ID: 1150037795

View in Genome Browser
Species Human (GRCh38)
Location 17:61822807-61822829
Sequence ACAAGTTTTCAGTTTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150037792_1150037795 1 Left 1150037792 17:61822783-61822805 CCTGTATGACTAATATGGGGACC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1150037795 17:61822807-61822829 ACAAGTTTTCAGTTTAAAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 289
1150037791_1150037795 2 Left 1150037791 17:61822782-61822804 CCCTGTATGACTAATATGGGGAC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1150037795 17:61822807-61822829 ACAAGTTTTCAGTTTAAAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150037795 Original CRISPR ACAAGTTTTCAGTTTAAAGG TGG Intronic
904289208 1:29473243-29473265 AAAAGTTTTCAGATTTAATGAGG + Intergenic
907506462 1:54922475-54922497 ACATGTTTTCACTTTCAAGTGGG - Intergenic
910678464 1:89838989-89839011 ACAAGTTATCTTTTTAAAGTGGG + Intronic
910741337 1:90521369-90521391 AAAAGTTTTCAGTTTTGATGAGG - Intergenic
911142433 1:94520185-94520207 ACAAGTTTTCAGCTTTATGATGG + Intergenic
912026770 1:105185240-105185262 ACAATTTTTCAGCCTAAAAGAGG - Intergenic
912230164 1:107783724-107783746 ATAAATTTTCATTTTAAATGAGG - Intronic
913089126 1:115464706-115464728 ACATGTTGTCAGTTTTAAGTGGG + Intergenic
913711454 1:121488053-121488075 AGAAGTTGTCAGTTTGATGGAGG + Intergenic
915068863 1:153248780-153248802 ACAAGTGTTCATTTTCCAGGAGG + Intergenic
917753407 1:178075386-178075408 TCAAGTTTTCAGTTTTAAATTGG + Intergenic
918473164 1:184895786-184895808 ACATGTTTTCAGTTATAAGCAGG - Intronic
918559337 1:185845637-185845659 ACAAATTTACACTTTAAAGTTGG + Intronic
919160992 1:193831216-193831238 AAAAGTTTTCTGTTTAAAGATGG + Intergenic
919435626 1:197556117-197556139 GCAAGTTTTCACTTAAAAGTGGG + Intronic
920002563 1:202809927-202809949 AGAAGTCTTCAATTAAAAGGGGG + Intergenic
920928098 1:210361781-210361803 ACAAGTTCTCAGTATAAGGGTGG - Intronic
922091315 1:222398021-222398043 ACAGGTGTTCAGTCTAGAGGAGG + Intergenic
923913642 1:238478450-238478472 ACAAGTTTTCAGTTTTACAAAGG + Intergenic
924676924 1:246188555-246188577 ACAAGTTTGCTTTTTAAAAGTGG + Intronic
1065742312 10:28808129-28808151 TCAAGTTTACATTTTAATGGAGG - Intergenic
1066267562 10:33791087-33791109 GCTAGTTTAAAGTTTAAAGGAGG - Intergenic
1067076195 10:43185200-43185222 ACTAGCTTTAAGTTTAAAGATGG + Exonic
1068337438 10:55653614-55653636 ATAACATTTCAATTTAAAGGAGG - Intergenic
1068802141 10:61153343-61153365 TCAATTTGTCATTTTAAAGGGGG + Intergenic
1070111383 10:73490250-73490272 GCAAGTTGTCAGTTCAAAGGAGG - Intronic
1073909543 10:108325562-108325584 ACAAATTTTCATATTAAGGGAGG + Intergenic
1074175172 10:110992747-110992769 ACTAGTTTTCTTTTTAATGGTGG + Intronic
1074377193 10:112950321-112950343 AGAGCTTTTCAGTTCAAAGGCGG - Intronic
1075859094 10:125659177-125659199 GGAAGTTTTCAGTTTAATGGAGG - Intronic
