ID: 1150031998

View in Genome Browser
Species Human (GRCh38)
Location 17:61748314-61748336
Sequence CTTTTCCACAGACCTGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 16, 3: 99, 4: 432}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150031998_1150032009 20 Left 1150031998 17:61748314-61748336 CCCAACCCAGGTCTGTGGAAAAG 0: 1
1: 0
2: 16
3: 99
4: 432
Right 1150032009 17:61748357-61748379 CCCTGGTGCTAAGAAGGTTGGGG 0: 1
1: 59
2: 1062
3: 1666
4: 2391
1150031998_1150032004 14 Left 1150031998 17:61748314-61748336 CCCAACCCAGGTCTGTGGAAAAG 0: 1
1: 0
2: 16
3: 99
4: 432
Right 1150032004 17:61748351-61748373 ACCAGTCCCTGGTGCTAAGAAGG 0: 1
1: 18
2: 563
3: 896
4: 1364
1150031998_1150032002 3 Left 1150031998 17:61748314-61748336 CCCAACCCAGGTCTGTGGAAAAG 0: 1
1: 0
2: 16
3: 99
4: 432
Right 1150032002 17:61748340-61748362 TCTTCCACAAAACCAGTCCCTGG 0: 248
1: 553
2: 1109
3: 1150
4: 1512
1150031998_1150032006 18 Left 1150031998 17:61748314-61748336 CCCAACCCAGGTCTGTGGAAAAG 0: 1
1: 0
2: 16
3: 99
4: 432
Right 1150032006 17:61748355-61748377 GTCCCTGGTGCTAAGAAGGTTGG 0: 1
1: 50
2: 1040
3: 1769
4: 1559
1150031998_1150032007 19 Left 1150031998 17:61748314-61748336 CCCAACCCAGGTCTGTGGAAAAG 0: 1
1: 0
2: 16
3: 99
4: 432
Right 1150032007 17:61748356-61748378 TCCCTGGTGCTAAGAAGGTTGGG 0: 1
1: 59
2: 1068
3: 1667
4: 1517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150031998 Original CRISPR CTTTTCCACAGACCTGGGTT GGG (reversed) Intronic
900078878 1:840572-840594 GATTCACACAGACCTGGGTTTGG - Intergenic
902313989 1:15603799-15603821 CTTTTACAAAGTCCTGGCTTTGG + Intergenic
902647410 1:17809888-17809910 TTTTTCCACAGACCTGGAGTAGG - Intronic
902703542 1:18189413-18189435 TTTTTCCACAGACCAGGGCAGGG + Intronic
903088360 1:20884898-20884920 TTTTTCCACAGACCAGGGTTGGG + Intronic
903458836 1:23506941-23506963 CTTTTCCACAGTAATGGGATCGG - Exonic
903694976 1:25199885-25199907 TTTTTCCAAAGCCCTGGATTTGG - Intergenic
903842082 1:26250431-26250453 TTTTTCCACAGACGATGGTTGGG - Intronic
904035361 1:27556000-27556022 TTTGTCCACAGACCAGGGCTAGG - Intronic
904066393 1:27755195-27755217 CTTCTCCCCAGACCTGGCTCTGG + Exonic
904097504 1:27992253-27992275 TTTTTCCATGGACCTGGGTGGGG + Intronic
904353054 1:29921374-29921396 TTTTTCCACAGACGGGGGTGGGG + Intergenic
905254792 1:36673425-36673447 GTTTTCCAGAGACCTGAGCTGGG - Intergenic
905688946 1:39928647-39928669 TTTTTCCACAGACTGGGGTGCGG - Intergenic
905788788 1:40779078-40779100 CTTTTCCCCAGATCTGGGTGTGG - Intergenic
906390500 1:45411313-45411335 TTTTTCCACAGACTCGGGTGAGG + Intronic
907495778 1:54843339-54843361 TTCTTCCACAGACCAGGGTAGGG - Intergenic
909712274 1:78665572-78665594 TTTTTCCACAGACCAGTGGTGGG + Intergenic
911286224 1:95996939-95996961 CTTTTCCACAGAAATCTGTTAGG + Intergenic
912559749 1:110542014-110542036 CTGTTCCTCAGTCCTGGGTTTGG + Intergenic
912975629 1:114327508-114327530 TTTTTCCATGGACCTGGGTAGGG - Intergenic
914398283 1:147291471-147291493 TTTTACCTCAGACCTGAGTTTGG + Exonic
914817258 1:151071968-151071990 CTTTTCCAAAGACGTTGGGTTGG - Intronic
915147071 1:153801578-153801600 CCTCTACACAGACCTGGGTGAGG + Intergenic
915595426 1:156893958-156893980 CTTTTCTACACTCCTGGGTCTGG - Intronic
916018212 1:160769248-160769270 CTTTCCCACAGTTCTGGGTTTGG - Intergenic
917452504 1:175158594-175158616 GTCTTCCACATCCCTGGGTTTGG + Intronic
917475670 1:175366988-175367010 CTTCCCCACAGACCTGTGCTCGG - Intronic
917780707 1:178393155-178393177 TTTTTCCACGGACCAGGGTTGGG + Intronic
917850621 1:179060632-179060654 ATTTTCCACAGACAGGGGTTGGG - Intronic
918476630 1:184932165-184932187 TTTTTCCATGGACCAGGGTTGGG + Intronic
919153600 1:193732036-193732058 CTTTTCCAAGGACCAGGGTGGGG + Intergenic
919852611 1:201683370-201683392 TTTTTCCACGGACAGGGGTTGGG + Intronic
920072197 1:203310343-203310365 CTGTCTCACAGACCAGGGTTTGG + Intergenic
921110061 1:212027208-212027230 CTTAGCAACAGCCCTGGGTTGGG + Intronic
921322423 1:213954907-213954929 TTTTTCCACAGACCGGGGTGGGG + Intergenic
921638787 1:217527217-217527239 TTTTTCCACAGACTGGGGGTAGG - Intronic
922074633 1:222231338-222231360 CAAGTCCACAGACTTGGGTTTGG - Intergenic
922111827 1:222566349-222566371 TTTTTCCACAGACCAGTGTGAGG + Intronic
922275669 1:224075586-224075608 CTTTTCCTATGACCTTGGTTAGG - Intergenic
922463171 1:225828389-225828411 CTTCTGCACAGCCCTGGGTAGGG - Intronic
922501686 1:226101596-226101618 TTTTTCCACAGACTGGGGTAAGG - Intergenic
922607853 1:226902096-226902118 TTTTTCCACAGATAGGGGTTGGG + Intronic
922865349 1:228856021-228856043 TTTTTCCACAGACCAGGGATGGG - Intergenic
923616744 1:235544654-235544676 TTTTTCCACAGATGTGGGGTGGG - Intergenic
924375517 1:243403915-243403937 TTTTTCCACGGACCAGGGTAGGG - Intronic
924552774 1:245093760-245093782 CTTCTCCACAGAACTAGGTTTGG - Intronic
1063344596 10:5299221-5299243 CTGACCCACAGGCCTGGGTTTGG + Intergenic
1063499456 10:6539680-6539702 TTTTTCCACAGACTGGGGTGGGG - Intronic
1064368154 10:14726810-14726832 TTTTTCCACAGACCAGGGTGTGG + Intronic
1064605038 10:17030288-17030310 TTTTTCCACGGACCGGGGGTGGG - Intronic
