ID: 1150047409

View in Genome Browser
Species Human (GRCh38)
Location 17:61927271-61927293
Sequence CGGGTAAAAAGCAGATGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150047399_1150047409 29 Left 1150047399 17:61927219-61927241 CCAGATTCAAGGCTCTGGAGGCC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1150047409 17:61927271-61927293 CGGGTAAAAAGCAGATGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 98
1150047400_1150047409 8 Left 1150047400 17:61927240-61927262 CCACAACACTATCCTATGTCCCC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1150047409 17:61927271-61927293 CGGGTAAAAAGCAGATGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 98
1150047402_1150047409 -4 Left 1150047402 17:61927252-61927274 CCTATGTCCCCTGTGTTACCGGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1150047409 17:61927271-61927293 CGGGTAAAAAGCAGATGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150047409 Original CRISPR CGGGTAAAAAGCAGATGTGT GGG Intronic
903324069 1:22559629-22559651 CTGGTAGAAGACAGATGTGTAGG - Intergenic
906467789 1:46099420-46099442 GGGGTAAAAAGCAGTGGTGGAGG - Intronic
907359829 1:53905565-53905587 CTGTTAAAACGCAGATGTCTGGG + Intronic
909666246 1:78136419-78136441 AGGGTAAAAAAGAGATGGGTAGG + Exonic
912183378 1:107245692-107245714 AGGGTGAAAAGCAAATGCGTAGG + Intronic
915790724 1:158667838-158667860 AAGGTAAAAAGCAGAGGTTTTGG - Exonic
916376927 1:164165572-164165594 CTGGGAAATAGCAGATATGTAGG + Intergenic
916926530 1:169527243-169527265 CAGTTAAAATGCAGATGTGAAGG - Intronic
923052114 1:230396254-230396276 GGGGTAAAAAGGAGGAGTGTGGG - Intronic
1064950242 10:20840449-20840471 CAGGTAAAAGGCAGATGATTGGG - Intronic
1065730626 10:28706691-28706713 GGAGAAAAAGGCAGATGTGTTGG + Intergenic
1066305367 10:34135274-34135296 TGGGTACAAAGCCAATGTGTTGG - Intronic
1070643838 10:78187739-78187761 GGGGTAAACACCATATGTGTAGG - Intergenic
1073985096 10:109199134-109199156 TGGGCAGAAAGCAGAAGTGTGGG + Intergenic
1078385006 11:10882427-10882449 GGGGTAAAAAGGAGATGGGAGGG - Intergenic
1078538631 11:12195782-12195804 CGAGTGAAAAGCCCATGTGTGGG + Intronic
1079470961 11:20776928-20776950 CCTGTAAAATGGAGATGTGTTGG + Intronic
1081951774 11:47050595-47050617 GGGGGAAAAAGCTGATGTCTAGG - Intronic
1084377973 11:68791419-68791441 CATGTGAAAAACAGATGTGTTGG - Intronic
1084381868 11:68817816-68817838 CGGGTCAAAAGCAGGTGTCTGGG + Intronic
1084539152 11:69775601-69775623 TGGCTGAAAAGCAGAAGTGTAGG - Intergenic
1090996099 11:131867156-131867178 AGCGTAAATAGCAGATGGGTAGG - Intronic
1098999982 12:77168161-77168183 TGGGAAAGAAGCACATGTGTAGG - Intergenic
1104074456 12:125377009-125377031 CTGGTAAAATGCAGATCTCTTGG + Intronic
