ID: 1150030575

View in Genome Browser
Species Human (GRCh38)
Location 17:61730162-61730184
Sequence CTTTAATCCTAGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150030569_1150030575 24 Left 1150030569 17:61730115-61730137 CCTACAGTTACAAAGTATAAACT 0: 1
1: 0
2: 3
3: 35
4: 289
Right 1150030575 17:61730162-61730184 CTTTAATCCTAGGGAAAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 208
1150030570_1150030575 -8 Left 1150030570 17:61730147-61730169 CCCAAGCTTTCAAGCCTTTAATC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1150030575 17:61730162-61730184 CTTTAATCCTAGGGAAAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 208
1150030571_1150030575 -9 Left 1150030571 17:61730148-61730170 CCAAGCTTTCAAGCCTTTAATCC 0: 1
1: 0
2: 0
3: 19
4: 273
Right 1150030575 17:61730162-61730184 CTTTAATCCTAGGGAAAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150030575 Original CRISPR CTTTAATCCTAGGGAAAAAC AGG Intronic
902446450 1:16468369-16468391 TTTTTATACTAAGGAAAAACTGG - Intergenic
902971173 1:20052242-20052264 ATTCAATCCAAGGTAAAAACAGG - Intronic
903612830 1:24629152-24629174 TTTTTTTCCTAGAGAAAAACTGG - Intergenic
904529077 1:31156020-31156042 CTTTAATCCTACGCAAAAAAAGG + Intergenic
906506194 1:46381632-46381654 ATATAGTCCTAGGGAAACACTGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
910028164 1:82683153-82683175 CCTGAATCCTAGAGAAAATCTGG + Intergenic
910693279 1:89985990-89986012 CTTTAATCCCAGGGAAACAAAGG - Intergenic
912062343 1:105687900-105687922 CTTTTATTCTAGGGAAAACATGG + Intergenic
912793745 1:112676931-112676953 TTTTAGTACTGGGGAAAAACTGG + Intronic
913126839 1:115798807-115798829 CTTTATTCCTAAAGGAAAACAGG + Intergenic
914200639 1:145481595-145481617 TTTTTATACTAAGGAAAAACTGG + Intergenic
914479753 1:148054722-148054744 TTTTTATACTAAGGAAAAACTGG + Intergenic
917226946 1:172794183-172794205 CTTTGATCTTAGGGTAACACTGG + Intergenic
919442086 1:197648359-197648381 TTCTAATCCTAGGTAAAAAGGGG + Intronic
919636915 1:200012181-200012203 ATAAAATCCTAGGGAAATACAGG + Intergenic
920709823 1:208284857-208284879 ATTAAAACCTAGGAAAAAACAGG - Intergenic
921482225 1:215676600-215676622 GTGTAATCTTAGGGAAAAAATGG - Intronic
921959803 1:221022710-221022732 CTGGCATCCTAGGGTAAAACAGG - Intergenic
922067279 1:222156513-222156535 CTTTAATCCTTAAGACAAACTGG - Intergenic
924018335 1:239752810-239752832 GTTTAAGCCTAGTGAAAAAAAGG - Intronic
924483419 1:244456834-244456856 CTTTCATTTTAGTGAAAAACCGG - Intronic
1063982652 10:11468208-11468230 CTTTAATCCTCTGTAAAAAGTGG + Intronic
1065562433 10:26977239-26977261 CTTTACTCCTAGGGAATACACGG - Intergenic
1068052619 10:51969767-51969789 GTTTAATCCTAGTCATAAACTGG - Intronic
1070864042 10:79695140-79695162 CTGTAATTCTAGGGACAAAGTGG - Intergenic
1071630939 10:87217366-87217388 CTGTAATTCTAGGGACAAAGTGG - Intergenic
1073303571 10:102485686-102485708 CTTTAAACCCACGAAAAAACCGG - Exonic
1074163435 10:110853515-110853537 GTATAAGCCTAGGGAAAATCTGG - Intergenic
1074661910 10:115668674-115668696 ATGTAATCCTAGAGAAAAAATGG - Intronic
1074928247 10:118095586-118095608 CATTAATCCTAGGGCTAATCTGG + Intergenic
1083156554 11:60826962-60826984 CTCTCATCCTAGGGAAAGAGAGG + Intergenic
1086357044 11:86012385-86012407 CTATTAACCTAGGGAAAAATTGG + Exonic