1065631417 10:27684789-27684811 TTTTTCCACAGACCGGGGAGCGG + Intronic
1065672561 10:28136280-28136302 TTTTTCCACAGATGGGGGTTTGG - Intronic
1065679094 10:28210678-28210700 ATTTTCCACAGAGCAGGCTTTGG - Intronic
1065939563 10:30551759-30551781 TTTTTCCACAGACTGGGGTGGGG + Intergenic
1067221672 10:44348361-44348383 CCTTTCCACAGACCCCGGTGAGG - Intergenic
1068017882 10:51541106-51541128 TTTTTCCACAGAGCAGGGTTGGG + Intronic
1068194130 10:53694380-53694402 TTTTTCCACAGACGGGGGTAGGG + Intergenic
1068861790 10:61855168-61855190 TTTTTCCACAGACGTAGGTGGGG - Intergenic
1069130255 10:64692077-64692099 ATTTTTCACAGTCCAGGGTTTGG + Intergenic
1069358367 10:67613838-67613860 CTTTTCCACAGACCCAGGGGTGG + Intronic
1072332697 10:94369234-94369256 TTTTTCCACAGATCAGGGTGGGG + Intergenic
1072604973 10:96973244-96973266 TCTTTCCACAGAACTGGCTTAGG - Intronic
1072961205 10:99930798-99930820 CTTTTCCATGGGCCTGGGCTGGG + Intronic
1074069590 10:110052559-110052581 TTTTTCCACAGACTGGGGGTCGG - Intronic
1074507495 10:114084568-114084590 TTTTTCCAAAGACCAGGGTAGGG + Intergenic
1074553330 10:114465691-114465713 CATTTCCACAGACCTGGTAAGGG - Exonic
1075565187 10:123498237-123498259 TGTTTCCAAAGACATGGGTTTGG - Intergenic
1076048770 10:127315706-127315728 CTTTTCCACATAGCTGGGTTGGG + Intronic
1076415071 10:130280222-130280244 TTTTTCCACAGACCCAGGGTGGG - Intergenic
1077400887 11:2356535-2356557 TTTTTCCACAGACCCGGAGTTGG - Intergenic
1077643423 11:3902418-3902440 TTTTTCCACAGACCAGGGTGCGG + Intronic
1078131113 11:8614885-8614907 CTCTTCCACAGAACATGGTTAGG - Exonic
1078342775 11:10511416-10511438 TTTTTCCACAGACCAGGGTTGGG - Intergenic
1078592278 11:12653551-12653573 TTTTTCCACAGACCAAGGTAGGG + Intergenic
1079423871 11:20321531-20321553 CCTTTCCACTGATCTGTGTTTGG + Intergenic
1079541374 11:21579905-21579927 ATTTGTCACAGACCTGGTTTAGG + Intergenic
1080046016 11:27809148-27809170 TTATTCCACAGACTGGGGTTGGG + Intergenic
1080454514 11:32406208-32406230 TTTTTCCACAGACCAGGGGTGGG + Intronic
1080466494 11:32502370-32502392 TTTTTCCACAGACCAGGGGGTGG - Intergenic
1080492595 11:32782302-32782324 TTTTTCCACAGACTGGGGCTGGG - Intronic
1080555519 11:33413047-33413069 ATGTTCCCCAGACCTGGCTTTGG - Intergenic
1080878526 11:36298252-36298274 TTTTTCCACAGACCAGGGTAGGG + Intronic
1081104018 11:39042080-39042102 CTTTTCCACACTCCAGAGTTTGG - Intergenic
1081763070 11:45590730-45590752 CATTTCCAAAGGCCTGGCTTGGG - Intergenic
1082769931 11:57199995-57200017 TTTTTCCACACGCCTGGGATGGG - Intergenic
1082900535 11:58245527-58245549 CTTTTCCACGGACTGAGGTTGGG - Intergenic
1083045227 11:59728566-59728588 CTTTTCAACAGACCTGGTGGTGG + Intronic
1084165926 11:67374687-67374709 CCTTCCCGCAGGCCTGGGTTGGG + Intronic
1084550397 11:69838027-69838049 CTCTTCCACTGTCCTGGGTTGGG - Intergenic
1085482939 11:76837776-76837798 GTTTTCATCAGAACTGGGTTGGG - Intergenic
1086793807 11:91074686-91074708 CTTTTCCACATGGCTAGGTTAGG + Intergenic
1087428393 11:98019182-98019204 TTTTTCCACAGACTGGTGTTGGG + Intergenic
1087454850 11:98372113-98372135 TTTTTCCACAGACCAGGGTTGGG + Intergenic
1089181389 11:116585386-116585408 TTTTTCCACAGACCAGGGTGGGG - Intergenic
1090330764 11:125930479-125930501 CTTTTCCACGGACAGGGGTGTGG - Intergenic
1090388895 11:126374512-126374534 CTTTTCCGTAGACATGGGCTTGG - Intronic
1090435353 11:126682596-126682618 TTTTTCCATGGACCTGGGTAGGG + Intronic
1090704825 11:129326689-129326711 TTTTTCCACAGACCAGGGGGTGG + Intergenic
1091942281 12:4498715-4498737 TTTTTCCACAGACTGGAGTTGGG + Intronic
1091942606 12:4501818-4501840 GTTTTCCACAGACCGGGGGTTGG - Intronic
1092091329 12:5805892-5805914 CATTTCCAAATACCTGGGTGGGG + Intronic
1092283086 12:7112180-7112202 TTTTTCCACAAACCAGGGATGGG - Intergenic
1092392262 12:8091270-8091292 GTTTTCCACAGACCGGCATTAGG + Intronic
1093176365 12:15917734-15917756 TTTTTCCACAGACTGGGGTAGGG + Intronic
1095690937 12:45087775-45087797 CTTTTTCTCATACTTGGGTTAGG + Intergenic
1096184876 12:49572305-49572327 TTTTTCCACAGACAGGGGGTTGG + Intronic
1096326000 12:50662641-50662663 CTATTCCACATCGCTGGGTTAGG - Intronic
1096459213 12:51813027-51813049 CTTTCCCACACACCTGGGAGTGG - Intergenic
1097897236 12:64837252-64837274 TTTTTCCACAGACCAGGGCTTGG + Intronic
1099222241 12:79929051-79929073 TTTTTCCACAGATGTGGGTTGGG + Intronic
1099536048 12:83846321-83846343 TTTTTCCACAAACTGGGGTTAGG + Intergenic
1099695326 12:86012438-86012460 CTTTTTTAAAGACCTGGGTGAGG + Intronic
1099747994 12:86732311-86732333 TTTTTTCACAGACCGGGGTGGGG + Intronic
1100324817 12:93530951-93530973 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1101749057 12:107567843-107567865 TTTTTCCACAGACTGGGGGTAGG - Intronic
1102363034 12:112305006-112305028 TTTTGTCACAGACCTGGCTTGGG + Intronic
1102919374 12:116780286-116780308 TTTTTCCACAGATCAGGGTGGGG + Intronic
1104065756 12:125304306-125304328 CTGGTCCACAGCCCAGGGTTTGG + Intronic
1104650638 12:130529742-130529764 GTTTTCCACAGACTGGGGTGGGG + Intronic
1105983977 13:25547668-25547690 TTTTTCCACAGACTTGGGTGGGG - Intronic
