ID: 1150029173

View in Genome Browser
Species Human (GRCh38)
Location 17:61713483-61713505
Sequence GTAGTATCCTAGGCCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 1, 2: 4, 3: 70, 4: 396}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150029173_1150029175 18 Left 1150029173 17:61713483-61713505 CCTGTGTAGGCCTAGGATACTAC 0: 1
1: 1
2: 4
3: 70
4: 396
Right 1150029175 17:61713524-61713546 ATTTTTTTTTTTTTTTGAGATGG 0: 3384
1: 98629
2: 69896
3: 85742
4: 127980

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150029173 Original CRISPR GTAGTATCCTAGGCCTACAC AGG (reversed) Intronic
901583041 1:10261601-10261623 TTATTAGCCTAGGCCTACACAGG + Intronic
904493357 1:30873532-30873554 GTACCATCATAGGCCTTCACTGG + Intronic
904815712 1:33196433-33196455 GCATTAGCCTAGGCCCACACAGG + Intergenic
906438096 1:45814401-45814423 GCACTAGCCTAGGCCTACACAGG - Intronic
906547480 1:46630764-46630786 ACATTAGCCTAGGCCTACACAGG + Intergenic
907087658 1:51691797-51691819 ACATGATCCTAGGCCTACACAGG + Intronic
907768432 1:57435590-57435612 ATATGAGCCTAGGCCTACACAGG + Intronic
907971008 1:59381484-59381506 ACATTATCCAAGGCCTACACAGG + Intronic
908025062 1:59941691-59941713 TCATTAGCCTAGGCCTACACAGG - Intergenic
908408447 1:63838439-63838461 ACATTAGCCTAGGCCTACACAGG - Intronic
908444074 1:64185034-64185056 ACACTAGCCTAGGCCTACACAGG + Intergenic
909277529 1:73707572-73707594 ACAGTAGCCTAGGCCTACACAGG + Intergenic
909314822 1:74202865-74202887 ATATTAGCTTAGGCCTACACTGG + Intronic
909400559 1:75224541-75224563 ACATTATCCTAGACCTACACAGG - Intronic
909411404 1:75356358-75356380 ATGTTAGCCTAGGCCTACACAGG - Intronic
909508752 1:76426367-76426389 TCATTATCCTAGGCCTACACAGG + Intronic
909765165 1:79346812-79346834 TCATTAGCCTAGGCCTACACAGG + Intergenic
909872082 1:80753735-80753757 ACATTAGCCTAGGCCTACACGGG + Intergenic
910003473 1:82365663-82365685 ACATTAGCCTAGGCCTACACAGG + Intergenic
910143074 1:84048449-84048471 ACATTAGCCTAGGCCTACACAGG + Intergenic
910823850 1:91384337-91384359 GCACTATCATAGGCATACACAGG + Intronic
910947023 1:92604395-92604417 ATATTAGCTTAGGCCTACACAGG + Intronic
912673888 1:111658582-111658604 ATATTCACCTAGGCCTACACTGG + Intronic
913194861 1:116447389-116447411 ATATTAGCCTAGGCCTAGACAGG - Intergenic
914937914 1:151996359-151996381 GTATTAGCCTAGACCTGCACAGG - Intergenic
915251808 1:154595436-154595458 CTGTTAGCCTAGGCCTACACAGG - Intronic
916957813 1:169858316-169858338 ACATTAGCCTAGGCCTACACAGG + Intronic
918505092 1:185245292-185245314 ACATTACCCTAGGCCTACACAGG + Intronic
918957515 1:191229201-191229223 ATATTAGTCTAGGCCTACACAGG + Intergenic
919405671 1:197179696-197179718 ACATTAGCCTAGGCCTACACAGG - Intronic
920153346 1:203927644-203927666 ATATTGGCCTAGGCCTACACAGG + Intergenic
921434518 1:215102280-215102302 ATATTAGGCTAGGCCTACACAGG - Intronic
921563861 1:216692289-216692311 ACACTAGCCTAGGCCTACACAGG - Intronic
921663302 1:217834493-217834515 ACATTAGCCTAGGCCTACACAGG - Intronic
922480089 1:225934235-225934257 ACAGTAGCCTAGGCCTACACAGG + Intergenic
922501729 1:226101967-226101989 ACAGTAGCCTAGGCCTTCACAGG - Intergenic
922501846 1:226103002-226103024 GTAATGTCCCAGGCCTTCACAGG + Intergenic
922881106 1:228981575-228981597 ACATTAGCCTAGGCCTACACAGG - Intergenic
923405847 1:233659243-233659265 ACACTAGCCTAGGCCTACACAGG + Intronic
924297799 1:242606050-242606072 ATACTGCCCTAGGCCTACACAGG + Intergenic
924405028 1:243734940-243734962 ATATTAGCCTAGACCTACACGGG + Intronic
1064530176 10:16300595-16300617 CTATTAGCCTAGTCCTACACAGG + Intergenic
1068268373 10:54685088-54685110 ACATTAGCCTAGGCCTACACCGG + Intronic
1071212342 10:83358437-83358459 ACATTAGCCTAGGCCTACACAGG + Intergenic
1072111089 10:92320563-92320585 ACATTAGCCTAGGCCTACACAGG - Intronic
1072644058 10:97238160-97238182 ACATTAACCTAGGCCTACACAGG - Intronic
1073719129 10:106145745-106145767 GTATTAGCCTAGACCTACAAAGG - Intergenic
1073906708 10:108289697-108289719 GCATTAGCCAAGGCCTACACAGG + Intergenic
1074747749 10:116552408-116552430 GCATTAGCCTAGGCCTACACAGG - Intronic
1075163552 10:120045785-120045807 ATGTTAGCCTAGGCCTACACAGG + Intergenic
1075368481 10:121914487-121914509 GTTGAATCCTAGGCCAACAGTGG + Intronic
1075422972 10:122317710-122317732 GTATTAGCCTAGGTCCACACAGG + Intronic
