTATAGGGAAAGTAGGG - Intergenic
1149102325 17:52921867-52921889 TGGAATTTATTGGGAAAAAAAGG + Intergenic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1151463491 17:74269737-74269759 TGGCTTTTCTTGGGAAATAAGGG - Intergenic
1151587669 17:75020408-75020430 AGGGATTTCTAGGGAAAGAAAGG - Intronic
1155632196 18:27906557-27906579 TTGGATTTCTCCGCAAAAAATGG + Intergenic
1156988952 18:43382866-43382888 TGGTCTTAGTAGGGAAAAAACGG + Intergenic
1157347465 18:46852784-46852806 TGGCATTGCTATGGAAAATATGG - Intronic
1157349618 18:46872925-46872947 TGGTTTTTCTAGGGAAGGAAGGG - Intronic
1157730754 18:50002088-50002110 TGGGAATGTTAGGGAAACAAAGG - Intronic
1158014607 18:52768992-52769014 TGGGTTGTCTAGGAAAAAAATGG + Intronic
1158444708 18:57509493-57509515 AGGGATTGTTAGGGAAAAAGAGG - Intergenic
1159568769 18:70087949-70087971 AAGAATTTCTAAGGAAAAAAAGG + Intronic
1159885471 18:73899676-73899698 TTGGATTTATAGGGAATACATGG - Intergenic
1160638085 19:97742-97764 TGGGTTTTCTAGGCAGCAAAAGG - Intergenic
1161748545 19:6077005-6077027 CTGGATTTCTAGGGAAGAAAAGG - Intronic
1162641976 19:12017926-12017948 TGTGTGTTGTAGGGAAAAAATGG - Exonic
1166143980 19:40821874-40821896 TGGGGTTTCTGGGGAAAAGGAGG + Intronic
1166183629 19:41125222-41125244 TGGGGTTTCTGGGGAAAAGGAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167179177 19:47889188-47889210 TGGGATTTTGGGGCAAAAAAAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168133967 19:54338232-54338254 TAGGCTTTCAAGAGAAAAAAAGG + Exonic
1168494316 19:56837432-56837454 TGGGATTTTAAGTGAGAAAATGG - Intronic
1202685755 1_KI270712v1_random:48477-48499 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
926594554 2:14776161-14776183 TAAAAGTTCTAGGGAAAAAATGG + Intergenic
927252246 2:21006928-21006950 TGAGATTTCTAGGGACATGAAGG + Exonic
927657030 2:24957763-24957785 TCAGATTTCTAGGGAAAGAGTGG - Intronic
929023834 2:37579861-37579883 TGGGGTTGCTAGGGAATACAGGG - Intergenic
929704786 2:44198850-44198872 TGTAATTACTAGGGAATAAAGGG + Intronic
931034926 2:58229464-58229486 TGGGATATCTGTGGCAAAAATGG - Intronic
931701617 2:64913630-64913652 TGGGATCTCTAGGTAGTAAAAGG + Intergenic
933060352 2:77728912-77728934 TGAAATTTAAAGGGAAAAAAAGG + Intergenic
934245969 2:90306347-90306369 TTAGTTTTCTAGAGAAAAAAAGG + Intergenic
934262777 2:91490688-91490710 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
934483567 2:94678354-94678376 TTATATTTTTAGGGAAAAAATGG - Intergenic
934909581 2:98238883-98238905 TGGAAATTTTAGGGAAAAAAAGG + Intronic
935119623 2:100172309-100172331 TGTAATTTCTATGGAAACAATGG + Intergenic
935338099 2:102035327-102035349 TGGAATTTATTGGGCAAAAAGGG - Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
936520949 2:113211865-113211887 GGGTGTTTCTAGGGAAGAAATGG + Intergenic
936820647 2:116516389-116516411 TGGGTTCTCTATTGAAAAAATGG + Intergenic