1076902318 10:133346017-133346039 ACTAGTTTTCAGGTTAACCGTGG + Intronic
1078004265 11:7520464-7520486 AGAATTTTTCAGTTTAGAAGTGG + Intronic
1079727594 11:23895288-23895310 ACATGTTTTCACTTTTAAGTGGG + Intergenic
1081422685 11:42890072-42890094 ACATGTTTTCATATTAATGGTGG - Intergenic
1085809187 11:79665185-79665207 AGAAGGTTTCAGCTTAGAGGTGG - Intergenic
1090330441 11:125927154-125927176 AAAAGTTTAATGTTTAAAGGGGG - Intergenic
1090457680 11:126864058-126864080 CCAAGTGTTCAGCTTTAAGGAGG - Intronic
1091415875 12:283709-283731 ATCAGTTTTCCTTTTAAAGGGGG - Exonic
1092976541 12:13750444-13750466 AGAAGTTTTAAGTTAAAAGTAGG + Intronic
1093175800 12:15911781-15911803 ACAAGTATTCTATTAAAAGGAGG - Intronic
1093234962 12:16598339-16598361 ACAAACTTTCAGTTTAAATAAGG + Intronic
1093865616 12:24223579-24223601 AAAATTTTTCAGTATAAAGATGG - Intergenic
1094803363 12:34064596-34064618 ACAAGTTTTCAATTTTAATGTGG - Intergenic
1095443595 12:42262159-42262181 ATAAATTTTAAGTTTAAATGAGG + Intronic
1095721986 12:45410748-45410770 ACAAGTCTGCAGTTAGAAGGTGG + Intronic
1095734894 12:45546002-45546024 ACAGTTTTACAGTATAAAGGGGG - Intergenic
1096359043 12:50967633-50967655 CCATGTTTTCAGTTATAAGGAGG - Intronic
1097400276 12:59119802-59119824 ACAGGTCTTCAGGTCAAAGGTGG - Intergenic
1098153695 12:67574902-67574924 ACTAGTTTTCACTTTAAGGCTGG - Intergenic
1098695677 12:73551377-73551399 ACATGTTCTCATTTTAAAAGGGG - Intergenic
1099077492 12:78128950-78128972 ACACGTTTTCATTTAAAGGGAGG + Intronic
1099705040 12:86141570-86141592 GAAAGTGTTCAGTTTAAAGCTGG - Intronic
1100737355 12:97551395-97551417 ATTATTTTTCTGTTTAAAGGAGG + Intergenic
1101354775 12:103966452-103966474 AGGAGTTTTCATTTTAAAGTTGG + Intronic
1102325570 12:111980083-111980105 ATAAGTTTTCAGTTCAACTGAGG - Intronic
1102618766 12:114177045-114177067 TCAAGTTGTCAGGCTAAAGGAGG - Intergenic
1102714815 12:114961034-114961056 TAATGTTTTCTGTTTAAAGGTGG - Intergenic
1104275839 12:127326981-127327003 ACAAGATTACAGTTTAATGGGGG - Intergenic
1105048817 12:133029413-133029435 ATAATTTTTCAGTTTATATGTGG - Intergenic
1107030534 13:35848280-35848302 AGAAGTTTTCAGTTCATTGGTGG - Intronic
1107687185 13:42914245-42914267 AGAAGTTTACATTTTAAGGGAGG - Intronic
1108023686 13:46156043-46156065 ACAAGTTTAAAGTATAAAGTTGG - Intronic
1108341932 13:49505470-49505492 AAAAGTTTTCAATTTAGATGAGG - Intronic
1109120190 13:58446162-58446184 ACCAGTATTAACTTTAAAGGGGG + Intergenic
1109268384 13:60226900-60226922 AGAAGGTTTCATTTTGAAGGAGG + Intergenic
1109496343 13:63177630-63177652 ACAAGTATTCAGTTTTAAAAGGG + Intergenic
1109807739 13:67466606-67466628 ACAAGGTGTGAGTTTAAAAGTGG + Intergenic
1110052599 13:70923607-70923629 ACAAGTTAGCACTTTCAAGGTGG + Intergenic
1111813472 13:93120757-93120779 ACATGTTTTCAGAGTTAAGGGGG + Intergenic
1112101308 13:96192519-96192541 ACAAGTTCTCACTTAAAAGGGGG - Intronic