1106039879 13:26079728-26079750 CTCTTCCTCAGATCTGGGTGTGG - Intergenic
1107446219 13:40472314-40472336 TTTTTCCATAGACTGGGGTTGGG - Intergenic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1108245026 13:48505440-48505462 CTTTTGCACAGCACTGGATTAGG - Intronic
1108515182 13:51194785-51194807 CTTTTCCACAGACTGGAGTAGGG + Intergenic
1109218553 13:59617211-59617233 CTGTTTCTCAGACCTGGGTGTGG - Intergenic
1112222684 13:97507042-97507064 TTTTTCCACAGACCATGGTTGGG - Intergenic
1112561901 13:100522575-100522597 CTTTAAAACAGCCCTGGGTTTGG + Intronic
1112880872 13:104104871-104104893 CTTTTTCCCAGGCCTGGGGTGGG + Intergenic
1113300363 13:109012581-109012603 TTTTTCCACGGACCAGGGGTGGG - Intronic
1113783557 13:112989863-112989885 CTTTTCCACAGATCAGGGGTAGG + Intronic
1113881235 13:113627825-113627847 TTTTTCCACAGACCGGAGTCGGG - Intronic
1113932165 13:113974256-113974278 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1114028530 14:18554061-18554083 TTTTTCCACAGATGTGGGTCTGG + Intergenic
1114629614 14:24150740-24150762 CTTTTCCAAAGAGCTGGCATAGG - Exonic
1116423755 14:44764793-44764815 TTTTTCCACAGATCAGGGGTGGG - Intergenic
1117706537 14:58475397-58475419 TTTTTCCACAGACCAGGGCAGGG - Intronic
1118596344 14:67438220-67438242 CTTTTCCAGTGCCCTGGCTTGGG + Intergenic
1118620719 14:67611760-67611782 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1118630212 14:67695617-67695639 CATTTGCACAGACCTGATTTGGG + Exonic
1118765996 14:68909664-68909686 CTGTTCCAGAGCCCTGGGCTGGG + Intronic
1119123093 14:72098063-72098085 CTTTTCCAAAAGCCTGGGGTGGG + Intronic
1119626185 14:76178412-76178434 TTTTTCCATGGACCCGGGTTGGG + Intronic
1119752382 14:77088846-77088868 CTTTTGCACACACCTGTGTATGG - Intergenic
1119772710 14:77230736-77230758 TTTTTCCATGGACCTGGGTGTGG - Intronic
1121735120 14:96213041-96213063 TTGTTCAACAGTCCTGGGTTAGG + Intronic
1122156626 14:99753992-99754014 CTTAGACACAGACCTGGGGTGGG - Intronic
1122305461 14:100763264-100763286 TTTTTCCATGGACCAGGGTTGGG + Intergenic
1122468635 14:101950959-101950981 ATATTCCACAGACCAGGGTGGGG - Intergenic
1123069253 14:105633924-105633946 TTTTTCCACAGACCAGGATCGGG - Intergenic
1123094301 14:105759084-105759106 TTTTTCCACAGACCAGGATCGGG - Intergenic
1124137972 15:27051673-27051695 TTTTTCCACGGACCAGGGCTGGG + Intronic
1124675970 15:31686177-31686199 CTTCTCCACAGCCCTGGGCCAGG - Intronic
1124808159 15:32907108-32907130 TTTTTCCACAGGCCAGGGGTTGG + Intronic
1124917866 15:33994507-33994529 TTTTTCCACAGACCAGGGTGAGG - Intronic
1125468384 15:39977248-39977270 TTTTTCCACAGACGGGTGTTAGG + Intronic
1126104416 15:45138255-45138277 CTTTCCCACAGCCCTGAGGTTGG - Intronic
1126524118 15:49631160-49631182 TTTTTCCACAGACCAGGGTTTGG - Intronic
1126554740 15:49973167-49973189 CTTTTCCACAGATCAGGGGAAGG + Intronic
1126704214 15:51392590-51392612 TTTTTCCATAGACCGGGGTGTGG - Intronic
1127441884 15:59017151-59017173 TTTTTCCACAGACCCAGGGTGGG - Intronic
1129139917 15:73588327-73588349 CTTCTCCAAAGACCTTGTTTTGG + Intronic
1129279200 15:74470518-74470540 TTTTTCCACAGACCAGGGTAGGG + Intergenic
1129332249 15:74833681-74833703 CTATCCCACAGACCTGAGGTGGG + Intergenic
1129703119 15:77779324-77779346 TTTTTCCACAGCCCAGGGTTGGG + Intronic
1130195731 15:81778701-81778723 TTTTTCCACAGACCAGGGCGGGG + Intergenic
1130305907 15:82711908-82711930 CGTTTACACAGGCCTGGGATAGG + Intergenic
1130459147 15:84146338-84146360 CTTTCCCACAGTCCTGTTTTCGG - Intergenic
1131714571 15:95094571-95094593 TTTTTCCACGGAACGGGGTTAGG + Intergenic
1133421968 16:5653737-5653759 CATTTCCACAGGCCAGGGGTGGG + Intergenic
1133909338 16:10050727-10050749 TTTTTCCACAGACCGGGGTTGGG - Intronic
1133977310 16:10608491-10608513 TTTTTCCACAGATGGGGGTTGGG - Intergenic
1134285920 16:12862173-12862195 TTTTTCCATGGACCGGGGTTAGG + Intergenic
1139120400 16:64009375-64009397 TTTTTCCACAGACCAGAGTTGGG + Intergenic
1140522906 16:75597511-75597533 TTTTTCCACAGATCCGGGGTGGG + Intronic
1143602016 17:7953208-7953230 TTTTTCCACAGACAGGGGTGCGG + Intergenic
1143617993 17:8064807-8064829 CCTCTCCCCAGACCTGGGGTGGG - Intergenic
1143838781 17:9714244-9714266 CTTGTCCACAGCCCAGGGGTTGG + Intronic
1143840220 17:9725872-9725894 CTCTTCCACAGCCCTGGGAAGGG - Intronic
1143880132 17:10023667-10023689 CTTTTCCAGAGGCCTGGGGAGGG + Intronic
1143881995 17:10036861-10036883 CTTGTCCACAGGCCTGGGGGTGG - Intronic
1144713615 17:17419549-17419571 TTTTTCCACAGACTGGGGGTGGG - Intergenic
1145075893 17:19854334-19854356 TTTTTCCACAAACCTATGTTGGG - Intronic
1145795166 17:27651230-27651252 CTTGTCCAAAGACCTGTGGTAGG - Intergenic
1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG + Exonic
1149817737 17:59742936-59742958 GTTTTCCACAGACCTGAGGTGGG - Intronic
1150031998 17:61748314-61748336 CTTTTCCACAGACCTGGGTTGGG - Intronic
1150209052 17:63431740-63431762 TTTTTCCACAGACCAGGGCTGGG - Intergenic
1150806742 17:68325490-68325512 TTTTTCCACAGACAGGGGTTGGG - Intronic
1151026759 17:70686017-70686039 TTTTTCCACAGACCAGGGTAGGG - Intergenic