1086959959 11:92971437-92971459 CTTATATATTAGGGAAAAACAGG + Intronic
1089619613 11:119714726-119714748 CATTAATCCTAAGGAAAACAGGG + Intronic
1091414437 12:268967-268989 TTTTAATCTTATGGAATAACTGG - Intergenic
1092168951 12:6361414-6361436 CTTTGATGCTAGGGAGAAAGGGG + Intronic
1092720587 12:11436737-11436759 CTGTAATCCTAGGCAAAAGTGGG + Intronic
1093006809 12:14060022-14060044 CTTTATTCCTCGGGAAGCACAGG - Intergenic
1093237891 12:16634312-16634334 GTTTAATCCCAGAGAAAAACAGG - Intergenic
1093580842 12:20782746-20782768 CCTGAATTCTAAGGAAAAACAGG + Intergenic
1094055284 12:26262946-26262968 CTTTGGTACTAGGGAAATACTGG - Intronic
1096218419 12:49811372-49811394 CTTTAATCCTCTGGGGAAACAGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097748603 12:63327554-63327576 AGTTAATCCTTGTGAAAAACAGG + Intergenic
1098070293 12:66667567-66667589 CTGTTATCCTGGGGAAAAAGTGG - Intronic
1098141941 12:67458530-67458552 CATGAATCAGAGGGAAAAACTGG - Intergenic
1098609887 12:72443486-72443508 GCTCAATCCTAGGGAAAAAAAGG - Intronic
1098624419 12:72644943-72644965 CTTTATTCCCAGGGAGAAGCAGG - Intronic
1099226508 12:79976342-79976364 CATTACACATAGGGAAAAACTGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1104664885 12:130640930-130640952 CTTTAATACTAGGAAACTACTGG + Intronic
1105828465 13:24143338-24143360 CTTTAATATTGGGGAAAAATGGG - Intronic
1108974990 13:56430021-56430043 CTTTTATTCTAGGCAAAAATAGG - Intergenic
1109249600 13:60003013-60003035 CTTTTCTACTAAGGAAAAACTGG + Intronic
1112644581 13:101315127-101315149 CTGTAATGCTAGGGAAAAATTGG + Intronic
1113153741 13:107293680-107293702 CTTACATCCTTGTGAAAAACGGG + Intronic
1113606979 13:111615757-111615779 TTTTAAGCCTAAGGAACAACAGG - Intronic
1115260242 14:31445085-31445107 CTTTAATCTTAGGAAAACAGAGG + Intronic
1116203747 14:41834150-41834172 TTTTTTTCCTAGGGAAAAAGTGG - Intronic
1116260108 14:42613956-42613978 CTTCAATCCAATGCAAAAACAGG + Intergenic
1116308603 14:43291692-43291714 TTTAAATCATAGGGAAATACAGG + Intergenic
1116482136 14:45404023-45404045 CTTTAATCATAGATAAAAACAGG + Intergenic
1119324221 14:73750009-73750031 CATTTTTCCTAGGGAAAAGCAGG - Intronic
1119756267 14:77122070-77122092 ATTTAATTCAAGGGAAAAAAAGG + Intronic
1121352797 14:93186681-93186703 TTGTAATCGTAGGGAAAAAACGG - Exonic
1125168476 15:36738857-36738879 CTTTAATCCTAGTGATACAGGGG - Intronic
1125495573 15:40190035-40190057 CTGTAATCCAAAGGAAAAATAGG - Intronic
1125580219 15:40780031-40780053 CTCTCATCCCAGGGACAAACAGG + Intronic
1125739012 15:41948546-41948568 TTTTAATCTGAGGGAATAACTGG - Intronic
1128012060 15:64307209-64307231 CATTAATAATAGGGGAAAACGGG + Intronic
1129705685 15:77792868-77792890 CATTCATCCTTGGGAGAAACAGG + Intronic
1131918826 15:97301235-97301257 CTTGCATCTTAGGGAAAAACTGG - Intergenic
1133330476 16:4970203-4970225 CATTCATCATGGGGAAAAACAGG + Intronic
1135654416 16:24235176-24235198 GTTTAATTCAAGGGAAAAAAAGG - Intergenic
1136182700 16:28565320-28565342 GGTTAATCCTAGGTAACAACTGG - Intronic
1137448213 16:48545625-48545647 TTTTCATCCTAGGAAAAGACAGG - Intronic
1137780755 16:51095929-51095951 ATTTACTCCCAGGGAAAAAAGGG + Intergenic
1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG + Intergenic
1144530452 17:16033590-16033612 ATTTAATCCTAAGGAAAAGATGG + Intronic