1113498159 13:110750041-110750063 ACAAGTTTACAGATTTAATGTGG + Intergenic
1114899745 14:27042652-27042674 ACATGTTTTCAGTTAACAGTAGG + Intergenic
1115020635 14:28676585-28676607 ACACGTTTTCAATTTAAATTTGG - Intergenic
1115096546 14:29644209-29644231 ACAGGATTTCAGTTTTAAGATGG + Intronic
1115151619 14:30292957-30292979 ACAAGCTCTGTGTTTAAAGGTGG - Intergenic
1116012347 14:39366419-39366441 ACAACTTTTGAGTTTCCAGGTGG + Intronic
1116576322 14:46580805-46580827 ATAAGTTATCAGTTGAAAGTAGG + Intergenic
1117657520 14:57971772-57971794 ACAAACTTTCAGTTATAAGGTGG + Intronic
1118236151 14:64007241-64007263 ACAATTTTTCAGATTCAAGAGGG - Intronic
1118917527 14:70120356-70120378 ACAACTTCTGAGTTTGAAGGTGG + Intronic
1119915037 14:78391006-78391028 ACATGTTTTCACTTTTAAGTGGG - Intronic
1123821948 15:24039331-24039353 TCAAGTTTTCAGTGTAAGGCAGG - Intergenic
1124130663 15:26982679-26982701 ACAAGTGTTCATTTCAAAGAAGG + Intronic
1124216443 15:27811279-27811301 ACAGGTTTTCAGTTGTAAGTGGG + Intronic
1124867173 15:33503811-33503833 AAAATTTTTCAGTTCAAAGTTGG - Intronic
1126332430 15:47547955-47547977 ACATGTTTTCATTTTAGAGGTGG - Intronic
1126425857 15:48526488-48526510 ACAGGTTTAGATTTTAAAGGGGG - Intronic
1129643507 15:77408307-77408329 ACAAGTTTTCACTTCTAAGTGGG + Intronic
1133654213 16:7844041-7844063 AAAAGGTTTCAGATTAAAAGGGG + Intergenic
1133660098 16:7908090-7908112 AGAAGCTCTCAGTTTAAAGGGGG - Intergenic
1136713806 16:32261228-32261250 ACAATTATTCAGTTTTAATGGGG + Intergenic
1136754105 16:32668202-32668224 ACAATTATTCAGTTTTAATGGGG - Intergenic
1136814008 16:33202163-33202185 ACAATTATTCAGTTTTAATGGGG + Intronic
1136820484 16:33312243-33312265 ACAATTATTCAGTTTTAATGGGG + Intergenic
1136827047 16:33368782-33368804 ACAATTATTCAGTTTTAATGGGG + Intergenic
1136832113 16:33467553-33467575 ACAATTATTCAGTTTTAATGGGG + Intergenic
1139062337 16:63267803-63267825 ACAAGTGTGCAGGTTAAAAGTGG - Intergenic
1141036241 16:80628820-80628842 AGAAGTTTACAGTCTAATGGAGG + Intronic
1141496779 16:84415827-84415849 ACGATTTTCCAGTTTAAAGCAGG + Intronic
1141707166 16:85672766-85672788 ACAGTTTTTCTTTTTAAAGGTGG + Exonic
1141979069 16:87538486-87538508 CCAAGCCTTCTGTTTAAAGGTGG + Intergenic
1202992584 16_KI270728v1_random:25137-25159 ACAATTATTCAGTTTTAATGGGG + Intergenic
1203056253 16_KI270728v1_random:928534-928556 ACAATTATTCAGTTTTAATGGGG - Intergenic
1144539873 17:16130498-16130520 TCAAGTATTGAGTTTAAAGAAGG - Intronic
1146945947 17:36873576-36873598 ACACATTTTCTTTTTAAAGGTGG - Intergenic
1148616091 17:49000220-49000242 CCAAGTTTTCAGCTGAAATGGGG - Intronic
1150037795 17:61822807-61822829 ACAAGTTTTCAGTTTAAAGGTGG + Intronic
1150688984 17:67346771-67346793 ACAAGTTAGCAGTATAAATGTGG + Intronic
1152348725 17:79771057-79771079 ACAAGGTTTCAGCTTCAAGGAGG + Intergenic
1155792575 18:29992919-29992941 AAAAATTTGCATTTTAAAGGAGG + Intergenic