1151945554 17:77318114-77318136 TTTTTCCACAGACCAGGGAGTGG - Intronic
1151984013 17:77530325-77530347 TTTTTCCACGGACCCGGGTGGGG + Intergenic
1152422327 17:80200617-80200639 CTTTTCCACAGACCGGGTTGTGG + Intronic
1153352150 18:4092795-4092817 CTTTTCCACAGACCTTTACTGGG - Intronic
1153377184 18:4393758-4393780 TTTTTCCACAGACCGGGGGCAGG + Intronic
1153529077 18:6025654-6025676 TTTTTCCACAGACAGGGGCTTGG + Intronic
1153533813 18:6078696-6078718 TTTTTCCACAGACCAGGGGTGGG + Intronic
1154405135 18:14083965-14083987 CTATACCCAAGACCTGGGTTGGG - Intronic
1154965295 18:21349892-21349914 TTTTTCCACAGCCAAGGGTTGGG - Intronic
1155107965 18:22686525-22686547 TTTTTCCAAAGACCAGGGTCGGG + Intergenic
1155991051 18:32279713-32279735 TTTTTCCACGGACCTGGCGTTGG - Intronic
1156432832 18:37094018-37094040 TTTTTCCACAGACCAGGGTGTGG + Intronic
1156504396 18:37579896-37579918 CATTTCCACAGAGCTGGTTTAGG - Intergenic
1157778096 18:50412628-50412650 TTTTTCCATGGACCGGGGTTGGG + Intergenic
1158289500 18:55923387-55923409 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1158480903 18:57821058-57821080 TTTTTCCACAAACCAGGGTGGGG - Intergenic
1158595969 18:58816338-58816360 TTTTTCCACGGACCAGGGGTGGG + Intergenic
1158684439 18:59600482-59600504 TTTTTCCACAGACCAGAGGTGGG - Intronic
1159141028 18:64395228-64395250 CTTTCTCACAGAACTGGCTTTGG - Intergenic
1159558320 18:69967854-69967876 TTTTTCCACAGACCAGGGAGAGG + Intergenic
1159692453 18:71505732-71505754 CTCTTCACCAGACCTGGGATGGG + Intergenic
1159937272 18:74379242-74379264 TTTTTCCACAGACCAAGGTTGGG + Intergenic
1159952786 18:74496868-74496890 CTTTCCCGGAGACCTGGGGTGGG + Intronic
1160271334 18:77387032-77387054 TTTTTCCACAGACCAAGGGTAGG - Intergenic
1160398913 18:78594612-78594634 TTTTTCCACAGACTAGGGTAGGG + Intergenic
1161997419 19:7721984-7722006 CTTTTCCACAGACTGGGGTGGGG + Intergenic
1162091971 19:8286125-8286147 TTTTTCCACGGACCAGGGGTGGG + Intronic
1162094208 19:8300974-8300996 TTTTTCCACGGACCAGGGGTGGG + Intronic
1162833262 19:13299846-13299868 TTTTTCCACAGACCTAGGTGTGG + Intronic
1163120966 19:15217469-15217491 TTTTTCCACGGACCGGGGTAGGG + Intergenic
1163208262 19:15820406-15820428 TTTTTCCACGGACTGGGGTTGGG + Intergenic
1163866465 19:19777220-19777242 CTTTTCCACACATGTTGGTTAGG + Intergenic
1163895067 19:20051586-20051608 CTTTTCCACACATGTTGGTTAGG - Intergenic
1164556850 19:29259844-29259866 CATTCCCACAGCCCTGGCTTTGG - Intergenic
1164579710 19:29427182-29427204 TTTTTCCACAGACCAGGGGAGGG - Intergenic
1164717486 19:30404180-30404202 CTTGTGCTCAGACCTGGGTTGGG + Intronic
1166582621 19:43915783-43915805 TTTTTCCACAGACTGGGGTCGGG - Intronic
1168076603 19:53983686-53983708 CTCTTCCTCACAACTGGGTTAGG - Exonic
925675465 2:6357134-6357156 GTTTCCCTCAGACCTGGTTTAGG - Intergenic
925918993 2:8626409-8626431 ATGTGCCTCAGACCTGGGTTGGG + Intergenic
926155243 2:10449734-10449756 CTGTGCCTCAGACCTGGTTTTGG - Intergenic
927001303 2:18796808-18796830 CTCTTCCATACACCTGGGATAGG - Intergenic
928208569 2:29305756-29305778 CTTTTCCACAGACCAGGGGCTGG + Intronic
929184555 2:39080004-39080026 CTTTTCCACAGACTCGGGTGGGG + Intronic
929334497 2:40724435-40724457 TTTTTCCACAGACCAGGAGTGGG - Intergenic
929549744 2:42881979-42882001 CTTTTCCACAGACCAGCTTCTGG - Intergenic
929675160 2:43919251-43919273 TTTTTCCACAGACCAGGTTGTGG - Intronic
932278385 2:70468922-70468944 TTTTTCCACAGACTTGGGAGAGG - Intronic
932725366 2:74175383-74175405 TTTTTCCACAGATCTGGTTGGGG - Intronic
934625765 2:95849494-95849516 TTTTTCCACAGATGGGGGTTTGG + Intronic
934807807 2:97251824-97251846 TTTTTCCACAGATGGGGGTTTGG - Intronic
934829703 2:97505363-97505385 TTTTTCCACAGATGGGGGTTTGG + Exonic
935606049 2:104973132-104973154 CTTTTCTACTGAGCTGGGTCAGG - Intergenic
935891315 2:107681806-107681828 TTTTTCCACAGACCAGGGTGGGG + Intergenic
938637848 2:133248821-133248843 CTTTTCCAAGGACCAGGGTTGGG - Intronic
938904804 2:135827546-135827568 TTTTTCCACAGACTTGGGGGAGG + Intronic
939044260 2:137231449-137231471 CTTTACCACATACCTGTGTATGG + Intronic
939370427 2:141292235-141292257 TTTTTCCACAGACCGGGATGGGG - Intronic
940641581 2:156350165-156350187 TTTTTCCACGGACCTGCGGTCGG - Intergenic
942180288 2:173373784-173373806 CTTGACCAGAGAACTGGGTTTGG + Intergenic
942408412 2:175680712-175680734 CTTTCCAACCAACCTGGGTTAGG + Intergenic
942601000 2:177640972-177640994 CATTTCCACAACCCTGGTTTAGG + Intronic
943294327 2:186117593-186117615 TTTTTCCACAGACCGGAGGTGGG + Intergenic
943576249 2:189634071-189634093 TTTTTCCACAGACCAGGGGCCGG - Intergenic
943906576 2:193506430-193506452 CTTACCCACAGACCTAGGTGAGG - Intergenic
943906759 2:193508856-193508878 GTTTTCCATGGACCTGGGTCGGG - Intergenic
944434622 2:199673974-199673996 CATTTCCATAGACTTGGGCTGGG - Intergenic
944862757 2:203830427-203830449 TGTTTCCACAGAGCTGAGTTGGG + Intergenic
946385475 2:219381779-219381801 GTATTCCACACACCTGGGTTAGG + Intronic
946463461 2:219890547-219890569 GTTGTCCACAGAGCTGGGTGTGG + Intergenic
946584558 2:221170253-221170275 TTTTTCCACAGACCTGGGGAAGG - Intergenic
947218720 2:227772489-227772511 CTGTTCCACAGCCCGGGGATTGG - Intergenic