1144620157 17:16813557-16813579 CTTTAATCCCGAGGAAAACCAGG + Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145299179 17:21618982-21619004 TTTCAATCCTAGGAAAAAACTGG + Intergenic
1145351100 17:22084300-22084322 TTTCAATCCTAGGAAAAAACTGG - Intergenic
1147395810 17:40141764-40141786 CTTTAGACCTAGGGAAAACTTGG + Intronic
1149149560 17:53544053-53544075 CTTTAATACTAAAGAATAACAGG + Intergenic
1150030575 17:61730162-61730184 CTTTAATCCTAGGGAAAAACAGG + Intronic
1151094176 17:71477112-71477134 CTTAAATCCCAAGGGAAAACTGG + Intergenic
1154273771 18:12942188-12942210 CTAAAATCCTTGGGACAAACTGG + Intergenic
1155126688 18:22885063-22885085 CTTTAATCTTAGAGAAAAAATGG - Intronic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1159120200 18:64160126-64160148 TTTTAACTCTAGGGAAATACTGG - Intergenic
1159426244 18:68290877-68290899 TTGTAATCCTAGAGAAAAAATGG + Intergenic
1165909854 19:39218848-39218870 CTCTGATCCCAGGGAAAAGCAGG + Intergenic
925745781 2:7042459-7042481 CTTTAATCCTGGGGAGTAAGGGG + Exonic
925905540 2:8537747-8537769 CTTTGATCCTAGGTTAAGACTGG - Intergenic
927629421 2:24759183-24759205 TTTTAATCATAGGACAAAACTGG + Intronic
929285800 2:40133981-40134003 CATTATTTCTATGGAAAAACAGG - Intronic
929949610 2:46396671-46396693 TGTTAATCATAGAGAAAAACTGG + Intergenic
932377713 2:71252705-71252727 CTTAAATCCTAAAGAAGAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935921757 2:108023106-108023128 CTTTCAACCTAAGGAAAAATAGG - Intergenic
936871666 2:117140617-117140639 CTTTAATCTCAGAGAAACACAGG + Intergenic
937722719 2:125122425-125122447 TTTTAATCATAAGGAAATACTGG + Intergenic
939501073 2:142985227-142985249 CTTTAATCTGAAGGAGAAACTGG + Intronic
939520844 2:143228568-143228590 TTTTTGTCCTAAGGAAAAACTGG + Exonic
943778284 2:191792323-191792345 CTTTTATCTTAGGGAATGACTGG + Intergenic
943979965 2:194537090-194537112 TTTTAAACCTAGTGAAAAAATGG - Intergenic
945205500 2:207327428-207327450 CTTTATTCCCAGAGAATAACTGG - Intergenic
945994494 2:216424571-216424593 CTTCAATGTGAGGGAAAAACTGG + Intronic
946207642 2:218121398-218121420 CTCGAATTCTAAGGAAAAACAGG + Intergenic
947842899 2:233219891-233219913 CTTTTATATTAGGGAAAAAGGGG + Intronic
1169253418 20:4078589-4078611 CTTTAATCCTTGGGTTAAAGAGG - Intergenic
1170426669 20:16241987-16242009 GCTTAATCCCAGGGAAAAAATGG - Intergenic
1170873589 20:20231153-20231175 CTTACATCCTAGGGAATATCAGG - Intronic
1171561348 20:26129276-26129298 TTTCAATCCTAGGAAAAAACTGG - Intergenic
1172144917 20:32750226-32750248 CCTTTCTCCTAGGGAAAACCTGG - Intergenic
1172927385 20:38550964-38550986 ATGTAATCCTAGGGAAACACAGG + Intronic
1176649898 21:9536019-9536041 TTTCAATCCTAGGAAAAAACTGG + Intergenic
1177384913 21:20396350-20396372 CCCTATTCCTAGGTAAAAACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950691129 3:14658859-14658881 TTTTTCTCCTAGGGAAAAATTGG + Exonic
951730513 3:25805834-25805856 TCTTAATACTAGGGAGAAACTGG + Intergenic
952264470 3:31772137-31772159 GTTTGCTCCTAGGGAAATACAGG + Intronic
952941246 3:38445839-38445861 CCTGAATCCTAAGGAAAAATAGG + Intergenic
954503073 3:51039325-51039347 TTTTTATCCTAGCAAAAAACTGG - Intronic
955616047 3:60807707-60807729 AGTTAATCCTGGGGACAAACAGG - Intronic
955982132 3:64537778-64537800 CTTTAAACCTAAGAGAAAACTGG + Intronic
957189314 3:76985823-76985845 CATTAATCCTCAGGAAATACTGG - Intronic