1076101046 10:127778691-127778713 ATGGTAGCCAAGGCCTACACAGG + Intergenic
1076182014 10:128416825-128416847 ACATTAGCCTAGGCCTACACGGG - Intergenic
1076263019 10:129085664-129085686 ACATTAACCTAGGCCTACACAGG - Intergenic
1077638702 11:3861863-3861885 GTAGTTTCCTAGGTCTCTACAGG + Intronic
1078644536 11:13127893-13127915 ACAGTAGCCTAGGTCTACACAGG - Intergenic
1078777338 11:14405692-14405714 ACATTAGCCTAGGCCTACACAGG - Intergenic
1079118893 11:17663267-17663289 ACACTAGCCTAGGCCTACACAGG + Intergenic
1080322795 11:31033784-31033806 ACATTAGCCTAGGCCTACACAGG - Intronic
1080788866 11:35501621-35501643 ATATTAGCCTAGGCCTACACAGG + Intronic
1081822733 11:46015710-46015732 ACATTAGCCTAGGCCTACACAGG + Intronic
1082805088 11:57443473-57443495 ACATTAGCCTAGGCCTACACTGG + Intergenic
1083167109 11:60896758-60896780 ACATTACCCTAGGCCTACACAGG - Intronic
1084300199 11:68244766-68244788 ACATTAGCCTAGGCCTACACAGG + Intergenic
1085166155 11:74401441-74401463 ACATTAGCCTAGGCCTACACTGG + Intergenic
1086618596 11:88856351-88856373 ATATTAACCTAGGCCTACACAGG + Intronic
1087156754 11:94912258-94912280 ACAGTATCCTAAGCCTACACAGG + Intergenic
1087827528 11:102782858-102782880 GAATTAGCCCAGGCCTACACAGG - Intergenic
1088467817 11:110160556-110160578 ACATTATCCTAGGCCTGCACAGG + Intronic
1088994000 11:114980089-114980111 ACATTAGCCTAGGCCTACACAGG - Intergenic
1090220447 11:125017786-125017808 ATGTTAGCCTAGGCCTACACAGG - Intronic
1090536979 11:127653470-127653492 ACATTAGCCTAGGCCTACACAGG - Intergenic
1091655059 12:2339677-2339699 ATAGTAACCTAGACCTACGCAGG + Intronic
1091812741 12:3413457-3413479 ATAGTATCCTAGGCCTACACAGG + Intronic
1092188155 12:6496883-6496905 ACATTAGCCTAGGCCTACACAGG + Intronic
1093008299 12:14076343-14076365 ATGTTATCCTAGGCCTACGCAGG - Intergenic
1093904108 12:24669118-24669140 ACATTAGCCTAGGCCTACACAGG - Intergenic
1093956408 12:25224369-25224391 ACATTAACCTAGGCCTACACAGG - Intronic
1097003230 12:55896195-55896217 ATATTAGCTTAGGCCTACACAGG + Intergenic
1097272487 12:57785281-57785303 ACATTAGCCTAGGCCTACACAGG + Intronic
1097593042 12:61594510-61594532 CTATTAGCCTAGGCTTACACAGG + Intergenic
1098831381 12:75367456-75367478 ACATTAGCCTAGGCCTACACAGG + Intronic
1099322183 12:81163709-81163731 ACATTAGCCTAGGCCTACACAGG - Intronic
1100677471 12:96883394-96883416 ACATTATTCTAGGCCTACACAGG + Intergenic
1101180833 12:102216109-102216131 ACATTAGCCTAGGCCTACACAGG + Intergenic
1101354166 12:103961117-103961139 ACATTAGCCTAGGCCTACACAGG - Intronic
1102354820 12:112224103-112224125 GTAGATTCTTAGGCCTACAAGGG - Intronic
1102607840 12:114083253-114083275 AAAGTAGCCTCGGCCTACACGGG - Intergenic
1103178652 12:118888091-118888113 ACATTATCTTAGGCCTACACAGG + Intergenic
1103252671 12:119514123-119514145 GCATTAGCCTAGGCCTACACAGG - Intronic
1106059385 13:26272361-26272383 ATGTTAGCCTAGGCCTACACAGG + Intronic
1106065504 13:26344390-26344412 ACATTAGCCTAGGCCTACACAGG + Intronic
1107193223 13:37615516-37615538 GTAGTATGATAGGCCTATAGAGG + Intergenic
1107294104 13:38891715-38891737 GTGCTATCCTAGGACTAGACTGG + Intergenic
1107321934 13:39199072-39199094 ACATTAGCCTAGGCCTACACAGG - Intergenic
1108233677 13:48378404-48378426 ACATTAGCCTAGGCCTACACAGG + Intronic
1108583425 13:51846746-51846768 ACATTAGCCTAGGCCTACACAGG - Intergenic
1108904879 13:55456177-55456199 ACATTAACCTAGGCCTACACAGG - Intergenic
1109454190 13:62561962-62561984 ATATTATCCTAGGTCTACACAGG - Intergenic
1109937249 13:69304127-69304149 ACATTAGCCTAGGCCTACACAGG - Intergenic
1109990291 13:70046132-70046154 GTTGTATCCTCTGCCTACAATGG - Intronic
1110473369 13:75885692-75885714 ATGCTAGCCTAGGCCTACACAGG + Intergenic
1110517842 13:76437551-76437573 ACAGTAGTCTAGGCCTACACAGG - Intergenic
1111088446 13:83408600-83408622 ACAATAGCCTAGGCCTACACAGG - Intergenic
1111701037 13:91689676-91689698 ACATTAGCCTAGGCCTACACAGG + Intronic
1112470424 13:99683556-99683578 ACATTAGCCTAGGCCTACACAGG + Intronic
1112584950 13:100710692-100710714 ATATTTGCCTAGGCCTACACAGG + Intergenic
1112942473 13:104881158-104881180 ACATTAGCCTAGGCCTACACAGG + Intergenic
1113125493 13:106973933-106973955 GTATTAGCCTAGGACTACACAGG - Intergenic
1113153625 13:107292539-107292561 GCACTAACCTAGGCCTACACAGG + Intronic