947406957 2:229788348-229788370 TTTTTCCACAGACATGGACTGGG - Intronic
947482411 2:230512659-230512681 TTTTTCCACAGACCGGGATGGGG + Intronic
947704593 2:232264026-232264048 TTTTTCCACAGACCAGGGGTAGG + Intronic
947798507 2:232910218-232910240 TTCTTCCACAGACCAGGGGTGGG + Intronic
948394893 2:237638035-237638057 CTTTTCCACAGACCAGGGTGTGG + Intronic
948535788 2:238645685-238645707 TTTTTCCACAGACCGGGGAAGGG - Intergenic
949042455 2:241855576-241855598 CTGTTCCACAGCCCCGGGATGGG - Intronic
1168846319 20:947052-947074 CTCCTCCACAGCCCAGGGTTGGG + Intergenic
1168892747 20:1305568-1305590 CTGTCCCACAGACCTGGGCCTGG - Exonic
1169138092 20:3209747-3209769 CTTTTCCACACAGCCGGGTCAGG - Intronic
1169166680 20:3430141-3430163 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1169482862 20:6001118-6001140 GTTTTCCACGGACCTGGATGGGG + Intergenic
1169812541 20:9622788-9622810 TTTTTCCACAGACAGGGGTGCGG - Intronic
1170233820 20:14079912-14079934 TTTTTCCACAGACTGGGGGTAGG - Intronic
1170670260 20:18426298-18426320 TTTTTCCACGGACCTGGTTGGGG - Intronic
1170742036 20:19066623-19066645 TTTTTCCACACACCAGGGGTGGG - Intergenic
1171129899 20:22642416-22642438 CTTTCCCAGAAACGTGGGTTTGG + Intergenic
1172757077 20:37293131-37293153 TTTTTCCACAGACCTGGGGGTGG + Intronic
1172838917 20:37890413-37890435 CTTTGCAACAGCCCTGGGGTTGG + Intergenic
1172882208 20:38209334-38209356 CTCATCCACAATCCTGGGTTTGG + Intergenic
1174117829 20:48239677-48239699 CCTCTCCACTGACCTAGGTTTGG - Intergenic
1174142824 20:48428456-48428478 TTTTTTCACAGACCAGGGATGGG + Intergenic
1174455884 20:50648501-50648523 TTTTTCCACTGACCAGGGTGGGG + Intronic
1174635538 20:51996270-51996292 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1174828000 20:53786376-53786398 CTTTACTACAGAGCTGGGTTTGG - Intergenic
1175062889 20:56259740-56259762 CTGATCCACAGGCCTGGGGTGGG + Intergenic
1175729242 20:61342206-61342228 TTTTTCCACAGATCAGGGGTAGG + Intronic
1175784121 20:61701450-61701472 CTTGTCCACATAGGTGGGTTTGG + Intronic
1179405541 21:41122390-41122412 TTTTTCCACAGACCCAGGGTTGG + Intergenic
1179598030 21:42456228-42456250 TTTTTCCACAAACCAGGGTGGGG + Intergenic
1180452651 22:15481111-15481133 TTTTTCCACAGATGTGGGTCTGG + Intergenic
1181560238 22:23695802-23695824 GTTTTCCAGAGTCCTGGGTGGGG - Intronic
1182752882 22:32655856-32655878 TTTTTCCACTGACCAGGGATGGG - Intronic
1183503664 22:38196444-38196466 CTTTTCCACAGATGAGGGTGGGG + Intronic
1183571040 22:38653709-38653731 TTTTTACACAGACCTGGGATGGG - Intronic
1183756555 22:39772107-39772129 TTTTTCCACAGAACAGGGTGTGG + Intronic
1184932951 22:47694977-47694999 TTTTTCCAGAGACCAGGGCTGGG + Intergenic
949395309 3:3608489-3608511 TTTTTCCACAGACCTGGGGAGGG - Intergenic
949636032 3:5982209-5982231 CATTTCCACAGATCTCGGTCAGG + Intergenic
949644792 3:6080662-6080684 AATTTCCACAGACCTGGTTCAGG - Intergenic
949787228 3:7755204-7755226 ATTTTCCACAGAGCTGTCTTTGG + Intergenic
950791800 3:15477918-15477940 CTCTTCCATAGCCCTGGCTTAGG - Intronic
951145488 3:19221385-19221407 CTTTTCCACAGATCTGTTTTTGG - Intronic
951628194 3:24689879-24689901 TTTTTCCACGGAACTGGGTGGGG - Intergenic
952163000 3:30714498-30714520 TTTTTCCACGGACCTGGTATTGG - Intergenic
953309880 3:41866383-41866405 TTTTTCCATGGACCAGGGTTAGG + Intronic
953872561 3:46639952-46639974 TTTTTCCACAGACCAGGGTGGGG + Intergenic
954230848 3:49216199-49216221 TTTTTCCACAGACCAGGATACGG + Intronic
954308855 3:49748750-49748772 CTTTTCCACAGAACGGGTGTGGG + Intronic
954327651 3:49872355-49872377 CTTTAGCACAGACCAGAGTTTGG + Intergenic
955581769 3:60430908-60430930 CTTTTTCTCAGTCCTGGTTTTGG + Intronic
955917970 3:63925551-63925573 TTTTTCCACTGACCAGGGTTGGG - Intronic
956198125 3:66674043-66674065 TTTTTCCACAGACCGGGGTGAGG - Intergenic
956438638 3:69258964-69258986 TTTTCCCACGGACCAGGGTTGGG + Intronic
956684062 3:71807995-71808017 CTCTTCCACTGACCTGTTTTGGG - Intergenic
956764427 3:72472457-72472479 TTTTCCCACAGACCGGGGTTGGG - Intergenic
956801600 3:72764708-72764730 CCTGTTCAGAGACCTGGGTTGGG - Intronic
958056509 3:88419228-88419250 TTTTTCCACAGACCAGGGGGTGG - Intergenic
959385967 3:105707143-105707165 CTTTGCCACACACATTGGTTTGG - Intronic
959846844 3:111042727-111042749 TTTTTCCACAGACTAGGGTCAGG - Intergenic
960086138 3:113593461-113593483 TTTTTCCACAGACGGGGGTGGGG - Intronic
962181920 3:133214936-133214958 TTTTTCTACAGACCTGGGGTGGG - Intronic
962373976 3:134845112-134845134 GTATTCTACAGACCTGGCTTTGG + Intronic
962754335 3:138456753-138456775 TTTTCCCACAGACCGGGGGTGGG - Intronic
963511340 3:146251885-146251907 CTTTTCCACAGAATTGGGGGAGG + Intergenic
963624818 3:147658247-147658269 TTTTTCCACAGACCTGGAGTGGG + Intergenic
964410223 3:156390216-156390238 CTATCCCTCAGACCTGGGGTGGG - Intronic
964792015 3:160461173-160461195 TTTGTCCACAGATCAGGGTTGGG - Intronic
965435753 3:168648896-168648918 TTTTTCCACAGACCGGGGTAAGG - Intergenic
965468812 3:169064980-169065002 CATTTCCAAAGTCCTGGGTAAGG - Intergenic
966358440 3:179107448-179107470 TTTTTCCACAGACTGGGGTAGGG + Intergenic