938193430 2:129303407-129303429 TGAGATTTCAAGTGAAAGAAAGG + Intergenic
938193802 2:129307951-129307973 TGGCATTTCAAGGGTATAAATGG - Intergenic
939396125 2:141631707-141631729 TGGGCTTTATAGGCAGAAAAGGG - Intronic
939716858 2:145594731-145594753 TGTGATAACTAGGAAAAAAATGG - Intergenic
939773668 2:146357534-146357556 TTGGCTTTCTAGAGAAAGAAGGG - Intergenic
939985250 2:148824010-148824032 TGGGATTTCTGTGGGAATAAAGG + Intergenic
940139522 2:150478297-150478319 TGGGCTTTATGGGGAAGAAAAGG - Intronic
940144444 2:150531477-150531499 TCCCTTTTCTAGGGAAAAAAAGG + Intronic
940538271 2:154975161-154975183 TGGGATTTTTAGGGAAAGTTAGG + Intergenic
941249958 2:163148863-163148885 TGGGATTTATTGGGCAAAAAGGG - Intergenic
941343448 2:164337042-164337064 AGGGGTTACTATGGAAAAAAAGG + Intergenic
941368187 2:164632580-164632602 TGGAGGTTCTAGGAAAAAAAAGG - Intergenic
941506805 2:166356487-166356509 TGCTATTTATGGGGAAAAAATGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942522686 2:176820693-176820715 GGGTAGCTCTAGGGAAAAAAAGG - Intergenic
942923348 2:181403728-181403750 TGGAAGTTCTGGGGAAAAGAAGG + Intergenic
943341298 2:186685168-186685190 TGGGGTTTCAATGGAAAAATGGG - Intergenic
943442137 2:187938411-187938433 TGGAAGTTCTAAGGAAATAAAGG - Intergenic
943468063 2:188255358-188255380 TGTGATTTATGGTGAAAAAAAGG + Intergenic
943707480 2:191050767-191050789 TGGGTTTTCTGGGAAGAAAATGG + Intronic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
943839157 2:192555628-192555650 TCTGTTTTCTAGGGAGAAAAGGG + Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945127864 2:206533169-206533191 TGAGATCTTTAGGGGAAAAAAGG - Intronic
945633735 2:212319965-212319987 TGGGATTTTTGGGGAAGGAATGG - Intronic
945797615 2:214384336-214384358 TAGCATCTCTAGGGAAAAATGGG - Intronic
945806440 2:214495729-214495751 TTGGATTTCTTTAGAAAAAATGG - Intronic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
946970335 2:225083738-225083760 GGGGCTTTCTGGGGAAGAAATGG + Intergenic
947083498 2:226425075-226425097 AGGGATTTAAAGGGAGAAAACGG - Intergenic
947165757 2:227260175-227260197 TGGGATTACGAAGGGAAAAATGG + Intronic
947678718 2:232009897-232009919 AGTGATTTCAAGGGCAAAAAAGG - Intronic
1169284723 20:4298412-4298434 TGAGAGTTCTAAGGACAAAAGGG - Intergenic
1169326240 20:4679058-4679080 CTGGATTTCTAGGGAAACAAAGG - Intergenic
1170421994 20:16202335-16202357 TAGAATTTTTATGGAAAAAAAGG + Intergenic
1171737408 20:28808936-28808958 TTTGATTCCTATGGAAAAAAAGG - Intergenic
1173316329 20:41947908-41947930 GGTGATTTCTAGGGACAGAAGGG + Intergenic
1174299266 20:49569598-49569620 TGGGACCTCTAGGGAAAGATGGG - Intergenic
1174703514 20:52633410-52633432 TGGCATCTCCTGGGAAAAAAGGG + Intergenic
1177252430 21:18612015-18612037 TGGGATTTCCAGAACAAAAAAGG + Intergenic
1177281372 21:18986994-18987016 GGGAAATTCTAGGCAAAAAACGG + Intergenic