957235969 3:77592095-77592117 TTTTAAAGCAAGGGAAAAACAGG - Intronic
959845688 3:111030542-111030564 TGTTTATACTAGGGAAAAACTGG + Intergenic
963706986 3:148699407-148699429 CTTTATAGCTAGGGAAACACCGG - Intronic
964968112 3:162524002-162524024 CTTTAATCATTGAGAAAAAGAGG - Intergenic
965465230 3:169021286-169021308 TTTAAGTCCTAGGGGAAAACTGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966021157 3:175212770-175212792 CTTTAAGTCTAGGTAAAAATAGG - Intronic
967077232 3:186014446-186014468 CATTAGTAGTAGGGAAAAACTGG - Intergenic
967792136 3:193561056-193561078 CTTCACTCCTAGGAAAAATCTGG + Intronic
968702887 4:2065098-2065120 CTTTAATTCTTGGGACAAAACGG + Exonic
968827519 4:2910415-2910437 CTCTAAGCACAGGGAAAAACAGG - Intronic
972587043 4:40447537-40447559 TTTTGATCCTAGGTAAACACTGG - Intronic
973276083 4:48310916-48310938 CATTAATAATAGGGAAAAAGAGG + Intergenic
973671307 4:53220973-53220995 CTTTAATCATAGAAAAAAATAGG + Intronic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
979521832 4:121676281-121676303 CTTTAATGATAGAGAAAATCAGG + Intronic
979799197 4:124886765-124886787 CTTTAAGCCTAGGGTAAACTTGG - Intergenic
980092515 4:128457174-128457196 CTTGAATCCCAGGGGAAATCTGG - Intergenic
980204859 4:129704484-129704506 ATTTAATCCTAGGAACAAATGGG + Intergenic
982953082 4:161725679-161725701 CTTTAATCCTAGGCATCATCTGG + Intronic
982976795 4:162073487-162073509 CTTTAATCTTTGCAAAAAACAGG + Intronic
983942133 4:173545706-173545728 CTTTAATAACAGTGAAAAACTGG + Intergenic
985903208 5:2813445-2813467 CTTCAATCCAAGGGAAGAGCAGG - Intergenic
986760214 5:10873360-10873382 CTTTATTCATAGCCAAAAACTGG - Intergenic
986865692 5:11983915-11983937 ATTAAATCCTAGGGAATCACAGG + Intergenic
990196049 5:53317683-53317705 TTTTAATTATAGAGAAAAACTGG - Intergenic
990303967 5:54476974-54476996 CTATAATCCTTGGAAAACACAGG + Intergenic
992497553 5:77308698-77308720 CTGTAATCCTAGGGGCAGACAGG - Intronic
992974170 5:82095815-82095837 CTTTACTCCTAGGGATAAGCTGG + Intronic
993425106 5:87753560-87753582 TTTTAATCATAGAGAAAAAGAGG - Intergenic
993775177 5:91985496-91985518 CTTTAGTACTTTGGAAAAACGGG - Intergenic
995837548 5:116413509-116413531 CTTTGTTCTTAGGGGAAAACTGG + Intergenic
997314837 5:132923816-132923838 CTTTTATCCTGGGTAAATACTGG - Intronic
997414777 5:133717846-133717868 CTTTATTCATAGTTAAAAACTGG - Intergenic
1004846868 6:19653366-19653388 CTTTTATACTAGCAAAAAACTGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1009711956 6:67334687-67334709 TTATAATCTTAGGGGAAAACAGG - Intergenic
1009719479 6:67448619-67448641 CTTGAATCCTAACTAAAAACCGG + Intergenic
1009764363 6:68050314-68050336 TATTAATCATAGGGAAAATCAGG - Intergenic
1011445321 6:87432943-87432965 CTTAAATCCCAGGGTAACACTGG + Intronic
1011994000 6:93561964-93561986 AATTAATCCTAAAGAAAAACTGG - Intergenic
1014602034 6:123425151-123425173 ATTTAAGCCTGGGGAAAAAAGGG + Intronic
1015173737 6:130283046-130283068 TTTAAATCCTAAGGAAAAAAAGG + Intronic
1015746666 6:136517063-136517085 CATTAATCCCAAGGAATAACAGG + Intronic
1016183716 6:141176717-141176739 CCTGAATCCTAAGGAAAAATAGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017675117 6:156805220-156805242 TTTAAATCTTAGGGAAAATCTGG + Intronic
1020413820 7:7923209-7923231 ATTTAATCCTTTGGAATAACAGG - Intronic