1105572611 13:21618173-21618195 CATGTAAAAATCAGATGTTTAGG - Intergenic
1109491775 13:63110582-63110604 CTGATAGAAAGCAGATGAGTTGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1118017733 14:61676779-61676801 CAGTTAAAAAGCAGCTCTGTAGG - Intergenic
1123675637 15:22708504-22708526 CAGGTGAAAAGCAGGGGTGTGGG + Intergenic
1123735350 15:23178454-23178476 CAGGTGAAAAGCAGGGGTGTGGG - Intergenic
1124285856 15:28399753-28399775 CAGGTGAAAAGCAGGGGTGTGGG - Intergenic
1124296846 15:28511911-28511933 CAGGTGAAAAGCAGGGGTGTGGG + Intergenic
1124327631 15:28781449-28781471 CAGGTGAAAAGCAGGGGTGTGGG + Intergenic
1124405626 15:29389357-29389379 TGGGGAGAAAGCAGATGTTTTGG - Intronic
1125439097 15:39682386-39682408 AGTGTTAAAAGCAAATGTGTGGG - Intronic
1131200983 15:90395619-90395641 CGGCTAAAGAGCAGTTGTATAGG + Intronic
1131226611 15:90629330-90629352 AGGGTGAAGAGCAGATGCGTTGG - Exonic
1131902443 15:97103318-97103340 CTGGTAAAAAGCAGGCGGGTAGG - Intergenic
1132890965 16:2204616-2204638 GGGGTAAAAGGCAGATGACTGGG + Intronic
1137034009 16:35553186-35553208 CGGGTAAAGAGAGGATGTGGCGG - Intergenic
1138458534 16:57134611-57134633 GAGGTGAAAAGCAGATGTGGGGG + Intronic
1139016243 16:62692377-62692399 ACGGTAAAAAGCAAATGTTTGGG + Intergenic
1150047409 17:61927271-61927293 CGGGTAAAAAGCAGATGTGTGGG + Intronic
1153982446 18:10321807-10321829 TGGGTAAGAAGCAGCTGTGATGG + Intergenic
1159751964 18:72313717-72313739 AGGTTAAAAAGTACATGTGTAGG - Intergenic
1160084294 18:75760470-75760492 TGGCAAAATAGCAGATGTGTAGG - Intergenic
1164450668 19:28361283-28361305 TGGGTAAAATATAGATGTGTAGG - Intergenic
1164967126 19:32495042-32495064 TGGGTGGAAATCAGATGTGTGGG + Intergenic
926278234 2:11422594-11422616 GGGGGCAAAAGCAGATGAGTTGG - Intergenic
926736850 2:16080071-16080093 AGGATACAAAGCAGATGCGTTGG - Intergenic
928294360 2:30069962-30069984 GTGGTAAAGAGCAGATTTGTGGG + Intergenic
930894655 2:56431292-56431314 GTGGTAAACAGCAGGTGTGTGGG - Intergenic
933140188 2:78782946-78782968 AGATTAATAAGCAGATGTGTAGG - Intergenic
941214798 2:162693092-162693114 GGGGAAAAAAGAAGATGTTTTGG + Intronic
941759763 2:169228935-169228957 CGGGTAAAAATCAGAGGACTGGG + Intronic
948342868 2:237269229-237269251 AGGGAAAAGAGCAGAGGTGTGGG - Intergenic
948353892 2:237361904-237361926 AGGGTCAAAATCGGATGTGTGGG + Intronic
1170146834 20:13184724-13184746 ATGGCAAAAAGCAGAAGTGTGGG - Intergenic
1170710380 20:18785489-18785511 CAGGGAAACTGCAGATGTGTGGG - Intergenic
1170966181 20:21073782-21073804 CGGGTAAAAACCACATATCTAGG + Intergenic
1178077647 21:29026517-29026539 AAGGTAAAATGCAGATGTTTGGG - Intronic
1178428678 21:32500075-32500097 GGGGTAGAAAGCAGAAGAGTAGG + Intronic
1203325060 22_KI270738v1_random:5200-5222 CGGGTAAAAAGCCGCGGTGATGG + Intergenic