1155819777 18:30361240-30361262 GAAAGTTTTCAGTTTAACAGTGG - Intergenic
1156040650 18:32817222-32817244 CAAAGTTTTCAATTTAATGGAGG - Intergenic
1156715370 18:40002638-40002660 ATATGTTTTCAGTTTTAAGTGGG + Intergenic
1157346915 18:46846564-46846586 AGTAATTTTCAGTTTAGAGGTGG - Intronic
1159092239 18:63862604-63862626 TAAAGTTTTCAGTTTACAAGTGG - Intergenic
1159191718 18:65053980-65054002 AAAAGTTTACAGTTTGAAGTGGG - Intergenic
1159517004 18:69470865-69470887 TAAAGTTTTCATTTTAGAGGAGG + Intronic
1159547465 18:69857868-69857890 ACAAGTTTTCCATTTAAAAATGG + Exonic
1159566236 18:70053904-70053926 TTGAGTTTTCAGTTTAAATGAGG - Intronic
1159826749 18:73222163-73222185 AGAAGCTTTCATGTTAAAGGCGG + Intronic
1160076177 18:75679812-75679834 ACGAGTCTTCAGTATAAAGATGG - Intergenic
1160545998 18:79656112-79656134 ACAAGTTTTCATTTTAACACAGG + Intergenic
1160971874 19:1772488-1772510 ATGAGTTTCCAGTTTAAATGTGG - Intronic
1164717221 19:30401576-30401598 ACATGTTCTCAGATTAAAGTGGG + Intronic
1166490275 19:43253690-43253712 AGAAGCTTTCTGTGTAAAGGAGG - Intronic
926454792 2:13053751-13053773 ACATATTTACAGTTTAAAGATGG + Intergenic
926853883 2:17231010-17231032 AACAGTTTTCAAATTAAAGGTGG - Intergenic
928267281 2:29822371-29822393 ACAAGTTTTCAGGTGGGAGGAGG + Intronic
931164689 2:59733752-59733774 AGAAGTTTCCAGTCCAAAGGAGG + Intergenic
931181468 2:59905446-59905468 ACAAATTTTCAGCATAAAGCGGG - Intergenic
931985469 2:67737421-67737443 AGTAGTTTTCAGTGTACAGGTGG - Intergenic
932361258 2:71108194-71108216 ACAAGTTTACAGTTTACAGTTGG - Intergenic
934033971 2:88073135-88073157 ACATGTTTTCATTTTGAAGTGGG - Intronic
935536040 2:104295623-104295645 ACAAGGTTTGACTTTAAAGATGG - Intergenic
935980939 2:108626187-108626209 ATAATTTTTCAGTTAAAAGTTGG - Intronic
937612053 2:123873718-123873740 AAGAGTTTTCAGTCTAATGGAGG - Intergenic
937782973 2:125860417-125860439 ACATGTTCTCACTTTAAAGTGGG - Intergenic
939392899 2:141591711-141591733 ACAGGCTTTAATTTTAAAGGTGG + Intronic
939644590 2:144681774-144681796 AGAAGTTTTCAGTTTATTTGTGG + Intergenic
939977813 2:148739348-148739370 AGATATTTTCAGGTTAAAGGGGG - Intronic
940038776 2:149337624-149337646 ATAAGTTTTTTTTTTAAAGGGGG - Intronic
943611485 2:190039746-190039768 ACATGTTCTCACTTTAAAGTGGG - Intronic
944174594 2:196816054-196816076 AACAGATTTCAGTTTGAAGGTGG + Intergenic
944764154 2:202847997-202848019 ACATGTTTTCATTTTTAAGTGGG + Intronic
945012280 2:205478258-205478280 ACAGGTTTTCAGGGTAATGGGGG - Intronic
945385969 2:209201451-209201473 AAAAGTTGTAAGTTTAAAAGCGG - Intergenic
945442014 2:209890908-209890930 TGAAGTTGGCAGTTTAAAGGAGG - Intronic
945751153 2:213784755-213784777 ACAAGTTTCCAGTACAATGGAGG - Intronic
946571288 2:221026823-221026845 ACTGTTTTTAAGTTTAAAGGTGG + Intergenic
947291338 2:228578147-228578169 AAAAGTTTTCAGTATTAAGGAGG - Intergenic