966812043 3:183855509-183855531 TTTTTCCATAGACCAGGGGTGGG + Intronic
967141853 3:186568132-186568154 AATTTACACATACCTGGGTTAGG + Intronic
968213521 3:196868492-196868514 CTTTTCCAGAGAGCCCGGTTGGG + Intronic
968478754 4:824974-824996 CTTCTCCACGGCCCTGGGCTCGG - Intronic
970008854 4:11436670-11436692 TTTTTCCACAGACCCGGGTGGGG + Intergenic
970690396 4:18612966-18612988 TTTTTCCACAGATGAGGGTTGGG + Intergenic
971066232 4:23036008-23036030 CTTTTTCACAGGCCTGAGGTGGG - Intergenic
972536900 4:40007375-40007397 TTTTTCCACAGACATGTGGTGGG + Intergenic
973944805 4:55945543-55945565 CTTTTCCACAGATTAGTGTTGGG - Intergenic
975133517 4:70851378-70851400 TTTTTCCACAGACCAGGGTAGGG - Intergenic
975289322 4:72658530-72658552 ATATGCCACAGTCCTGGGTTTGG + Intergenic
975441795 4:74419703-74419725 TTTTTCCACAGACCAGGGGGTGG + Intergenic
975960745 4:79901560-79901582 TTTTTCCACAGACCGGGGGGTGG + Intronic
976058268 4:81095091-81095113 CTCATCCCCAGACTTGGGTTTGG + Intronic
976122692 4:81800310-81800332 TTTTTCCACGGACCAGGGTGTGG + Intronic
976705595 4:88015943-88015965 TTTTTCCACAGACCTGGGGTAGG + Intronic
976787217 4:88835454-88835476 CTTTTCCACAGACTAGGGGGTGG + Intronic
978754474 4:112287077-112287099 TTTTTCCACAGACTGGGGTTGGG + Intronic
978776352 4:112510138-112510160 CTTTTCCAAAGCGCTTGGTTTGG - Intergenic
980016668 4:127657913-127657935 TTTTTCCACAGACCAGGGTTGGG - Intronic
981000147 4:139821485-139821507 TTTTTCCACAGACCAGGGGTCGG - Intronic
981207122 4:142055800-142055822 TTTTTCCACTGACCTGGGGGTGG + Intronic
981553725 4:145968261-145968283 CTTATCCAAATATCTGGGTTTGG - Intergenic
981786307 4:148483109-148483131 TTTTTCCACAGACTGGGGTGGGG - Intergenic
981988719 4:150889674-150889696 TTTTTCCACAAACTGGGGTTGGG - Intronic
982086302 4:151840211-151840233 TTTTTCCACAGACTGGGGGTGGG - Intergenic
982248826 4:153383543-153383565 CTTTTCTCCAGGCCTTGGTTGGG + Intronic
983850199 4:172570659-172570681 CTTTTTCACAGACCAGTGGTGGG + Intronic
985143860 4:186872633-186872655 TTTTTCCACAGACCAGGGTGGGG - Intergenic
985223838 4:187738012-187738034 CTTGTTCTCAGTCCTGGGTTTGG - Intergenic
985940102 5:3128520-3128542 CTTTCCCAGGGACCTGGGTGTGG - Intergenic
986237126 5:5921770-5921792 TTTTTCCACCTACCTGGGATGGG - Intergenic
987018792 5:13848418-13848440 TTTTTCCATAGACCAGGGGTGGG + Intronic
988095957 5:26610354-26610376 TTTTTCCACAGACCCAGGGTTGG - Intergenic
988144946 5:27293237-27293259 TTTGTCCATAGACCTGGGTGGGG - Intergenic
989257177 5:39378433-39378455 GTTTTCTTCAGACCTGGGTTAGG + Intronic
989472488 5:41836559-41836581 TTTTTCCACAGATGGGGGTTGGG + Intronic
989728189 5:44613674-44613696 CTTTTCCACTGTTCTGGGTTAGG + Intergenic
990070802 5:51780751-51780773 TTTTTCCACAGATCTTGTTTTGG - Intergenic
990148070 5:52785411-52785433 TTTTTCCACAGACCAGGGGTAGG + Intergenic
991095028 5:62730966-62730988 TTTTTCCACAGACCTGGGGTGGG + Intergenic
991103154 5:62815646-62815668 CTTTTCCACAGCCCAATGTTGGG - Intergenic
991316144 5:65309092-65309114 CTTTTCCACAGACCAGGGTGGGG + Intronic
992222579 5:74587426-74587448 CTTCCCCACAGACCTGGGGATGG + Intergenic
993037265 5:82771423-82771445 TTTTTCCACAGACCAGGGACGGG + Intergenic
993078765 5:83269847-83269869 TTTTTCCATGGACCTGGGGTGGG + Intronic
993498772 5:88639806-88639828 TGTTTCCACAGCCTTGGGTTTGG - Intergenic
993840157 5:92867490-92867512 TTTTTCCACAGAACAGAGTTAGG - Intergenic
993855260 5:93066378-93066400 TTTTTCCACAGATGGGGGTTGGG - Intergenic
994163557 5:96584111-96584133 TTTTTCCACAGACAAGGGGTGGG + Intronic
994198821 5:96949494-96949516 TTTTTCCACAGACAGGGGTGTGG - Intronic
994453484 5:99974341-99974363 TTTTTCAACAGACCAGGGTTGGG - Intergenic
994745300 5:103669996-103670018 CTCTTCCAAAGACTTTGGTTTGG - Intergenic
995225187 5:109692775-109692797 TTTTTCCACAGACAGGGGTGGGG + Intronic
995354428 5:111222714-111222736 TTTTTCCACAGACAGGGGGTGGG - Intergenic
995443945 5:112222317-112222339 GTATCCCAAAGACCTGGGTTAGG + Intronic
995463877 5:112430851-112430873 TTTTTCCACAGACTTGGGGGTGG + Intergenic
996588270 5:125116026-125116048 CTTTTTCACAAATCTGGGTATGG + Intergenic
996710861 5:126542371-126542393 ATTTTCCACAGAGCTGGGCATGG + Exonic
997290241 5:132727222-132727244 ATTTACCACACACCTGAGTTTGG + Intronic
997693876 5:135846217-135846239 TTTTTCCAAAGACCAGGGTGGGG - Intronic
999587275 5:153103845-153103867 CTTTTCCACAGACTGGGGGATGG - Intergenic
1000078836 5:157824007-157824029 TTTTTGCACAGACCAGGGGTTGG - Intronic
1000336110 5:160242791-160242813 CCATTCCACAGACCTGGTTCAGG + Intergenic
1000814136 5:165899483-165899505 TTTTTCCACAGAACTGGGGAGGG - Intergenic
1000913447 5:167050399-167050421 TTTTTTCACAGACTGGGGTTGGG - Intergenic
1001346714 5:170908184-170908206 CTTTTTGACAGATTTGGGTTTGG - Intronic
1002195642 5:177499558-177499580 TTTTTCCACAGACTGGGGGTGGG - Intergenic
1003024235 6:2539160-2539182 CTTTTCCACAGCACTGACTTTGG + Intergenic
1003714586 6:8632210-8632232 CCTTTCCACAGACAGGGGTGGGG + Intergenic
1004098568 6:12584755-12584777 CTTTTCCACTGAATGGGGTTGGG - Intergenic
1004121252 6:12824408-12824430 TTTTTCCACGGACCAGGGTAGGG - Intronic