1177799723 21:25816593-25816615 TGAGAAGTCAAGGGAAAAAAAGG - Intergenic
1177918254 21:27118044-27118066 AGAAATTTCTATGGAAAAAAGGG - Intergenic
1178603757 21:34017205-34017227 GGGGGTTGCTAGGAAAAAAAGGG + Intergenic
1179266713 21:39810066-39810088 TGTGATTTCTGGGGAGAGAAAGG - Intergenic
1179790933 21:43755605-43755627 GGGGATTTCCAGGGAACACAAGG - Intronic
1180393671 22:12309210-12309232 TTGGATTTGTCTGGAAAAAAAGG + Intergenic
1180406078 22:12555542-12555564 TTGGATTTGTCTGGAAAAAAAGG - Intergenic
1180681430 22:17629547-17629569 TGGGATTTTGGGGAAAAAAACGG - Intronic
1183163549 22:36130954-36130976 TGGGATTTCCTGTGAAGAAAAGG - Intergenic
1184962144 22:47938359-47938381 TGGTATTTCTAAGTAAACAATGG - Intergenic
949269764 3:2201029-2201051 TGGCATTTCTCAGGGAAAAAAGG - Intronic
949610679 3:5700165-5700187 TTTAATTTATAGGGAAAAAATGG + Intergenic
949744111 3:7268629-7268651 TGGGCTTTGTAGAGAGAAAAGGG + Intronic
949787156 3:7754405-7754427 TGGGATGTGTAGGGGAAAACTGG + Intergenic
949791519 3:7797321-7797343 TGGGATGTAGAGGCAAAAAATGG + Intergenic
950294391 3:11816101-11816123 TGGAATTTCTAGAGCTAAAAAGG - Intronic
950973445 3:17213935-17213957 AGGCATTTGTAGAGAAAAAAAGG + Intronic
950980038 3:17293241-17293263 TTGAATTTCTGGAGAAAAAAAGG - Intronic
951281040 3:20750286-20750308 GGGCATTTCAAGGCAAAAAATGG + Intergenic
951487564 3:23230993-23231015 AGGGCTTTCTAGAGAAATAATGG + Intronic
951661973 3:25076899-25076921 TGGGATTTCTAGGACAAATCTGG + Intergenic
951922431 3:27871109-27871131 TGGGATTTCTTGGGACACCAAGG + Intergenic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
953675378 3:44997367-44997389 TGGGATTAGTTGGGAAAAGATGG + Intronic
953971733 3:47353560-47353582 TGGGAGTTTTAGGGTAGAAAAGG + Intergenic
954968651 3:54633488-54633510 TCGGATTTATTGGGCAAAAAGGG + Intronic
955529711 3:59860431-59860453 TGGAACTTGTAGGGAAAAGAAGG + Intronic
955722612 3:61899572-61899594 TGTGCTGTCTATGGAAAAAAGGG + Intronic
956086895 3:65621119-65621141 TGGTATGTCTAGGAAAATAAAGG + Intronic
956247715 3:67202935-67202957 TGGGATTGATTGGGCAAAAAAGG - Intergenic
956642407 3:71427507-71427529 TGGGCTCTCTTGTGAAAAAAAGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
958199986 3:90301180-90301202 TGTGATTTATATGGTAAAAAAGG - Intergenic
958645539 3:96867657-96867679 TACCATTTCTAAGGAAAAAAAGG - Intronic
959896481 3:111612387-111612409 TGTAATTGCTAGGGAAAAAATGG - Intronic
960348203 3:116561037-116561059 AAGGATTGCTAGGGAAAAAGAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962065273 3:131973050-131973072 TGGGATTTTTAGGGCCAAAAAGG - Intronic
962454387 3:135551850-135551872 TGGGACTGCTAGAGAAGAAATGG - Intergenic
963863759 3:150337954-150337976 TCTGATTTTTTGGGAAAAAAAGG - Intergenic
964861440 3:161206575-161206597 TGGAATGTCTAGGGCAAAACAGG - Intronic
965214511 3:165844650-165844672 TTGGGCTTCAAGGGAAAAAATGG + Intergenic