1169228305 20:3869949-3869971 ACAAGTTTGCTGTTCAAAGTAGG - Exonic
1170779406 20:19410852-19410874 ACCAGTTTTTATTTTAAAGATGG - Intronic
1171953907 20:31444733-31444755 ACAAGTGTGCAGCTTAATGGAGG + Intronic
1173567217 20:44050356-44050378 ACAGGTTTTCAGTTTTATGTGGG - Intronic
1173775257 20:45700738-45700760 AGAAGTTTTCATTTTAAATCAGG + Intronic
1174170281 20:48613541-48613563 ACAGGTGTTCTGTTTAAATGAGG - Intergenic
1174377805 20:50138147-50138169 ACAAGTTTTCAACTTACAGAAGG - Intronic
1176720122 21:10385902-10385924 ACACGTTTTCATTTAAAAGTGGG + Intergenic
1177690905 21:24506093-24506115 ACATGTTTTCACTTAAAAGTGGG - Intergenic
1178725048 21:35044051-35044073 ACAAGTTTTGATTTTAAATATGG - Intronic
1179601642 21:42481625-42481647 AGAAGTTTTGAGTTTTAAGGAGG - Intronic
1180301326 22:11038679-11038701 ACACGTTTTCATTTAAAAGTGGG + Intergenic
1180582135 22:16848114-16848136 ACATGTTTTCACTTAAAAGTGGG + Intergenic
1185257363 22:49842506-49842528 AAAAGTTTTTAGTTTTAATGAGG - Intergenic
949689302 3:6616821-6616843 ACAATTTCTCAATTTAAATGAGG + Intergenic
951704829 3:25533751-25533773 ACAAAGTTTAAGTTTAAAGCAGG + Intronic
952124589 3:30285577-30285599 GCAAGTATTCAGTTGAAAGAAGG + Intergenic
953679563 3:45029243-45029265 ATAATTTGTCAGTTTAGAGGAGG - Intronic
954009383 3:47621569-47621591 ACATGTTCTCAGTTTTAAGTGGG + Intronic
955034527 3:55253567-55253589 ATGAGTTTTCAGATTGAAGGAGG + Intergenic
956313316 3:67906227-67906249 ACAGGATTTTATTTTAAAGGTGG + Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956885924 3:73559686-73559708 ATAAGTTTACACTTTAAAAGAGG + Intronic
956929249 3:74024031-74024053 ACAAGTTTCAAGGCTAAAGGTGG + Intergenic
957494424 3:80972794-80972816 ACATGTTTTCACTTTTAAGTGGG + Intergenic
957997758 3:87711876-87711898 ACATGTTTTCATTTTGCAGGAGG - Intergenic
958259655 3:91365959-91365981 ACAAGTCCTCAGTTTAGAGAAGG + Intergenic
958559591 3:95728676-95728698 GCAAGTTTTCACTTAAAAGTGGG - Intergenic
958763093 3:98331503-98331525 TCAAGTTTTCAGTTTAAGTCCGG - Intergenic
959845251 3:111025006-111025028 ACAAGATTTTGGTTTAAAGTAGG + Intergenic
962041930 3:131716582-131716604 ACATGTTTTCAGAACAAAGGGGG - Intronic
962546528 3:136441493-136441515 AAAAGTTTTTAGTTTAGAAGAGG + Intronic
963329521 3:143898650-143898672 ACATGTTTTCAGTTATAAGTGGG + Intergenic
964385128 3:156139205-156139227 AAAAGATCCCAGTTTAAAGGTGG - Intronic
964616873 3:158675310-158675332 ACAAGTTTTCAAGATAAAAGAGG + Intronic
964838711 3:160970348-160970370 ATAAGTTCTCAGTTTATAAGTGG - Intronic
966439466 3:179927837-179927859 ACTAGTTTGCTGTTTAAATGGGG + Intronic
967265812 3:187691308-187691330 AAAAGGTTACAGTTTGAAGGAGG - Intergenic
967437110 3:189460422-189460444 ACAGGCTTTCAAGTTAAAGGAGG - Intergenic
968464579 4:744201-744223 GGAAGTTTTCATTTTAAAAGCGG + Intronic
969096401 4:4735937-4735959 CCAAGTTTCTGGTTTAAAGGGGG - Intergenic