1114049537 14:18911940-18911962 ACATTAGCCTAGGCCTACACTGG - Intergenic
1114113026 14:19489991-19490013 ACATTAGCCTAGGCCTACACTGG + Intergenic
1115112642 14:29842011-29842033 CAATTAGCCTAGGCCTACACAGG + Intronic
1115282084 14:31675342-31675364 CTGGTATTTTAGGCCTACACTGG + Intronic
1117235181 14:53766916-53766938 ACATTAGCCTAGGCCTACACAGG + Intergenic
1117732561 14:58738014-58738036 ACATTAGCCTAGGCCTACACAGG - Intergenic
1118791988 14:69102620-69102642 ATATTAGCCTAGACCTACACAGG + Intronic
1118856065 14:69623731-69623753 ACATTAGCCTAGGCCTACACAGG - Intronic
1119403076 14:74377639-74377661 ACATTAGCCTAGGCCTACACAGG - Intergenic
1121172613 14:91867706-91867728 GTAGTATCTTAGGCCTTCAGTGG - Intergenic
1121584439 14:95053481-95053503 ATATTAGCCTAGGCCTACACAGG + Intergenic
1122147563 14:99700954-99700976 ACATTAGCCTAGGCCTACACAGG - Intronic
1123506403 15:20943926-20943948 ACACTAGCCTAGGCCTACACTGG - Intergenic
1123599881 15:21954921-21954943 ACACTAGCCTAGGCCTACACTGG - Intergenic
1123703132 15:22930588-22930610 ACATTAGCCTAGGCCTACACGGG - Intronic
1124163569 15:27297018-27297040 ACATTAGCCTAGGCCTACACAGG - Intronic
1124920270 15:34019204-34019226 CCATTAGCCTAGGCCTACACAGG - Intronic
1125147095 15:36483882-36483904 AAATTAGCCTAGGCCTACACAGG - Intergenic
1125436758 15:39653974-39653996 ACATTAGCCTAGGCCTACACAGG + Intronic
1125444152 15:39735863-39735885 CTATTAGCCTAGGTCTACACAGG + Intronic
1125561071 15:40634042-40634064 ACATTAGCCTAGGCCTACACAGG - Intronic
1126477541 15:49081229-49081251 ATGTTAGCCTAGGCCTACACAGG - Intergenic
1126529473 15:49696986-49697008 ACATTAGCCTAGGCCTACACAGG - Intergenic
1126702006 15:51376772-51376794 ACATTAGCCTAGGCCTACACAGG + Intronic
1127010154 15:54616522-54616544 CTATTAGCCCAGGCCTACACAGG - Intronic
1127898006 15:63319660-63319682 ATATTAGCCTAGGCCTACACAGG - Intergenic
1128310306 15:66627167-66627189 ACATTAGCCTAGGCCTACACAGG - Intronic
1128494501 15:68186279-68186301 ACATTAGCCTAGGCCTACACAGG - Intronic
1128959484 15:71986566-71986588 ATATTAGCATAGGCCTACACAGG - Intronic
1131098842 15:89672609-89672631 GTGGTCTCCAAGGCATACACAGG - Intronic
1131309308 15:91273316-91273338 GTGGAATCCTAGGCTTAGACAGG - Intronic
1131601980 15:93858984-93859006 GCAATAGCCTAGGCCTACACAGG + Intergenic
1132133825 15:99312343-99312365 ATATTAGTCTAGGCCTACACAGG + Intronic
1202971988 15_KI270727v1_random:244766-244788 ACACTAGCCTAGGCCTACACTGG - Intergenic
1132837393 16:1960963-1960985 GCTGTAGCCTAGGCCTTCACAGG + Intronic
1133016568 16:2945010-2945032 ACACTATCCTAGGCCTGCACAGG - Intronic
1136018135 16:27419249-27419271 ACATTAGCCTAGGCCTACACAGG + Intronic
1138356848 16:56388740-56388762 GCATTAGCCTAAGCCTACACAGG + Intronic
1141305843 16:82863198-82863220 GGAGTAACCAAGGCCTACATAGG + Intronic
1143300537 17:5907049-5907071 ACATTACCCTAGGCCTACACAGG + Intronic
1143943071 17:10563537-10563559 ACATTAGCCTAGGCCTACACAGG + Intergenic
1144450446 17:15373132-15373154 ACATTAGCCTAGGCCTACACAGG + Intergenic
1148920537 17:51028003-51028025 TTATTAGCCTTGGCCTACACAGG - Intronic
1149127021 17:53247013-53247035 ATATTAACCTAGGCCTACACAGG - Intergenic
1149261571 17:54885791-54885813 ACATTATCCTAGGCCTACACAGG + Intergenic
1149426758 17:56562279-56562301 ATATTAGCCTAGGCCTACTCAGG - Intergenic
1150029173 17:61713483-61713505 GTAGTATCCTAGGCCTACACAGG - Intronic
1153281871 18:3422233-3422255 ACATTAGCCTAGGCCTACACAGG - Intronic
1153470133 18:5434998-5435020 TTATTAGCCTAGGCCTACACAGG - Intronic
1153692877 18:7611017-7611039 ACATTAGCCTAGGCCTACACAGG - Intronic
1153953877 18:10079764-10079786 ACATTAGCCTAGGCCTACACAGG + Intergenic
1154969207 18:21390462-21390484 ACATTAGCCTAGGCCTACACAGG - Intronic
1155151889 18:23129677-23129699 GTCGTATCATAGGCCCAGACAGG - Intergenic
1155846556 18:30715391-30715413 GCATTAGCCTAGGCCTGCACAGG + Intergenic
1156097877 18:33558014-33558036 GCATTAGCCTAGGCCTACACGGG - Intergenic
1158111585 18:53945923-53945945 ACATTATCCTAGGCCTAAACAGG + Intergenic
1163081653 19:14948217-14948239 GCATTATCCTAGGCCTACACAGG - Intergenic
1164762890 19:30741287-30741309 TTAGAATCCTCGGCCTCCACAGG + Intergenic
1164802162 19:31086456-31086478 ACATTAGCCTAGGCCTACACAGG + Intergenic
1165648273 19:37463805-37463827 ATATTAGCCTAGGCTTACACAGG - Intronic