966223681 3:177575219-177575241 TGGAATTAGTAGAGAAAAAAAGG - Intergenic
967385702 3:188908768-188908790 TGGGACTCCTATGGAGAAAAGGG + Intergenic
970672842 4:18416070-18416092 TGTGAATTATAAGGAAAAAAAGG - Intergenic
971754921 4:30695068-30695090 AGGAATTTCTGGGGAAAATATGG + Intergenic
971923892 4:32980899-32980921 TAGGATTGCTAGGTCAAAAATGG + Intergenic
971945058 4:33264554-33264576 TGAGATTACTAAGGAAATAAAGG + Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972113727 4:35600597-35600619 TAGGATTTAAAGGGAAAACAGGG + Intergenic
973566785 4:52197020-52197042 TGGCATTTCTAAGGAAGAGAGGG - Intergenic
974210320 4:58764396-58764418 AGGGCTTTCCAGGGAATAAAGGG - Intergenic
975061467 4:70007671-70007693 TTAAATTTCTAGGAAAAAAATGG + Intergenic
977281008 4:95040092-95040114 TGAGGTTTCTATGGAAAAACTGG + Intronic
977434835 4:96980886-96980908 TTGGAGATGTAGGGAAAAAAAGG + Intergenic
979243933 4:118476648-118476670 TGTGTTTTCCATGGAAAAAATGG + Intergenic
981085179 4:140676159-140676181 TGTGATTTCAAGGGAAGAAATGG - Intronic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981396272 4:144253381-144253403 TGGAATTGGTAGAGAAAAAAGGG + Intergenic
981412895 4:144453867-144453889 AGAGGTTTCTAGGGAATAAAGGG - Intergenic
982689456 4:158531531-158531553 TGTGCTTTCTGAGGAAAAAAAGG - Intronic
983906806 4:173191749-173191771 ACGGATTTCTAAGGAAAGAAAGG - Intronic
984499680 4:180543948-180543970 TGGGAATTCTGAGGAGAAAAAGG - Intergenic
984541177 4:181039466-181039488 TAAGATTTCTAGGAAAAAAAAGG + Intergenic
984592822 4:181635747-181635769 TAGGATTTCCTGGGAAGAAAGGG + Intergenic
985120749 4:186639090-186639112 TGGGTTTTCTAAGGACTAAAAGG + Intronic
985510473 5:310518-310540 TGGGATTTCGAGGGAGGGAAGGG + Intronic
985634507 5:1029238-1029260 TGAGAATTCTAGGGAATAAGGGG + Intronic
985912654 5:2895972-2895994 TAGGATTTCCAGGGAAGAAGAGG - Intergenic
986892245 5:12322987-12323009 TGGGACTTCCAGAGAAAGAAAGG + Intergenic
987570386 5:19649782-19649804 TGGAAGTTTTAGGAAAAAAAAGG - Intronic
988010680 5:25478735-25478757 ATGGAGTTCAAGGGAAAAAAAGG - Intergenic
989633899 5:43514392-43514414 TGGTATTTTAGGGGAAAAAACGG + Intronic
989690292 5:44135411-44135433 TGGGATCTCTGGGGAAAGAGTGG - Intergenic
990104902 5:52246545-52246567 TTGCATTTCAAGGTAAAAAATGG + Intergenic
992282701 5:75198290-75198312 TTGGCTTTTGAGGGAAAAAAAGG - Intronic
992895615 5:81242636-81242658 TGAGATTTGTAGTGAGAAAAAGG + Intronic
993330581 5:86595055-86595077 TGGGATTTCTACAGCAGAAATGG + Intergenic
994070998 5:95602189-95602211 TGGGCTTTATAGGCAGAAAAAGG - Intronic
995101187 5:108308088-108308110 TTGGATAGCTAGGGTAAAAATGG - Intronic
995848622 5:116521176-116521198 TGGGCTTTGTAGTGAAAAAGAGG - Intronic
996069517 5:119119358-119119380 TGGGTTTTCTAAAGATAAAATGG - Intronic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
996750457 5:126883402-126883424 TGAGATTTCTACAGAAAAATAGG - Intronic