1004157900 6:13186759-13186781 TTTTTCCACAGACCGGAGGTGGG + Intronic
1004672477 6:17810516-17810538 CTTTTCCATGGACCGAGGTTGGG + Intronic
1004949761 6:20655695-20655717 TTTTTCCACAGACCGGGGGTGGG - Intronic
1004971292 6:20913511-20913533 GTTTTCCACAGAGCTGGGGCAGG - Intronic
1006507497 6:34498935-34498957 TTTTTCCACAGACTGGGGTTGGG + Intronic
1006507505 6:34498963-34498985 GTTTTCCACAGACCAGGGTTAGG + Intronic
1007335737 6:41153881-41153903 GTTTCTCACAGACCTGGGTGGGG - Exonic
1007474795 6:42112275-42112297 GAGCTCCACAGACCTGGGTTTGG - Intronic
1007809039 6:44473472-44473494 CCTTTTCACAGCCCTGGGCTGGG - Intergenic
1008681620 6:53878267-53878289 TTTTTCCACAGACCAGTGTTGGG + Intronic
1008909360 6:56716801-56716823 TTTTTCCACAGACCAGGGTCAGG + Intronic
1009052196 6:58289654-58289676 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1009747433 6:67835553-67835575 TTTTCCCATAGACCTGAGTTTGG - Intergenic
1010152848 6:72755999-72756021 CTTTTCCACAGGCCTGCGTGAGG - Intronic
1010155469 6:72787081-72787103 TATCTCCACAGACCAGGGTTTGG + Intronic
1010258037 6:73782716-73782738 ATTTTCCAGAGACTTGGATTTGG + Exonic
1011493904 6:87920255-87920277 CTTCTCCTCAGACCTGAGGTTGG - Intergenic
1011846163 6:91565700-91565722 TTTTTCCACGGACCAGGGTTGGG + Intergenic
1011934600 6:92759693-92759715 TTTTTCCACGGACTGGGGTTGGG - Intergenic
1013048056 6:106507452-106507474 CTTTCCCACAGGCCTGGGCAGGG - Intergenic
1013331502 6:109106200-109106222 TTTTTCCACGGACCTGGGTTAGG - Intronic
1013333690 6:109133492-109133514 CTATTCCACAGACCAGGGGTTGG + Intronic
1013465819 6:110416039-110416061 TTTTTCCACAGACTGGGGATGGG + Intergenic
1013471988 6:110474184-110474206 TTTTTCCACAGACCTGTGGTGGG - Intronic
1013496230 6:110700342-110700364 TTTTTTCACATACCGGGGTTCGG - Intronic
1014010437 6:116469414-116469436 TTTTTCCACAGACAGGGGTGGGG + Intergenic
1014191094 6:118497562-118497584 TTTCTCCACAGACCTGGGGAGGG - Intronic
1014227010 6:118860789-118860811 TTTTTCCACAGACCAGAGTGGGG + Intronic
1014335755 6:120134067-120134089 TTTTTCCACAGACCTGGGGTTGG + Intergenic
1014540967 6:122675963-122675985 TTTTTCCACAGACTTGGGGTTGG + Intronic
1014651482 6:124044344-124044366 GTTTTCCACAGACTTTGGGTTGG + Intronic
1014712264 6:124820881-124820903 TTTTCCCATAGACCAGGGTTGGG - Intronic
1014744996 6:125190487-125190509 TTTTTCCACAGACGAAGGTTGGG + Intronic
1015230719 6:130912166-130912188 TTTTTCCACATACCGGGGTGGGG - Intronic
1015832784 6:137387963-137387985 TTTTTCCACGGACCAGGGTGAGG - Intergenic
1015894909 6:138007830-138007852 CTTTTCCCCAGTCCTGCCTTTGG - Intergenic
1015957629 6:138614930-138614952 TTTTCCCACAGACCTGGGGTAGG - Intronic
1016055272 6:139571875-139571897 TTTTTCCACGGACTTGGGGTCGG - Intergenic
1016336265 6:143008346-143008368 CTTTTCTCCAGGGCTGGGTTGGG - Intergenic
1016756984 6:147697951-147697973 TTTTTCCAGAGTCCTGGGGTGGG + Intronic
1017735546 6:157359662-157359684 TTTTTCCATAGACCAGGGTGCGG + Intergenic
1017808502 6:157967001-157967023 CTTTCCCACATACCTGGGACAGG + Intergenic
1018325438 6:162662900-162662922 CTGTTCCAAAGGCTTGGGTTGGG + Intronic
1018489382 6:164276011-164276033 TTTTTCCACGGACCAGGGTAGGG - Intergenic
1018500133 6:164399792-164399814 CTTCTCCACAGAACTGTCTTTGG + Intergenic
1018976489 6:168571583-168571605 CTATTCCTCAGAACTCGGTTTGG - Intronic
1019333462 7:471620-471642 CTTTCCGACTGACCTGGGTGGGG + Intergenic
1019620292 7:1988473-1988495 CTTGTCCCCAGGCCTGGCTTTGG - Intronic
1019986278 7:4658553-4658575 TTTTTCCACAGACCAGAGTGGGG + Intergenic
1021253043 7:18355702-18355724 CTTTTCCCCAGAGTTTGGTTTGG + Intronic
1021609319 7:22442528-22442550 CTTTCCCAAATACCTGGGGTTGG + Intronic
1022509913 7:30928478-30928500 CTTTTCCAGACTCCTGGCTTGGG - Intergenic
1022644242 7:32215926-32215948 CTTTGCCACAGCCCTGGGTCTGG + Intronic
1023049757 7:36240785-36240807 TTTTTCCGCAGACCTGGGTTGGG + Intronic
1023199699 7:37682991-37683013 TTTTTCCACAGACAGGGGTGGGG - Intergenic
1023728769 7:43170357-43170379 TTTTTCCACAGACAGGGGTGGGG - Intronic
1024292202 7:47812772-47812794 CTATTCCACAGAGCTAGGTGAGG + Intronic
1024626628 7:51213446-51213468 TTTTTCCACAGACCAGGCTGGGG - Intronic
1026399010 7:69989986-69990008 TTTTCCCACAGACCTGGGGATGG - Intronic
1027398752 7:77786179-77786201 TTTTTCCACGGACAGGGGTTGGG + Intergenic
1027482724 7:78718778-78718800 TTTTTCCACGGACAGGGGTTGGG - Intronic
1028655616 7:93203114-93203136 CTTTGCCACAGCCGTGGTTTTGG - Intronic
1029015673 7:97313235-97313257 TTTTTCCACACACCAGGGGTGGG + Intergenic
1030199139 7:106884632-106884654 CTTTTCCACGGACAGGGGTGGGG + Intronic
1030661235 7:112221480-112221502 TTTTTCCACAGACTGGGTTTTGG + Intronic
1030812369 7:113989846-113989868 TTTTTTCACAAACCTGGGCTGGG - Intronic
1032116129 7:129118731-129118753 TTTTTCCACAGACCAGGGAGTGG - Intergenic
1032224846 7:130023171-130023193 TTTTTCCACGGACCACGGTTGGG - Intronic
1032474697 7:132203897-132203919 CTTTACCAAAGACCTGGGGAGGG + Intronic
1032707261 7:134432228-134432250 TTTTTCCACAGACCTGGCGGTGG + Intergenic
1033890045 7:146000926-146000948 CTTTAACTCAGACCTGGGTTTGG + Intergenic