969902981 4:10367116-10367138 ACAAGTCTTCTGTCTAAAGCTGG + Intergenic
970045722 4:11850969-11850991 ACATGTTTTCACTTTTAAGTGGG + Intergenic
971650146 4:29261022-29261044 ACAAGTTCATAGTTTAATGGGGG - Intergenic
973752746 4:54039704-54039726 ACAAGTTTTCATTTTTAGGAAGG - Intronic
975151280 4:71023823-71023845 ACAAGTTTCTAATTTAGAGGTGG - Intronic
976761939 4:88558625-88558647 AAAAGTTTTCAGGATACAGGTGG - Intronic
976797548 4:88951375-88951397 ACAACTTCTCATTTTAAAGCAGG + Intronic
977229770 4:94437975-94437997 ACAGTTTTTGGGTTTAAAGGTGG - Intergenic
977475196 4:97498234-97498256 ACAAGTTCTCTATTTAAAGGTGG - Intronic
980245619 4:130236309-130236331 AGAAGTTGTCATTTTAAAGATGG - Intergenic
981632739 4:146839818-146839840 ACAAGTGCTCAAGTTAAAGGAGG - Intronic
982138424 4:152294914-152294936 CCTAGTTTCCAGTTTAAAGATGG - Intergenic
982699092 4:158639431-158639453 ACAAACTTTCAGTTTATAGCTGG - Intronic
983536482 4:168862722-168862744 ACAAGTTTTCTGTCTTCAGGAGG + Intronic
983850892 4:172579764-172579786 ACAACTTTAGAGTTTAAATGAGG + Intronic
989961635 5:50422710-50422732 AAAAGTTTAAAGTTTAAAGTGGG + Intronic
990114789 5:52376363-52376385 ATAACTTTTCAGTTTATATGAGG + Intergenic
990913052 5:60873045-60873067 ACAAAATTTCAGTTAAAAAGGGG + Intergenic
991200071 5:63981026-63981048 ACAAGTTTCCAGTTCCAAGATGG - Intergenic
991310456 5:65235103-65235125 ACAAGCTTTCAGTTATAAGAGGG + Intronic
991728380 5:69559613-69559635 AGAAGTTTGCAGTTTAAAATAGG - Intergenic
991804809 5:70414760-70414782 AAAAGTTTGCAGTTTAAAATAGG - Intergenic
991866575 5:71068262-71068284 AAAAGTTTGCAGTTTAAAATAGG + Intergenic
992110508 5:73488293-73488315 AGAAGTTCTTAGTTTAATGGAGG - Intergenic
993687854 5:90962081-90962103 ACAAGTTTTAAATTTAAATTGGG - Intronic
993763742 5:91830215-91830237 AAAAGTTTTCATGTTTAAGGTGG + Intergenic
993780253 5:92057462-92057484 AGAAGTTTTCAGTTTTAAGAAGG + Intergenic
994596312 5:101841416-101841438 AAAAGTTTTCAATTCAAAGAAGG + Intergenic
995708197 5:115007258-115007280 ACAATTTTTCAGTTTTACAGTGG - Intergenic
996640632 5:125748032-125748054 AAAACTTTTCTGGTTAAAGGGGG - Intergenic
997125630 5:131224190-131224212 ATGAGTTTTCAGATTAGAGGTGG - Intergenic
997774066 5:136583422-136583444 ACAAGTTTTCACTTATAAGTGGG + Intergenic
998974939 5:147635241-147635263 ACACATTTTCAGTTCAAAGGTGG - Intronic
999786915 5:154899099-154899121 ACAAGTAATAAGTTTAGAGGTGG - Intronic
1000573628 5:162947650-162947672 ACCAGATTTCTGATTAAAGGTGG + Intergenic
1000623285 5:163509285-163509307 TCAAGTTTTCTTTTTTAAGGGGG + Intronic
1000847061 5:166294865-166294887 CAAAGTATTCAGTTTTAAGGAGG - Intergenic
1001291607 5:170466874-170466896 ACAAGTATTCAGTCTATAGCAGG + Intronic
1003793609 6:9575105-9575127 GCAAGTATTCAGCTTAAAGTGGG + Intergenic
1004601818 6:17157702-17157724 ACATGTTCTCAGTTTTAAGCAGG - Intergenic
1008461656 6:51781404-51781426 ACAAATTTTCATTTTTAATGAGG + Intronic