997911150 5:137874746-137874768 AGTGATTTTTAGAGAAAAAATGG - Intronic
998305731 5:141074978-141075000 TGATTTTTCTAGGAAAAAAAGGG - Intergenic
998629409 5:143881782-143881804 TGGGTTTTCATGGGAAACAATGG - Intergenic
998800620 5:145865172-145865194 TGGGATTGCTATGAAAAAATTGG - Intronic
1000347850 5:160329725-160329747 TGGGCTTTATAGGCAGAAAAAGG - Intronic
1001247452 5:170115467-170115489 TGGGTTTGCTGGAGAAAAAAGGG + Intergenic
1002960395 6:1908987-1909009 TGAGATTCCCAGGGGAAAAAAGG + Intronic
1004055076 6:12128001-12128023 AAGGATTTCTAGGCAAAACATGG + Intronic
1004555855 6:16697368-16697390 TGGGATTTGAAGGGAAGAGAAGG - Intronic
1005977945 6:30814475-30814497 TGGGGCTTTTAGGGAAACAACGG + Intergenic
1006066533 6:31466384-31466406 TGGGATTACTAAGGAATGAATGG - Intergenic
1007940966 6:45781164-45781186 TTTGATTTCTAAGGAAAATAAGG + Intergenic
1008194305 6:48499189-48499211 TGGGAATTCTAGTGAAATCAAGG + Intergenic
1008510245 6:52269219-52269241 GGAGATGTCTAGGGAAGAAAAGG + Exonic
1008969055 6:57345838-57345860 TGAGTTTTCTAGGGAAGAGATGG + Intronic
1010053046 6:71531001-71531023 TGGAATTTTTGGGAAAAAAAAGG - Intergenic
1011039731 6:83015997-83016019 AGGGATTAATTGGGAAAAAATGG - Intronic
1011754568 6:90485657-90485679 TGGGGTTTCTACAGAAAATATGG - Intergenic
1011834598 6:91416095-91416117 TCAGATTTCTGGGGAAAAAATGG - Intergenic
1012055892 6:94409741-94409763 TGAGAGTTTTAGAGAAAAAATGG - Intergenic
1012371414 6:98511858-98511880 AGGGATTTCTGGGGAAAGAGTGG + Intergenic
1012693728 6:102352627-102352649 AGGAATTTATTGGGAAAAAAAGG + Intergenic
1013296515 6:108762511-108762533 AGGGAGTTCAAGAGAAAAAAGGG - Intergenic
1014194844 6:118543055-118543077 TGGGCTTTCTAGGCAGAAAGAGG - Intronic
1014624428 6:123708643-123708665 TCGGGTAACTAGGGAAAAAATGG - Intergenic
1014665656 6:124233745-124233767 TGTGATGTCTAGAGAAAGAATGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016653870 6:146495246-146495268 GGGGATTTTTGGAGAAAAAAAGG + Intergenic
1017115229 6:150969556-150969578 TGGGCTTGCTAGGGAAAGAAGGG + Intronic
1018957323 6:168418886-168418908 ATGGCTTTCTGGGGAAAAAAAGG + Intergenic
1020426403 7:8071059-8071081 TGGGATTCCGGGGGACAAAAAGG - Exonic
1021700633 7:23316244-23316266 TTGGGTTTTTAGTGAAAAAATGG + Intronic
1022059513 7:26777809-26777831 TGGTATTTCAAGGTAAAAACAGG + Intronic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1022322365 7:29299023-29299045 TTGAATTTATTGGGAAAAAAGGG + Intronic
1022823499 7:33984853-33984875 TAGGATTTTTAGGGGATAAAAGG - Intronic
1024013656 7:45292140-45292162 TAGGAATTCAGGGGAAAAAAAGG + Intergenic
1024112605 7:46162392-46162414 TGGGATTTATTGGGCAAAAAGGG + Intergenic
1024656239 7:51453545-51453567 AGGGGTTTGTATGGAAAAAAAGG + Intergenic
1024752181 7:52479506-52479528 TTGTATTTTTAAGGAAAAAAAGG - Intergenic
1026325372 7:69304963-69304985 TGTGATTTCTAAGGTGAAAAGGG - Intergenic