955872132 3:63450558-63450580 TGGGTTATAAGCAGATGTCTAGG + Intronic
962134364 3:132718690-132718712 TGGCTAAAATGCAGATGTGCTGG + Intronic
980501240 4:133656840-133656862 GGGGTAAAAACCAAAAGTGTGGG - Intergenic
982082706 4:151806118-151806140 CGGCTTAAAACCAGAAGTGTAGG - Intergenic
986298111 5:6456183-6456205 CAGGTCAAAAGCAAATGTGAAGG - Intronic
998205547 5:140154593-140154615 CAGTTAAAAAGCAGAGGAGTCGG - Intergenic
998598677 5:143561711-143561733 CGGTTAAAGAGCAGGTCTGTAGG - Intergenic
1005773227 6:29098669-29098691 CTGCTAAAAAGCAGATCTTTTGG + Intergenic
1005779212 6:29170862-29170884 CTGCTAAAAAGCAGATCTTTTGG + Intergenic
1011192450 6:84745284-84745306 CTGGTAATAAGCAGATGGGATGG - Intronic
1014063008 6:117094723-117094745 TGTGAAAAAAGCAGATGTATTGG + Intergenic
1020068682 7:5210934-5210956 CGCGGAGAAAGCACATGTGTGGG - Intronic
1020154521 7:5711675-5711697 CAGGTAAACAGCAGATATTTGGG + Intronic
1021135140 7:16956223-16956245 TGGGTCAAAGTCAGATGTGTTGG - Intergenic
1021489762 7:21206844-21206866 CTGGTAAAAAGAAGCTGGGTGGG - Intergenic
1026339345 7:69421899-69421921 CGGGGAACAACCAGCTGTGTTGG - Intergenic
1031071796 7:117169994-117170016 CGGGTTAAAAGAAAATTTGTAGG - Intronic
1031973480 7:128079654-128079676 CGCGTTAAAGGCAGAAGTGTGGG + Intronic
1032549492 7:132771381-132771403 CAGATACAAAGCAGATGGGTGGG - Intergenic
1034260019 7:149749408-149749430 CTGGAAGAAAGCAGTTGTGTGGG + Intergenic
1047314232 8:123717659-123717681 CGGCTAATAAGCAGTTGTGCTGG - Intronic
1053913581 9:42928601-42928623 TGGGTAAAAGGCAGGTGTGGGGG + Intergenic
1057933925 9:99221283-99221305 CAGTTAAAATGCAGATGTCTGGG + Intronic
1058808370 9:108615355-108615377 GGGGTAAAAAGGGGATGTGGTGG - Intergenic
1059793158 9:117662748-117662770 GGGGTAGATAGCAGATCTGTGGG - Intergenic
1060156561 9:121324455-121324477 CTGGTAACAGGGAGATGTGTAGG + Intronic
1060258454 9:122053180-122053202 CGGGGTAGAGGCAGATGTGTGGG + Intronic
1060789213 9:126474538-126474560 TGGGTAGAAAGCTGATCTGTGGG - Intronic
1060921783 9:127425467-127425489 GGGGTGAACAGCAGAGGTGTTGG - Intronic
1062440395 9:136567027-136567049 CGGGAAAAAGGCAGATATGCGGG + Intergenic
1186410592 X:9342256-9342278 AGGGTAAAAAGCAGAGGGGGAGG - Intergenic
1186410639 X:9342375-9342397 AGGGTAAAAAGCAGAGGGGGAGG - Intergenic
1192771814 X:74200894-74200916 CGGGTAGAAAGCATATATTTGGG + Intergenic
1194365891 X:93012922-93012944 AGGGAAAAAAGCAAATGTGAAGG - Intergenic
1197698533 X:129577190-129577212 CGGATAAAATGCAGATCTGTAGG - Intronic
1199150153 X:144422533-144422555 CTGGTAATATGAAGATGTGTAGG - Intergenic
1200420524 Y:2960551-2960573 AGGGTAAAAACGAGATATGTAGG + Intronic
1200674113 Y:6129190-6129212 AGGGAAAAAAGCAAATGTGAAGG - Intergenic