1008995579 6:57654403-57654425 ACAAGTCCTCAGTTTAGAGAAGG - Intergenic
1009184107 6:60553180-60553202 ACAAGTCCTCAGTTTAGAGAAGG - Intergenic
1009639582 6:66316260-66316282 AATAGTTTTAAATTTAAAGGAGG + Intergenic
1011741797 6:90368848-90368870 ATAGGTTTACAGTTTGAAGGGGG + Intergenic
1012057373 6:94430111-94430133 ACAATATTTAAGATTAAAGGAGG - Intergenic
1012081559 6:94764168-94764190 ACAAGTTTTCATGTTAAAAATGG + Intergenic
1012358209 6:98342826-98342848 ACAAGGTTTCAGGTTCAGGGTGG - Intergenic
1012488492 6:99749841-99749863 GCATGTTTTCAGTTTTAATGGGG + Intergenic
1013223255 6:108098919-108098941 ACATGTTTTCACTTTTAAGTGGG + Intronic
1014903374 6:126996507-126996529 ACAAGTTGTCAGTTTACATTAGG + Intergenic
1018690953 6:166343522-166343544 AAAATCTTTCAGTTAAAAGGTGG + Intergenic
1022051099 7:26673207-26673229 ACAAGGTTTCAGGTACAAGGAGG + Intronic
1023543524 7:41293088-41293110 ACTAGTTTACAGTTCCAAGGTGG - Intergenic
1023837131 7:44074718-44074740 AAAAGTTTAAAATTTAAAGGGGG - Intronic
1027475025 7:78618912-78618934 ACAAAGTTTCAGTTAGAAGGAGG + Intronic
1027995440 7:85420164-85420186 ACAACTTTTCAGGTAAAAGTTGG + Intergenic
1028067847 7:86410537-86410559 ACAAGTTTTGAGGTAAATGGAGG + Intergenic
1028083467 7:86605594-86605616 ACATGTTTTCACTTAAAAGTGGG + Intergenic
1028524995 7:91774313-91774335 ACAAGTTGTCTTTTGAAAGGAGG + Intronic
1028742540 7:94292221-94292243 ATCTGTTTTCAGTTTCAAGGAGG - Intergenic
1030760200 7:113341317-113341339 AAAGGTTTTCATTTGAAAGGAGG - Intergenic
1030786402 7:113668723-113668745 ACATGTTTTCACTTAAAAGTGGG + Intergenic
1030864299 7:114679901-114679923 TCAAGTTTTCAGTCTAATAGAGG - Intronic
1031279958 7:119786465-119786487 ATAAGTTTTCACTTTAAAGTGGG - Intergenic
1032573700 7:133029351-133029373 ACAAGCTTTCAGTTATAAGATGG - Intronic
1033672370 7:143505314-143505336 ACAAGTGGACAGTTAAAAGGGGG - Intergenic
1034641926 7:152611058-152611080 ACAATTTTACAGTCTAAATGTGG - Intergenic
1036056987 8:5266254-5266276 TGAAGATTTCACTTTAAAGGTGG - Intergenic
1036408558 8:8477672-8477694 ACAAGTCTTAACTTGAAAGGGGG - Intergenic
1039352056 8:36773687-36773709 ACAACTTTTCCTTATAAAGGGGG + Intergenic
1041173040 8:55164647-55164669 ACATGTTTTAAGTTTACAGGGGG + Intronic
1041407830 8:57519731-57519753 ACAAAATTTCAGTTTAGGGGAGG - Intergenic
1043281416 8:78471277-78471299 TCAAATTTTCAATTTAAAGGAGG - Intergenic
1043326266 8:79055631-79055653 ACTATTTTGGAGTTTAAAGGAGG - Intergenic
1043596084 8:81886699-81886721 AATAGTTTTCATTATAAAGGTGG + Intergenic
1043609927 8:82050034-82050056 AGAAGTTTTCTGTTTAAACTTGG - Intergenic
1043984812 8:86681592-86681614 ACAAGTCTTCAGATTCAAAGAGG + Intronic
1044108509 8:88242021-88242043 TCAATTTTTCAGTTTAAATGAGG + Intronic
1044425978 8:92050756-92050778 TCAAGTTATCCTTTTAAAGGGGG + Intronic
1045565928 8:103315243-103315265 ACAAGTCATCAGTATAAAAGTGG - Intronic
1046814545 8:118569968-118569990 CCAATTTTTCAGTTTAAGTGAGG + Intronic