1027614298 7:80402403-80402425 TTATATTTCAAGGGAAAAAAAGG - Intronic
1028235897 7:88361281-88361303 TGGGATTTATTGGGCAAAAAGGG + Intergenic
1028611745 7:92719457-92719479 TGTAATTTCTATGGAATAAAGGG + Intronic
1028871608 7:95776506-95776528 GTAGTTTTCTAGGGAAAAAATGG + Intronic
1028937537 7:96483002-96483024 TGGGATTTTTAGAGATAATATGG + Intronic
1028943248 7:96549006-96549028 TGGGCTGTCTAGGGAAGAAGTGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030205981 7:106953144-106953166 TGGCATTTCTCGTGAAAAACGGG + Intergenic
1030696910 7:112595472-112595494 TGAGGCTTCTAGGGAAAAATTGG - Intergenic
1031502481 7:122536682-122536704 TGGGATGTCAAGGGGAAAAGAGG + Intronic
1032594341 7:133224649-133224671 ATGGATTTCTAGGTAACAAAAGG - Intergenic
1032823255 7:135544246-135544268 TTTGTTTTCTTGGGAAAAAAGGG + Intergenic
1033497315 7:141912141-141912163 TGGTTTTTCCAGGGAAAAATGGG + Intronic
1034483362 7:151340888-151340910 TGGGCTTTATAGGTAGAAAAGGG + Intergenic
1034830992 7:154307275-154307297 TGGGATTTCCAATGACAAAAAGG - Intronic
1035860111 8:3019339-3019361 TGGGATTGATATGGAAAGAAAGG - Intronic
1035917905 8:3644916-3644938 TGGAATTTCCAGGGAAAATGTGG - Intronic
1036008032 8:4689457-4689479 AAGGATTTGTGGGGAAAAAAGGG + Intronic
1036155789 8:6340735-6340757 TGGGAGGTCCAGGGAAAATAAGG - Intergenic
1037044407 8:14279430-14279452 TGTGTAATCTAGGGAAAAAAAGG - Intronic
1037401794 8:18501461-18501483 GGGGTTTTCTAGGCAATAAAGGG + Intergenic
1038438818 8:27557789-27557811 TGGACTTTCAAGGCAAAAAAGGG - Intergenic
1039121693 8:34155245-34155267 TGGGCTTTCTAGAGGGAAAAGGG - Intergenic
1039664717 8:39512312-39512334 TAGGAGTTTTAGGGGAAAAAAGG - Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1042374960 8:68039730-68039752 TGGGATGTTGAGGGAAAAACAGG - Intronic
1042985344 8:74576922-74576944 TGGGTGGTCTAGGGTAAAAATGG + Intergenic
1043548690 8:81344216-81344238 CGGGTCTTATAGGGAAAAAATGG - Intergenic
1044589095 8:93896398-93896420 TGAAGTTTCTAGGGAAAACATGG - Intronic
1047067824 8:121306214-121306236 TTGGATTTACAGTGAAAAAATGG + Intergenic
1047231208 8:122999945-122999967 AGGAAATTTTAGGGAAAAAAAGG + Intergenic
1047662410 8:127051894-127051916 TGGGGTGTGGAGGGAAAAAAAGG - Intergenic
1048588841 8:135802423-135802445 GAGGATTTCCAGGGAAAAAACGG - Intergenic
1048730660 8:137437267-137437289 TGAGCTTTCTAGGAAAAGAAGGG - Intergenic
1048767271 8:137858636-137858658 TGGGATTTTTAGGAAGGAAAAGG + Intergenic
1050245117 9:3681232-3681254 TGGGAGCACTAGGGAAGAAAAGG + Intergenic
1050352358 9:4752580-4752602 TGGGTTTCCAAAGGAAAAAATGG + Intergenic
1050756347 9:9008569-9008591 TGACAATTCTATGGAAAAAAAGG + Intronic
1052302750 9:26972508-26972530 TGGCTTTTCTAGGGAAGATAGGG + Intronic
1052553041 9:29976464-29976486 AGGGAATACTAGGGAAAAAGAGG - Intergenic
1052750514 9:32484975-32484997 TTGGATTTAAAAGGAAAAAAAGG + Intronic