1166194334 19:41196216-41196238 GCAGGATCATAGGCCTAGACAGG + Intronic
1167076636 19:47254177-47254199 GTTGTGTCCTTGGCCTGCACAGG + Intergenic
1167297952 19:48662854-48662876 CTAGTGTTCTAGGCCTTCACAGG - Intronic
1167868459 19:52347235-52347257 ACATTAGCCTAGGCCTACACAGG - Intronic
925029516 2:638657-638679 ACATTAACCTAGGCCTACACAGG + Intergenic
925630090 2:5882992-5883014 ACATTAGCCTAGGCCTACACAGG - Intergenic
928933247 2:36647211-36647233 ACATTAGCCTAGGCCTACACAGG - Intergenic
928956170 2:36870917-36870939 ATATTAACCTAGGCCTATACAGG - Intronic
929014397 2:37480553-37480575 ATGTTAGCCTAGGCCTACACAGG + Intergenic
929514315 2:42592643-42592665 ATATTAGCTTAGGCCTACACAGG + Intronic
930144582 2:47988633-47988655 GTATTAGTCTAGGCCTACACAGG - Intergenic
930182806 2:48381741-48381763 ACATTATCCTAGGCCCACACAGG + Intergenic
930535461 2:52640291-52640313 ACATTAGCCTAGGCCTACACAGG - Intergenic
930652800 2:53979229-53979251 ACATTAGCCTAGGCCTACACAGG - Intronic
930761971 2:55048539-55048561 GCATTACCCTAGGCCTACACAGG + Intronic
930793030 2:55354939-55354961 GCACTAGCCTATGCCTACACAGG + Intronic
930928779 2:56854795-56854817 ATATTAGCCTAGGCCAACACAGG - Intergenic
933120793 2:78534948-78534970 ACATTAGCCTAGGCCTACACAGG - Intergenic
933732248 2:85465918-85465940 ACATTAGCCTAGGCCTACACAGG + Intergenic
935083300 2:99820810-99820832 ATATTAGCCTAGGCCCACACAGG + Intronic
935178050 2:100666450-100666472 CCATTAACCTAGGCCTACACAGG - Intergenic
935221394 2:101017102-101017124 ACATTAGCCTAGGCCTACACAGG + Intronic
935716228 2:105941521-105941543 ACATTAGCCTAGGCCTACACAGG + Intergenic
935818655 2:106871661-106871683 AAATTAGCCTAGGCCTACACAGG + Intronic
936143528 2:109962610-109962632 GCATTGGCCTAGGCCTACACAGG + Intergenic
936180211 2:110260573-110260595 GCATTGGCCTAGGCCTACACAGG + Intergenic
936201160 2:110408856-110408878 GCATTGGCCTAGGCCTACACAGG - Intronic
936726656 2:115326668-115326690 ATATTAGCCTAGGCCTACACAGG - Intronic
937232901 2:120410292-120410314 GTAGAATCATAGTCCTACCCTGG + Intergenic
937580202 2:123475748-123475770 GCATTAGCCTAGACCTACACAGG - Intergenic
937725603 2:125161533-125161555 AGATTAGCCTAGGCCTACACAGG - Intergenic
938813536 2:134876478-134876500 ACATTAGCCTAGGCCTACACAGG + Intronic
939975547 2:148713298-148713320 CCATTAGCCTAGGCCTACACTGG - Intronic
940697567 2:156998651-156998673 ATATTAGCCCAGGCCTACACAGG + Intergenic
941878302 2:170457530-170457552 ACATTAGCCTAGGCCTACACAGG + Intronic
942359206 2:175154299-175154321 ACATTAGCCTAGGCCTACACAGG + Intronic
942765771 2:179454678-179454700 ATATTAGCCTAGGCCTACACAGG - Intronic
943288820 2:186042404-186042426 GTAGCATGCTATGCCTACATGGG - Intergenic
943618869 2:190124925-190124947 ACATTAGCCTAGGCCTACACAGG + Intronic
943741986 2:191419727-191419749 ATATTAGCCTAGGCCTACACAGG - Intronic
943769296 2:191697822-191697844 ATATTAGCCTAGACCTACACAGG + Intergenic
944813611 2:203352512-203352534 GTATTAGCCTAACCCTACACAGG - Intronic
945564980 2:211386720-211386742 GCAGTAGCCTAGGCCTTTACTGG + Intronic
945637742 2:212377999-212378021 ACATTAGCCTAGGCCTACACAGG + Intronic
945758000 2:213874446-213874468 ACATTAGCCTAGGCCTACACAGG + Intronic
947560525 2:231146035-231146057 ACATTATACTAGGCCTACACAGG + Intronic
947980781 2:234407552-234407574 ACATTAGCCTAGGCCTACACAGG - Intergenic
948336860 2:237215613-237215635 ATATTAGCCTAGGCTTACACAGG - Intergenic
1170619627 20:17984636-17984658 ACATTAGCCTAGGCCTACACAGG - Intronic
1170751888 20:19156196-19156218 ACATTAGCCTAGGCCTACACAGG + Intergenic
1172892563 20:38277340-38277362 ATATTAGCCTAGGCCTACACTGG + Intronic
1173029829 20:39344956-39344978 ACATTAGCCTAGGCCTACACAGG - Intergenic
1173244190 20:41323513-41323535 GTATTAGCCTTGGCCTACACAGG + Intergenic
1173713906 20:45184576-45184598 ATAATAGCCTAGGCCTGCACAGG + Intergenic
1174491466 20:50899729-50899751 TAATTAGCCTAGGCCTACACAGG - Intronic
1174862149 20:54101098-54101120 ACATTAGCCTAGGCCTACACAGG + Intergenic
1175549408 20:59807321-59807343 GCATTAGCCTAGGCCTGCACAGG + Intronic
1175582214 20:60108957-60108979 ATATTAGCCTAGGCCTGCACAGG - Intergenic
1176067998 20:63209761-63209783 ATATTAGCCTAGGCCTACACAGG + Intronic
1176675021 21:9769816-9769838 ACATTAGCCTAGGCCTACACAGG + Intergenic