1020936376 7:14469989-14470011 ATTTAGTCATATGGAAAAACTGG + Intronic
1021283444 7:18748982-18749004 CTTTAAGACAAGGGAAATACAGG - Intronic
1022064928 7:26844281-26844303 TTTTAAAACTAGGTAAAAACAGG + Intronic
1022311146 7:29196876-29196898 TTTTAATCCTAAGGGAAAATGGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028842635 7:95444385-95444407 CTTTCATCCTAGGGCAAAACTGG - Intergenic
1028847967 7:95504072-95504094 CTTTATTCATAGGGAAATGCAGG - Intronic
1030088146 7:105834938-105834960 CTTTTAGCCCTGGGAAAAACTGG - Intronic
1032588834 7:133173757-133173779 CATCAATCTTAGGGAAAAATGGG - Intergenic
1033094570 7:138419225-138419247 CTTTAGTTCTATGGGAAAACTGG - Intergenic
1037140837 8:15518599-15518621 CTATAATCCTATGGAAAAAAAGG - Intronic
1037237524 8:16738733-16738755 CTTTAATCTCAGGGAAAAGGTGG - Intergenic
1040402724 8:47068508-47068530 CTTTAAACCATGGGAAAAATAGG - Intergenic
1042305292 8:67324822-67324844 TTTTAATCCCATGGTAAAACTGG + Intronic
1043281523 8:78473122-78473144 CATTGCTCCTAGGGAAATACAGG - Intergenic
1043290349 8:78592194-78592216 CTATAATCATAGAGAAAATCTGG + Intronic
1044542907 8:93427934-93427956 CTTTCCTACTAGGGAAGAACAGG + Intergenic
1045710464 8:104977261-104977283 ATTCAATGCTAGGGAAACACTGG + Intronic
1052138422 9:24945149-24945171 CTTGAATCCTAGTTAAAAATGGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053578908 9:39382634-39382656 CTTTAATACTAGAGAAAGATGGG + Intergenic
1053843424 9:42210709-42210731 CTTTAATACTAGAGAAAGATGGG + Intergenic
1054100491 9:60941438-60941460 CTTTAATACTAGAGAAAGATGGG + Intergenic
1054121888 9:61217063-61217085 CTTTAATACTAGAGAAAGATGGG + Intergenic
1054585856 9:66965448-66965470 CTTTAATACTAGAGAAAGATGGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056390726 9:86139062-86139084 CATTACTCCTAGGGGAATACAGG + Intergenic
1059755357 9:117288542-117288564 TTTTAATCCTGGGGAAATCCTGG + Intronic
1059905361 9:118978221-118978243 CTCTAATCCATGGGAAAATCAGG - Intergenic
1060146777 9:121259871-121259893 CTTCAGCTCTAGGGAAAAACAGG + Intronic
1203627640 Un_KI270750v1:39567-39589 TTTCAATCCTAGGAAAAAACTGG + Intergenic
1187094185 X:16129124-16129146 CTTTGATTCTATGGAAAGACTGG + Intronic
1187482005 X:19665807-19665829 GTTTAATGCTATGTAAAAACTGG - Intronic
1188829986 X:34884425-34884447 TTGTAAACCTAGAGAAAAACAGG + Intergenic
1188979216 X:36712175-36712197 TTTCAAGCCTAGGGAAGAACAGG + Intergenic
1191566206 X:62535710-62535732 CTTTAATCCTATGGTCAAAAAGG + Intergenic
1193369241 X:80673874-80673896 CTTTAAACCTACGTAAAATCTGG - Exonic
1193545784 X:82826871-82826893 CTTTAATCTTTGAGAAAAAGAGG + Intergenic
1193653347 X:84167073-84167095 CTTTAAACCAAAGGAAAAATGGG + Intronic
1193971800 X:88064387-88064409 CTTTAACACAAGGGAAAAACTGG - Intergenic
1196419730 X:115509110-115509132 CTTGAATTCTAAGGAAAAATAGG + Intergenic
1197085247 X:122465617-122465639 TTTCAATACTAGGGAAAAGCAGG + Intergenic
1199269161 X:145863056-145863078 CTTTCTTCCTAGAGAAACACAGG + Intergenic
1199827340 X:151513704-151513726 ATTTAATCCTAGGGAGGAATGGG + Intergenic
1200703119 Y:6419053-6419075 CATCAATCCTGGGGAACAACTGG + Intergenic
1201030991 Y:9745654-9745676 CATCAATCCTGGGGAACAACTGG - Intergenic
1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG + Intergenic
1202213536 Y:22472519-22472541 CTGCAATCCTGGGGAAAAAATGG - Intergenic