ID: 1150047493

View in Genome Browser
Species Human (GRCh38)
Location 17:61927805-61927827
Sequence GGTCCCGGCGTCTGAGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150047493_1150047498 1 Left 1150047493 17:61927805-61927827 CCAAGAACTCAGACGCCGGGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1150047498 17:61927829-61927851 ACCGGGTTGTCGATACAAAGTGG 0: 1
1: 0
2: 0
3: 0
4: 14
1150047493_1150047505 13 Left 1150047493 17:61927805-61927827 CCAAGAACTCAGACGCCGGGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1150047505 17:61927841-61927863 ATACAAAGTGGGAAGGATGGGGG 0: 1
1: 0
2: 0
3: 30
4: 380
1150047493_1150047502 10 Left 1150047493 17:61927805-61927827 CCAAGAACTCAGACGCCGGGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1150047502 17:61927838-61927860 TCGATACAAAGTGGGAAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 147
1150047493_1150047501 6 Left 1150047493 17:61927805-61927827 CCAAGAACTCAGACGCCGGGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1150047501 17:61927834-61927856 GTTGTCGATACAAAGTGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 64
1150047493_1150047503 11 Left 1150047493 17:61927805-61927827 CCAAGAACTCAGACGCCGGGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1150047503 17:61927839-61927861 CGATACAAAGTGGGAAGGATGGG 0: 1
1: 0
2: 0
3: 4
4: 102
1150047493_1150047500 2 Left 1150047493 17:61927805-61927827 CCAAGAACTCAGACGCCGGGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1150047500 17:61927830-61927852 CCGGGTTGTCGATACAAAGTGGG 0: 1
1: 0
2: 0
3: 0
4: 16
1150047493_1150047506 26 Left 1150047493 17:61927805-61927827 CCAAGAACTCAGACGCCGGGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1150047506 17:61927854-61927876 AGGATGGGGGCACCACACAAAGG 0: 1
1: 0
2: 1
3: 19
4: 198
1150047493_1150047504 12 Left 1150047493 17:61927805-61927827 CCAAGAACTCAGACGCCGGGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1150047504 17:61927840-61927862 GATACAAAGTGGGAAGGATGGGG 0: 1
1: 0
2: 2
3: 21
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150047493 Original CRISPR GGTCCCGGCGTCTGAGTTCT TGG (reversed) Intronic