1179196907 21:39172575-39172597 ACATTAGCCTAGGCCTACACAGG + Intergenic
1180468018 22:15634315-15634337 ACATTAGCCTAGGCCTACACTGG - Intergenic
1182286083 22:29248324-29248346 ACATTAGCCTAGGCCTACACAGG + Intronic
1183561492 22:38577820-38577842 ACAGTAGCCTAGGCCTACACAGG + Intergenic
1184824401 22:46937785-46937807 ACATTAGCCTAGGCCTACACAGG - Intronic
949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG + Intronic
949392208 3:3575056-3575078 ACATTAGCCTAGGCCTACACAGG + Intergenic
949684936 3:6558280-6558302 ATATTACCCTAGGCCTACACAGG - Intergenic
949831599 3:8220893-8220915 ACATTAGCCTAGGCCTACACAGG + Intergenic
950537263 3:13586136-13586158 ACACTAGCCTAGGCCTACACAGG - Intronic
951244688 3:20327101-20327123 ACACTATCCTAGGCCTACACAGG + Intergenic
951277069 3:20700770-20700792 GTATGATCCTAGGCTTACAATGG - Intergenic
952084780 3:29805579-29805601 ATATTACCCTAGGCCTACACAGG - Intronic
954585047 3:51726598-51726620 ACATTAGCCTAGGCCTACACAGG - Intergenic
956247087 3:67195978-67196000 ACATTAGCCTAGGCCTACACAGG - Intergenic
956712890 3:72053767-72053789 ACATTAGCCTAGGCCTACACAGG - Intergenic
956893408 3:73635765-73635787 ATATTATCCTAGGCCTACACAGG + Intergenic
956896044 3:73661028-73661050 ACATTACCCTAGGCCTACACAGG + Intergenic
957200653 3:77131157-77131179 GTGGAACCTTAGGCCTACACTGG + Intronic
957268416 3:77997717-77997739 ACACTAGCCTAGGCCTACACTGG - Intergenic
957701518 3:83721636-83721658 ATAGTAGCCTAGCCCTGCACCGG + Intergenic
958186320 3:90124669-90124691 GCATTAGCTTAGGCCTACACAGG - Intergenic
959184047 3:103021635-103021657 ATAGTAGCCTAAGTCTACACAGG - Intergenic
959442734 3:106398397-106398419 GCAGTATCCTAGGCTTAGAAGGG - Intergenic
960357030 3:116666243-116666265 ACATTAGCCTAGGCCTACACAGG + Intronic
960560983 3:119084034-119084056 ACATTAGCCTAGGCCTACACAGG - Intronic
961098644 3:124179320-124179342 ATATTAGCCTAGGCCTACACAGG + Intronic
961617010 3:128190348-128190370 ACATTAGCCTAGGCCTACACAGG - Intronic
962089188 3:132225046-132225068 ACATTAGCCTAGGCCTACACAGG - Intronic
962208386 3:133454937-133454959 ACATTAGCCTAGGCCTACACAGG + Intronic
962375007 3:134852012-134852034 GTAGAATCCCAGGGCTACAAGGG + Intronic
962639312 3:137367645-137367667 ATAGTATCCTAAGCCTACGTAGG + Intergenic
962832430 3:139156275-139156297 GCATTAGGCTAGGCCTACACAGG + Intronic
962968574 3:140377523-140377545 ACATTAGCCTAGGCCTACACAGG - Intronic
963144563 3:141979565-141979587 ACACTATCCTAGGCCTACAGGGG - Intronic
963729348 3:148956456-148956478 GTAGTCTCCTAGTCATACACAGG - Intergenic
963875643 3:150471517-150471539 ATATTAGCCTAGGCCTACACAGG + Intergenic
964201934 3:154127422-154127444 GCATTAGCCTAGGCCTGCACAGG + Intronic
964368982 3:155979761-155979783 GCATTAGCCTAGGCCTACACAGG + Intergenic
964636536 3:158863751-158863773 ACATTAGCCTAGGCCTACACAGG - Intergenic
965066895 3:163860851-163860873 ACATTAGCCTAGGCCTACACAGG - Intergenic
966343231 3:178949077-178949099 ACATTAGCCTAGGCCTACACAGG + Intergenic
966392797 3:179470402-179470424 ACAATAGCCTAGGCCTACACAGG - Intergenic
966418255 3:179711608-179711630 ACATTAGCCTAGGCCTACACAGG + Intronic
966438476 3:179917154-179917176 TCATTAGCCTAGGCCTACACAGG + Intronic
966533486 3:181006034-181006056 ACATTAGCCTAGGCCTACACAGG + Intergenic
967127692 3:186439850-186439872 ACATTAGCCTAGGCCTACACGGG + Intergenic
967250974 3:187537801-187537823 ATATTAGCCTAGTCCTACACAGG + Intergenic
968723316 4:2224199-2224221 ACATTAGCCTAGGCCTACACAGG + Intronic
970157480 4:13155526-13155548 ACATTAGCCTAGGCCTACACAGG - Intergenic
970321664 4:14880856-14880878 GTCCTTTCCTAGGCCTACATGGG + Intergenic
970701176 4:18741073-18741095 ACATTATCCTAGGCCTACACAGG + Intergenic
970834949 4:20392739-20392761 ATATTAGCCTAGCCCTACACAGG + Intronic
970984257 4:22137453-22137475 ACATTAGCCTAGGCCTACACAGG + Intergenic
971359105 4:25920331-25920353 ATATTAGCCTAGGCCCACACAGG - Intronic
971364030 4:25962121-25962143 ACATTAGCCTAGGCCTACACAGG + Intergenic
971616423 4:28795558-28795580 GTAGAATCCCAGGTCTACACAGG - Intergenic
971731355 4:30386061-30386083 ATATTAGCCTAGGCTTACACAGG - Intergenic
971822978 4:31583325-31583347 ACATTAGCCTAGGCCTACACAGG - Intergenic
972105214 4:35476746-35476768 GCATTAGCCTAGGCGTACACAGG + Intergenic
973913700 4:55610873-55610895 ATATTAGCCTAGGCCTACACAGG - Intronic