1047101763 8:121684360-121684382 ACAAGTTTACAGTTTGGAAGGGG - Intergenic
1047793724 8:128232804-128232826 CCAGGTTTTTTGTTTAAAGGTGG + Intergenic
1048708333 8:137179974-137179996 ATAAGTTATCAGCTCAAAGGAGG + Intergenic
1050751073 9:8938029-8938051 ACAAGTTTACAGTTTAGAAAAGG + Intronic
1051263234 9:15286273-15286295 AAAATGTTTCAGATTAAAGGAGG - Intronic
1052037417 9:23698402-23698424 ATAAGGGTTAAGTTTAAAGGTGG - Intronic
1052040905 9:23737952-23737974 ACAAGTTTTCGTTACAAAGGGGG + Intronic
1052981486 9:34453159-34453181 ATGACTTTTCAGTTTAAGGGTGG - Intronic
1055141520 9:72882180-72882202 ACAGGTTTTCAGTTGAAAGGGGG - Intergenic
1056194468 9:84215848-84215870 ACTTGGTTTCAGTTCAAAGGAGG + Intergenic
1056274297 9:84978117-84978139 CCAAGTTTTCAAGTGAAAGGAGG + Intronic
1057027760 9:91747957-91747979 ACAAAATTTCAGTTAGAAGGAGG + Intronic
1058138269 9:101331238-101331260 ACAAGTTTTTAGTTTGAAATAGG + Intergenic
1059210217 9:112507372-112507394 ACAAGTTTTCAGTCTAATCCAGG + Intronic
1061602756 9:131682521-131682543 TCTAGTTTTAAGTTTAAAAGGGG + Intronic
1185540777 X:901600-901622 ACATGTTTTCATTTAAAAGTGGG - Intergenic
1186098922 X:6134082-6134104 ACAAGTATTTAGCTAAAAGGGGG - Intronic
1186661113 X:11667757-11667779 ACAAGTTTCCAGTTTCCTGGAGG - Intergenic
1187400743 X:18957828-18957850 ACAGGTTTTCTTTTTGAAGGTGG + Intronic
1187705757 X:22007806-22007828 AAAAGATTCCAGATTAAAGGAGG + Intergenic
1188930824 X:36109027-36109049 ACATGTTCTCACTTTAAAGTGGG - Intronic
1191732856 X:64355872-64355894 ACAAGTTGATACTTTAAAGGAGG + Intronic
1193665204 X:84308041-84308063 ACATGTTTTCACTTTCAAGTGGG - Intergenic
1193862127 X:86682030-86682052 AAAAGACTTCACTTTAAAGGAGG + Intronic
1193881573 X:86929324-86929346 AGAAATTTTCAGTATAAAGAAGG - Intergenic
1194154424 X:90369741-90369763 ACATGTTTTCACTTAAAAGTGGG - Intergenic
1194260972 X:91695224-91695246 GCATGTTTTCACTTTAAAGGGGG - Intergenic
1195034418 X:100959214-100959236 ACTAGCTTTTAGTTTAAAGATGG + Intergenic
1195564900 X:106329489-106329511 ACTAGTTTGTAGTTTAAAGATGG + Intergenic
1196324453 X:114386029-114386051 AGCAGTTTTAAGTTTATAGGAGG + Intergenic
1196841033 X:119859400-119859422 AAAAGTTTTTAGTTTAAAATTGG + Intergenic
1196930862 X:120680872-120680894 ACAATTTTATAGTTTTAAGGTGG + Intergenic
1197315768 X:124964211-124964233 ACCAGTTTTCATTTCAAATGTGG - Intergenic
1198681616 X:139188950-139188972 ACAAGTTTACAGTATAGTGGGGG + Intronic
1199536260 X:148906465-148906487 ACAAGCTCTGTGTTTAAAGGAGG - Intronic
1199728616 X:150608746-150608768 ACAAAATTTCAGTTAATAGGAGG - Intronic
1199796833 X:151206610-151206632 ACACGTTTTCAGTTATAAGTGGG - Intergenic
1199812415 X:151363415-151363437 ACAAACTTTCAGTTTGAAGGTGG - Intergenic
1200500778 Y:3946634-3946656 ACATGTTTTCACTTAAAAGTGGG - Intergenic
1200579623 Y:4934026-4934048 GCATGTTTTCACTTTAAAGTGGG - Intergenic