1034007696 7:147492108-147492130 TTTTTCTACAGACCAGGGTGGGG + Intronic
1034237664 7:149585284-149585306 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034240745 7:149608943-149608965 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034899278 7:154897504-154897526 TTTCTCCACAGAGCTGGGCTGGG + Intergenic
1035339741 7:158152602-158152624 CATCTCCACAGACCTAGGTGAGG + Intronic
1035526753 8:319113-319135 GATTCACACAGACCTGGGTTTGG + Intergenic
1036612088 8:10359037-10359059 TTTTTCCATAGACCTGGGGTGGG - Intronic
1037190403 8:16117951-16117973 TTTTTCCACAGACCAGGGATGGG - Intronic
1037734914 8:21558037-21558059 TTTTTCCATGGACCAGGGTTAGG + Intergenic
1038199054 8:25394915-25394937 TTTTTCCATGGACCTGGGGTGGG + Intronic
1039250919 8:35663048-35663070 TTTTTCCACGGACCTGGGGTGGG - Intronic
1039960880 8:42246823-42246845 TTTTTCCACGGACCTGGGGTTGG + Intergenic
1040087509 8:43360823-43360845 TTTTTCCACAGACCTGAGGTGGG - Intergenic
1040808466 8:51422311-51422333 TTTTTCCACTGACCGGGGTGGGG - Intronic
1040907452 8:52483281-52483303 TTTTTCCACAGACCAAGGGTGGG + Intergenic
1040915473 8:52563882-52563904 CTCTCCCACACACCTGGGTGTGG - Intronic
1041250540 8:55930113-55930135 TTTTTCCACAGAGCGGGGTCAGG - Intronic
1041332967 8:56748385-56748407 CTTTTCCACAGACTGGGGGTAGG - Intergenic
1041506623 8:58605921-58605943 CATTGCCACATACCTAGGTTTGG - Exonic
1042901815 8:73736535-73736557 CTCTTCCCCACCCCTGGGTTTGG - Intronic
1043196488 8:77299177-77299199 CTTGACCAAAGACTTGGGTTTGG - Intergenic
1043531416 8:81155131-81155153 ACTTTCAACAGACCAGGGTTTGG + Intergenic
1044064954 8:87687946-87687968 CTTTTCCACAGATGGGGGTTGGG + Intergenic
1044416417 8:91945187-91945209 TTTTTCCACAGACCAGGGTAGGG + Intergenic
1045174458 8:99706819-99706841 TTTTTCCACAGTCCTTGGGTTGG - Intronic
1045654927 8:104376942-104376964 TTTTTCTACAGACCGGGGGTTGG + Intronic
1045842837 8:106599815-106599837 TTTTTCCAGGGACCTGGGGTAGG + Intronic
1046037744 8:108864471-108864493 TTTTTCCACGGAGCTGGGGTAGG - Intergenic
1046349334 8:112985974-112985996 TTTTTCCACAGATCGGGGGTGGG - Intronic
1048071831 8:131029365-131029387 TTTTTCCACAGACATGGGTGGGG - Intronic
1048723793 8:137358717-137358739 TTTTTCCACAGACCAGGGTTAGG - Intergenic
1049521136 8:143092065-143092087 CCTTCCCTCAGACCTGGGCTGGG - Intergenic
1050717891 9:8550823-8550845 CTTTTGTACAGGCCTGGGTCAGG + Intronic
1051332123 9:16033690-16033712 TTTTTCCACAGACAGGGGGTGGG - Intronic
1051689605 9:19696236-19696258 TTTTTCCACAGACCGAGGTTGGG - Intronic
1051788622 9:20774142-20774164 TTTTTCCACACACCTGGGGCAGG - Intronic
1051849907 9:21494359-21494381 TTTTTCCATAGACCAGGGTGGGG + Intergenic
1054747451 9:68869141-68869163 CTTGTCCACAGCCCAGGGATTGG - Intronic
1054978619 9:71177360-71177382 TTTTTCCATAGACCAGGGGTAGG - Intronic
1055846376 9:80568554-80568576 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1056325218 9:85472287-85472309 TTTTTCCACAGACCAGGGCAGGG - Intergenic
1056749714 9:89339240-89339262 CATTCCCACAGACTTGGGGTGGG + Intronic
1057342028 9:94211589-94211611 CTTGTCCAAAGACCTTTGTTTGG + Intergenic
1058525902 9:105857445-105857467 GTTCTCCACATACCTGTGTTGGG - Intergenic
1059750346 9:117241719-117241741 CTGGTCCACAGCCCTGGGTTTGG + Intronic
1060345959 9:122815999-122816021 TTTTTCCACAGACTGGGGTTGGG + Intronic
1060633315 9:125179596-125179618 CTTTTCCCTAGACATGGGCTTGG + Intronic
1061467588 9:130794142-130794164 TTTTTCCACAGACTGGGGATGGG - Intronic
1062388828 9:136326120-136326142 CTTTGCCACAGCCCTGGGCCTGG - Intergenic
1062701833 9:137910420-137910442 TTTTTCCACAGACCAGAGGTCGG + Intronic
1185983776 X:4807933-4807955 TTGTTCCACAGACCAGGGTTGGG + Intergenic
1186996708 X:15131399-15131421 TTTTTCCACAGACGGGGGGTGGG - Intergenic
1187386240 X:18851339-18851361 GTTTTCCACAGACTGGGGTGGGG - Intergenic
1187386250 X:18851367-18851389 TTTTTCCACAGACTGGGGTCGGG - Intergenic
1187460700 X:19484374-19484396 TTTTTCCACAGACCAGAGGTGGG - Intronic
1188065665 X:25656399-25656421 TTTTTCCACCGACCAAGGTTGGG + Intergenic
1188469182 X:30518108-30518130 TTTTTCCACAAACCAGAGTTGGG + Intergenic
1188674506 X:32922491-32922513 TTTTTTCACAGACTTGGGCTGGG + Intronic
1188700197 X:33250210-33250232 TTATTCCACAGACAGGGGTTTGG + Intronic
1189235833 X:39486457-39486479 CTTTACAGCAGACCAGGGTTTGG + Intergenic
1189248789 X:39583832-39583854 CCTTGCAACAGAGCTGGGTTAGG - Intergenic
1189642100 X:43084408-43084430 TTTTTCCACAGACCAGGGACGGG + Intergenic
1190068701 X:47261475-47261497 TTTTTCCATAGACCAGGGGTTGG + Intergenic
1191764411 X:64681826-64681848 TTTTTCCACAGACCAGGGAGAGG + Intergenic
1192562287 X:72135054-72135076 CTTGTGCCCAGAGCTGGGTTTGG + Intronic
1195761281 X:108249161-108249183 TTTTACCACAGACCAGGGGTGGG - Intronic
1196086407 X:111687282-111687304 ATTTTCCCCAGACCTAGGCTGGG + Intronic
1197709977 X:129658958-129658980 CTTTTCCATGGACTAGGGTTAGG - Intergenic
1199615412 X:149651749-149651771 CTTCTCCACAGGCCTGCCTTGGG + Intergenic
1199672036 X:150155566-150155588 GTTTTCCCCAGTCCTGGGTGGGG - Intergenic