975077958 4:70236623-70236645 ATATTAGCCTAGGCCTACCCAGG + Intergenic
975564700 4:75741926-75741948 CTGTTAGCCTAGGCCTACACAGG + Intronic
976636626 4:87292728-87292750 ATATCAGCCTAGGCCTACACAGG - Intergenic
977263833 4:94831173-94831195 ACATTAGCCTAGGCCTACACAGG - Intronic
977676337 4:99752133-99752155 GTATTAGCCTAGGACTACACAGG + Intergenic
978968404 4:114771461-114771483 ACATTAGCCTAGGCCTACACAGG + Intergenic
978986026 4:115014000-115014022 GGATTACCCTAAGCCTACACAGG + Intronic
979681117 4:123460919-123460941 ACATTAGCCTAGGCCTACACAGG - Intergenic
979794300 4:124827190-124827212 ACATTAGCCTAGGCCTACACAGG - Intergenic
979922822 4:126523334-126523356 ATATTAGCCTAGGCCTACACAGG + Intergenic
979932750 4:126652354-126652376 ACATTAGCCTAGGCCTACACAGG - Intergenic
980251754 4:130324878-130324900 ACATTACCCTAGGCCTACACAGG + Intergenic
980350407 4:131676445-131676467 ACAGTAGCCGAGGCCTACACAGG - Intergenic
980408814 4:132388176-132388198 ACATTATCCTAGGCCTACACAGG - Intergenic
981041131 4:140223196-140223218 ACATTAACCTAGGCCTACACAGG + Intergenic
981125465 4:141101355-141101377 ACATTAGCCTAGGCCTACACAGG + Intronic
981676374 4:147347810-147347832 CTATTAGCCTAGGCCTGCACAGG - Intergenic
982027859 4:151269878-151269900 ACATTAGCCTAGGCCTACACAGG + Intronic
982345761 4:154356161-154356183 ACATTAGCCTAGGCCTACACAGG - Intronic
982905497 4:161064335-161064357 TTATTAGCCTAGGCCTACACAGG + Intergenic
983260187 4:165447851-165447873 AGATTAACCTAGGCCTACACAGG + Intronic
983282094 4:165693829-165693851 TCATTAGCCTAGGCCTACACAGG - Intergenic
984248538 4:177304722-177304744 ACATTAGCCTAGGCCTACACAGG - Intergenic
984773749 4:183462269-183462291 ACATTAGCCTAGGCCTACACAGG + Intergenic
984787099 4:183577538-183577560 ACATTAGCCTAGGCCTACACAGG - Intergenic
985294021 4:188415275-188415297 ACATTAGCCTAGGCCTACACGGG - Intergenic
985400534 4:189588876-189588898 ACACTAGCCTAGGCCTACACAGG - Intergenic
987802474 5:22716770-22716792 ATGTTAGCCTAGGCCTACACAGG - Intronic
988793055 5:34626653-34626675 ACATTAGCCTAGGCCTACACAGG - Intergenic
989116284 5:37956299-37956321 ACATTAGCCTAGGCCTACACGGG - Intergenic
989135147 5:38146540-38146562 ACATTAGCCTAGGCCTACACAGG - Intergenic
990053154 5:51533562-51533584 ACATTAGCCTAGGCCTACACAGG - Intergenic
990057250 5:51598541-51598563 ATACTAGCCTAGGCCTACACAGG - Intergenic
990480729 5:56208108-56208130 ACATTAGCCTAGGCCTACACAGG + Intronic
990847465 5:60159127-60159149 ACATTAGCCTAGGCCTACACAGG + Intronic
991764509 5:69959770-69959792 ATACTAGCGTAGGCCTACACAGG - Intergenic
991782815 5:70158377-70158399 ATACTAGCGTAGGCCTACACAGG + Intergenic
991843741 5:70834842-70834864 ATACTAGCGTAGGCCTACACAGG - Intergenic
991875257 5:71158704-71158726 ATACTAGCGTAGGCCTACACAGG + Intergenic
992303782 5:75413139-75413161 ACATTAGCCTAGGCCTACACAGG + Intronic
992449724 5:76865198-76865220 ACATTAGCCTAGGCCTACACAGG - Intronic
993853405 5:93039539-93039561 GTATTAGCCTAGACCTACACAGG - Intergenic
993943230 5:94087079-94087101 GTATTAGCCCAGGCCTACCCAGG - Intronic
993985995 5:94598300-94598322 ATATTAGCCTAGGCCTACACAGG + Intronic
994053226 5:95385784-95385806 ACATTAGCCTAGGCCTACACAGG - Intergenic
994111789 5:96014202-96014224 ACATTAGCCTAGGCCTACACGGG + Intergenic
994165443 5:96603451-96603473 ACATTAGCCTAGGCCTACACAGG + Intronic
994206373 5:97040918-97040940 ACATTAGCCTAGGCCTACACGGG - Intergenic
994621485 5:102168288-102168310 ATATTAGCCTAGGCCTACACAGG - Intergenic
995471785 5:112510054-112510076 ACATTAGCCTAGGCCTACACAGG + Intergenic
995589222 5:113681520-113681542 ACATTAGCCTAGGCCTACACAGG - Intergenic
996176413 5:120364751-120364773 ACATTAGCCTAGGCCTACACTGG - Intergenic
996419830 5:123250346-123250368 CCATTAGCCTAGGCCTACACAGG - Intergenic
996926422 5:128832246-128832268 AGATTAGCCTAGGCCTACACAGG - Intronic
998541380 5:142985086-142985108 ACATTAGCCTAGGCCTACACAGG - Intronic
998615833 5:143739559-143739581 ACAGTAGCCTAGACCTACACAGG + Intergenic
999110174 5:149112710-149112732 ACATTAGCCTAGGCCTACACAGG - Intergenic
999629671 5:153557733-153557755 GCATTAGCCTAGGCCTACACTGG + Intronic
1000310639 5:160041002-160041024 ACAGTAGCCTAGGCCTACACAGG + Intronic
1001060140 5:168481256-168481278 ACATTAACCTAGGCCTACACAGG + Intergenic