1054872800 9:70064459-70064481 TGGGATTTGGAGGAAAAGAAGGG - Intronic
1054952731 9:70871097-70871119 TGAGTTTTCTAGAGAAACAAAGG + Intronic
1055614123 9:78053664-78053686 TGGGAGCTCTAGAGATAAAATGG + Intergenic
1055736928 9:79340393-79340415 TGGGATTTATAGGCAGAAAAGGG - Intergenic
1056558918 9:87712565-87712587 TGTGATTTCAATGGAAAAGATGG - Intergenic
1056674608 9:88664577-88664599 TGGGATTTGTTGGGAAAGACTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058806817 9:108600895-108600917 TGGGATCTCTCTGGAAAATAAGG + Intergenic
1059803339 9:117772987-117773009 AGGAAATTCTGGGGAAAAAATGG + Intergenic
1060429340 9:123535914-123535936 TAGGATTTCTAAGGAAAAATTGG + Intronic
1061176889 9:129003002-129003024 TGGGAGTTTCAGGGTAAAAAAGG + Intronic
1062065107 9:134522497-134522519 AGGGGCTTCTGGGGAAAAAACGG - Intergenic
1186438388 X:9563786-9563808 TGGGAATTCCAGGGAAGAAAGGG + Intronic
1187595307 X:20765239-20765261 TTGGATTTCTAGACCAAAAATGG - Intergenic
1187642588 X:21311260-21311282 TGGAATTTTTGTGGAAAAAAGGG - Intergenic
1188648599 X:32601010-32601032 TAGGATTTCTTGGGAAATGATGG + Intronic
1188994952 X:36872702-36872724 TGGGATTTCTGGGTCAAAGAGGG - Intergenic
1189303683 X:39970935-39970957 AGGCATTACTAGGGAAAAGAGGG - Intergenic
1189909054 X:45791302-45791324 TGGGATTTCTATGACACAAATGG - Intergenic
1190395393 X:49976871-49976893 TGGAATTTCTAGGAAAAGCAAGG + Intronic
1190846271 X:54194146-54194168 TGAGTTTTCAAGGAAAAAAAAGG + Exonic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192860776 X:75068131-75068153 TGGGATTTTCAGTGAAAAAGAGG + Intronic
1193656852 X:84209171-84209193 TGAAATTTCTAGGGTAAAGAAGG - Intergenic
1193666469 X:84325190-84325212 GGCTATTTCTTGGGAAAAAAAGG + Intronic
1194341886 X:92715751-92715773 AGTCATTTCTAGGGAAAAAGAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194630916 X:96282407-96282429 TAGTATTTGTAGGGAGAAAAAGG + Intergenic
1195070094 X:101270698-101270720 TTGGATTTACAGGGCAAAAAGGG - Intronic
1195380161 X:104262963-104262985 TGGGAGTTCAAAGGAAGAAAAGG + Intergenic
1195677378 X:107517382-107517404 TGAGATTTCTTGGGGAAAATGGG + Intergenic
1196037677 X:111164611-111164633 TTGGACATATAGGGAAAAAAGGG - Intronic
1197312888 X:124927848-124927870 TGGCATTACAAGGGAAAAGAAGG - Intronic
1198492944 X:137161790-137161812 TGAGAATCCTAGGGAAAATATGG + Intergenic
1198825109 X:140691159-140691181 TGGAATTTGTAGTGAAAAAAGGG + Intergenic
1198954689 X:142115444-142115466 AGGTATTTAGAGGGAAAAAAAGG - Intergenic
1199232057 X:145447423-145447445 TGGCATTTCAAGAGAAAAAAAGG - Intergenic
1199493910 X:148431864-148431886 TGGGAATTTTAGGGAAATGAAGG - Intergenic
1199907412 X:152247450-152247472 TGGGATGTAAAGGGGAAAAAAGG + Intronic
1200650230 Y:5832444-5832466 AGTCATTTCTAGGGAAAAAGAGG - Intergenic
1200785738 Y:7258910-7258932 TGGAATTTATTGGGCAAAAAGGG + Intergenic