1001609417 5:172988111-172988133 ATATTATTCTAGGCCCACACAGG + Intronic
1003678126 6:8225973-8225995 ACATTAGCCTAGGCCTACACAGG + Intergenic
1003924698 6:10866530-10866552 ACAGTAGCCTAGGCCTACATGGG - Intronic
1003975222 6:11336809-11336831 GTATTAGCCTAGCCCTACATGGG + Intronic
1003994662 6:11527100-11527122 GCATTAGCCTAGGCCTAAACAGG - Intergenic
1003996516 6:11546196-11546218 ATATTAGCCTAGGCCTACACAGG - Intronic
1004578624 6:16925184-16925206 GTATTACCCTGGGCTTACACAGG + Intergenic
1005105085 6:22215302-22215324 GCATTAGCCTAGGCTTACACAGG - Intergenic
1006490945 6:34387386-34387408 ACATTAACCTAGGCCTACACAGG - Intronic
1006754699 6:36405131-36405153 ATATTAGCCTAGGCCTACACAGG - Intronic
1007020026 6:38510747-38510769 ATATTAGCCTAGGCCTACACTGG + Intronic
1007741858 6:44015962-44015984 ATATTAGCTTAGGCCTACACAGG - Intergenic
1008593915 6:53021968-53021990 ACATTAGCCTAGGCCTACACAGG - Intronic
1010027004 6:71230470-71230492 CCATTAGCCTAGGCCTACACAGG - Intergenic
1011885939 6:92095727-92095749 ACATTAGCCTAGGCCTACACAGG - Intergenic
1012529991 6:100223882-100223904 ACATTAGCCTAGGCCTACACAGG - Intergenic
1013637833 6:112046052-112046074 ACATTAGCCTAGGCCTACACAGG - Intergenic
1014052938 6:116976887-116976909 ACATTAGCCTAGGCCTACACAGG - Intergenic
1014347013 6:120283942-120283964 ATCTTATCCTAGGCCTACACAGG + Intergenic
1014914748 6:127132716-127132738 GTAGTACCCTAGGCCTCAAGAGG + Intronic
1015043731 6:128753744-128753766 ACATTAGCCTAGGCCTACACAGG - Intergenic
1015608911 6:134992546-134992568 ACATTAGCCTAGGCCTACACAGG - Intronic
1015840209 6:137468527-137468549 ACAGTAGCCTAGGCCTACCCAGG - Intergenic
1015942696 6:138467662-138467684 ATATTAGCCTTGGCCTACACAGG - Intronic
1016382089 6:143494701-143494723 ACATTAGCCTAGGCCTACACGGG - Intergenic
1016474703 6:144414303-144414325 ACATTAGCCTAGGCCTACACAGG - Intronic
1016543435 6:145193495-145193517 ATGTTAGCCTAGGCCTACACGGG - Intergenic
1016592307 6:145760009-145760031 CCATTAGCCTAGGCCTACACAGG - Intergenic
1016716778 6:147242128-147242150 ACATTAGCCTAGGCCTACACAGG - Intronic
1017022011 6:150147678-150147700 GTAGCATCCTAGCCATAAACAGG + Intronic
1017204803 6:151793226-151793248 GCATTAGCCTAGGCCTACCCAGG + Intronic
1017833185 6:158151191-158151213 CCATTAGCCTAGGCCTACACAGG - Intronic
1018527781 6:164733149-164733171 ACATTAGCCTAGGCCTACACAGG - Intergenic
1019583298 7:1780304-1780326 GTATTAGCCTAGGCCTACACGGG - Intergenic
1020487778 7:8739857-8739879 ATATTAGCCTAGGCCTACACAGG + Intronic
1021696562 7:23281923-23281945 ATATTAGCCTAGGCCTACACAGG - Intergenic
1022021426 7:26402774-26402796 ACATTAGCCTAGGCCTACACAGG - Intergenic
1022666062 7:32411932-32411954 ACATTATCCTAGGCCTACGCAGG + Intergenic
1023281099 7:38570875-38570897 ACATTAGCCTAGGCCTACACAGG - Intronic
1024277148 7:47687273-47687295 ATATTAGCCTGGGCCTACACAGG + Intergenic
1024349148 7:48345470-48345492 ACATTAGCCTAGGCCTACACAGG - Intronic
1024784861 7:52895613-52895635 ACATTAGCCTAGGCCTACACAGG - Intergenic
1024949694 7:54847103-54847125 GCATTTGCCTAGGCCTACACAGG + Intergenic
1026147095 7:67756560-67756582 ACACTAGCCTAGGCCTACACAGG - Intergenic
1026565159 7:71483914-71483936 ACATTAGCCTAGGCCTACACAGG + Intronic
1027344529 7:77243827-77243849 ACATTAGCCTAGGCCTACACAGG - Intronic
1027475450 7:78625086-78625108 ACATTAGCCTAGGCCTACACAGG - Intronic
1027545779 7:79525859-79525881 TCATTAGCCTAGGCCTACACAGG + Intergenic
1027892843 7:83998835-83998857 ACACTAGCCTAGGCCTACACAGG + Intronic
1028495875 7:91460366-91460388 ATATTAACCTAGGCCTACACAGG + Intergenic
1028601334 7:92603619-92603641 ACATTAGCCTAGGCCTACACAGG - Intergenic
1028776142 7:94679168-94679190 ACATTAGCCTAGGCCTACACAGG + Intergenic
1030707667 7:112711321-112711343 ACATTATCCTAGGCCTACCCAGG - Intergenic
1030899822 7:115109237-115109259 ACATTAGCCTAGGCCTACACGGG + Intergenic
1031576857 7:123424842-123424864 ACATTAGCCTAGGCCTACACAGG - Intergenic
1031716236 7:125112200-125112222 ACAGTAGCCTAGGCCTACACCGG + Intergenic
1031888912 7:127271732-127271754 ACAGTAGCCTAAGCCTACACAGG + Intergenic
1032099353 7:128960510-128960532 ATATTAGCCTAGACCTACACAGG - Intronic
1032158866 7:129494898-129494920 ACATTAACCTAGGCCTACACAGG + Intergenic
1033480636 7:141736886-141736908 ACATTAGCCTAGGCCTACACAGG - Intergenic
1035130951 7:156652637-156652659 ATATTAGCCTAGGCCAACACAGG - Intronic
1036734093 8:11293178-11293200 ACATTAGCCTAGGCCTACACAGG - Intronic
1037195396 8:16182624-16182646 ACATTAGCCTAGGCCTACACAGG + Intronic
1037560535 8:20070387-20070409 ACATTAGCCTAGGCCTACACAGG + Intergenic
1038961881 8:32529676-32529698 ACATTATCCTAGGCCTACACAGG + Intronic
1039125949 8:34202107-34202129 ACATTAGCCTAGGCCTACACGGG + Intergenic
1040597524 8:48853732-48853754 ACAGTATCTTAGGGCTACACAGG - Intergenic
1040695919 8:49998624-49998646 ACAGTATCCTAGGCCTACATAGG + Intronic
1040729551 8:50426391-50426413 ATATTAGCCTAGGCCTACACAGG - Intronic
1041141782 8:54827969-54827991 ACATTAGCCTAGGCCTACACAGG + Intergenic
1041261468 8:56023864-56023886 ACATTATCCTAGGCCTGCACAGG - Intergenic
1041369685 8:57145628-57145650 CCATTAGCCTAGGCCTACACAGG - Intergenic
1041821494 8:62039632-62039654 ACATTATCCTAGGCCTACACAGG - Intergenic
1041861824 8:62522635-62522657 CCATTAGCCTAGGCCTACACAGG - Intronic
1042164064 8:65928403-65928425 AAATTAGCCTAGGCCTACACAGG + Intergenic
1042296240 8:67221413-67221435 ACATTAACCTAGGCCTACACAGG - Intronic
1042406335 8:68409396-68409418 ACATTAGCCTAGGCCTACACAGG - Intronic
1043307211 8:78810138-78810160 ATATTAGCTTAGGCCTACACGGG + Intergenic
1043909527 8:85845230-85845252 GCATTATTCTAGGCCTACATGGG - Intergenic
1044117389 8:88351417-88351439 ACATTATCCTAAGCCTACACGGG + Intergenic
1045284336 8:100777430-100777452 GCATTAACCTAGGCCTACACAGG + Intergenic
1049430110 8:142558701-142558723 ACAGTAGCCTAGGCCTGCACAGG + Intergenic
1050285045 9:4092584-4092606 ACATTATCCTAGGCCTACACAGG + Intronic
1050770582 9:9194100-9194122 ATATTAGCCTAGGTCTACACAGG + Intronic
1051128249 9:13830236-13830258 ACATTAGCCTAGGCCTACACAGG + Intergenic
1051684427 9:19642431-19642453 TTAGCATCCATGGCCTACACAGG + Intronic
1052514800 9:29466465-29466487 GTATTACCCTAGGCCTACACGGG + Intergenic
1052623173 9:30941077-30941099 ACATTAGCCTAGGCCTACACAGG + Intergenic
1052652742 9:31324673-31324695 ATATTAGCATAGGCCTACACAGG - Intergenic
1052708195 9:32018905-32018927 ACATTAGCCTAGGCCTACACAGG - Intergenic
1055247278 9:74262089-74262111 ACATTAGCCTAGGCCTACACAGG + Intergenic
1055964760 9:81855276-81855298 ACATTATCCTAGGCCTACACAGG + Intergenic
1056122881 9:83506945-83506967 ACATTAGCCTAGGCCTACACAGG + Intronic
1056209407 9:84351194-84351216 ATATTAGTCTAGGCCTACACAGG + Intergenic
1056405318 9:86268281-86268303 GTATTAACTTAGGCCTCCACAGG - Intronic
1058172461 9:101699198-101699220 ATATTAGCCTAGGCCTACACAGG + Intronic
1058434550 9:104950310-104950332 ATATTAGCCTAGGCCTACACAGG + Intergenic
1059508488 9:114821671-114821693 ACATTAGCCTAGGCCTACACAGG + Intergenic
1061644136 9:131985897-131985919 ACATTAGCCTAGGCCTACACAGG - Intronic
1186577062 X:10777857-10777879 ACATTAGCCTAGGCCTACACAGG + Intronic
1186791306 X:13001806-13001828 ACATTAGCCTAGGCCTACACAGG - Intergenic
1187209915 X:17219254-17219276 ACATTAGCCTAGGCCTACACAGG - Intergenic
1188855924 X:35195806-35195828 ACATTAACCTAGGCCTACACAGG - Intergenic
1189158231 X:38782187-38782209 ACATTAGCCTAGGCCTACACAGG + Intergenic
1189428555 X:40926359-40926381 ACATTAGCCTAGGCCTACACAGG - Intergenic
1189965818 X:46371754-46371776 ATATTAACCTAGGCTTACACAGG + Intergenic
1191789828 X:64957906-64957928 ATATTAGCCTAGGCCTACACAGG + Intronic
1192407693 X:70902994-70903016 TTATTAGCCTAGGCCTACACAGG + Intronic
1193437706 X:81498057-81498079 ATAGTAGTTTAGGCCTACACAGG - Intergenic
1195143736 X:101991502-101991524 ACATTAGCCTAGGCCTACACAGG + Intergenic
1195501841 X:105611049-105611071 ATATTAGCCTAGGTCTACACAGG - Intronic
1195551108 X:106172508-106172530 ATATTAGCCTAGGCCTACACAGG + Intronic
1195580784 X:106499285-106499307 ACATTAGCCTAGGCCTACACAGG - Intergenic
1195781703 X:108473470-108473492 GTATTAGTCTAGGCGTACACAGG - Intronic
1195805086 X:108756642-108756664 ACAATAGCCTAGGCCTACACAGG + Intergenic
1195849297 X:109265469-109265491 ATATTTGCCTAGGCCTACACAGG + Intergenic
1196960731 X:120997886-120997908 ATATTAGCCTAGGCCTGCACAGG + Intergenic
1197540781 X:127757520-127757542 ATATTAACCTACGCCTACACAGG + Intergenic
1198180804 X:134206731-134206753 ACATTAGCCTAGGCCTACACCGG - Intergenic
1198432671 X:136583176-136583198 ACATTAGCCTAGGCCTACACAGG - Intergenic