ID: 1150060230

View in Genome Browser
Species Human (GRCh38)
Location 17:62061670-62061692
Sequence CAATGAAAGAAAAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1559
Summary {0: 1, 1: 0, 2: 10, 3: 166, 4: 1382}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150060226_1150060230 17 Left 1150060226 17:62061630-62061652 CCACTTAACGATTAAAATAACTC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1150060230 17:62061670-62061692 CAATGAAAGAAAAAGGAGGCTGG 0: 1
1: 0
2: 10
3: 166
4: 1382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150060230 Original CRISPR CAATGAAAGAAAAAGGAGGC TGG Intronic
900153791 1:1195286-1195308 AACAGAAAGAAAAAGGAGGCCGG - Intronic
900253832 1:1686297-1686319 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
900262831 1:1741077-1741099 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
900571822 1:3362420-3362442 CAAGGAAATATAAAGGAGGCTGG + Intronic
900655964 1:3757360-3757382 AAATGAAAGAAAGAAAAGGCTGG + Intronic
900699532 1:4036053-4036075 CAATGAAAAAAAAAGTATTCAGG + Intergenic
900702286 1:4055787-4055809 CAGGGAGAGAAACAGGAGGCAGG - Intergenic
900848703 1:5124704-5124726 AAATGAAAGAATATGAAGGCAGG + Intergenic
901305707 1:8231319-8231341 CAAAGAAAGAAAAACCAGGCAGG - Intergenic
901432022 1:9222281-9222303 CAAAGAAAAAAAAATGAGCCAGG - Intergenic
901485644 1:9559002-9559024 TAAAGGAACAAAAAGGAGGCTGG - Intronic
901693880 1:10992120-10992142 CAAAGAAAGAAAAGGAAGGAAGG + Intergenic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902046332 1:13527394-13527416 TAAAGAAAAAAAAAGGGGGCCGG + Intergenic
902046442 1:13528267-13528289 CAAAGGAAGAGAAAAGAGGCTGG - Intergenic
902388532 1:16089487-16089509 AAAAGAAAGAAATTGGAGGCCGG + Intergenic
902401998 1:16162907-16162929 AAAATAAAGAAAAAGGGGGCCGG + Intergenic
902550894 1:17219011-17219033 CACTGAAAGAGAAAAGAGCCTGG + Intronic
902907629 1:19570337-19570359 AAAAGAAAAAAAAAGAAGGCGGG - Intergenic
902929843 1:19723350-19723372 CATCGAAGGAGAAAGGAGGCAGG - Intronic
902945883 1:19838255-19838277 GAAGGAAGGAAAAAGGAGGAAGG - Intergenic
902961236 1:19964174-19964196 CTCTAAAAGATAAAGGAGGCAGG + Intergenic
903075903 1:20765994-20766016 CAAAACAAGAAAAAGGAGCCAGG + Intronic
903604052 1:24561918-24561940 AAAAAAAAGAAAAAGGAGGGAGG + Intronic
904014295 1:27408150-27408172 GAAGGAAAGAAAAAGAAGGTGGG + Exonic
904026780 1:27508959-27508981 AAAGGAAACAAAAAGGAGCCAGG - Intergenic
904073216 1:27818080-27818102 GAAAGAAAGAAAAAGGAGTTAGG + Intronic
904165291 1:28550712-28550734 AAAGAAAAGAAAAAAGAGGCTGG + Intergenic
904214330 1:28907361-28907383 TATTGAAAAAAAAAGAAGGCCGG - Intronic
904580245 1:31537941-31537963 GACTGAAAGAAAAAATAGGCCGG - Intergenic
905079638 1:35306484-35306506 AAATGAAACAAAAAGAAGGTAGG - Intronic
905566768 1:38971799-38971821 AAAGAAAAGAAAAAGGAGGCCGG + Intergenic
905744093 1:40399116-40399138 CAATGAAATAAAAAAGAGACAGG - Intronic
906124377 1:43418317-43418339 AAAGGAAGGAAAAAGGAGGCTGG + Intronic
906250545 1:44307681-44307703 CAAAGGAGGAAAGAGGAGGCTGG + Intronic
906800815 1:48735474-48735496 GAAGGAAGGAAAAAGGAGGAAGG + Intronic
907672463 1:56488401-56488423 CACCAAAAGAAAAAGGAGACTGG - Intergenic
907676462 1:56521933-56521955 CCATCAAAGCAAAAGGAGACAGG + Intronic
908225118 1:62048248-62048270 CAAAGAAAGAAAGAAAAGGCCGG + Intronic
908394116 1:63709548-63709570 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
908632234 1:66121981-66122003 GAAAGGAAGAAAAAGGAGGAAGG - Intronic
908912425 1:69087703-69087725 CAAGGAAAGAAAAATGAGAAAGG - Intergenic
909308490 1:74114088-74114110 CAATAAGAGCACAAGGAGGCAGG + Intronic
909367208 1:74840571-74840593 GACTGAAATAAAAAGGAAGCTGG + Intergenic
909859310 1:80584673-80584695 CAATGAAAGACATAGGACCCTGG + Intergenic
910006123 1:82399128-82399150 CAAAGAGAGAAAAAGCAAGCAGG - Intergenic
910212629 1:84809097-84809119 ATATGAAAGAAAAAGGGGGAGGG - Intergenic
910540474 1:88350444-88350466 AAAAGAAAGAAAAAGAAGGAAGG + Intergenic
910691422 1:89969372-89969394 AAATGAAAGAACAAGGATGTGGG - Intergenic
910881050 1:91922704-91922726 CTATGAAGAAAAAAGAAGGCTGG - Intergenic
910896888 1:92079299-92079321 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
910905560 1:92173973-92173995 CTATGAAGGAAAAATGAAGCAGG - Intronic
910952408 1:92664908-92664930 TAAAGAAAGAAAAAAGTGGCTGG + Intronic
910963171 1:92783515-92783537 AAAGAAAAGAAAAAGAAGGCCGG + Intronic
911887646 1:103325024-103325046 CCATGAAAGAGAAATAAGGCTGG - Intergenic
912156473 1:106927269-106927291 AAAAGAAAGAAAAAGAAGGAAGG + Intergenic
912660449 1:111524323-111524345 ATAAGAAAGAAAAAGAAGGCCGG - Intronic
912800699 1:112718177-112718199 GAATGAAAGAAAGAGAAGGAAGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913120443 1:115735863-115735885 CAGTCAAAGAAAGAGCAGGCCGG + Intronic
913459186 1:119065383-119065405 AAATAAAAAACAAAGGAGGCAGG + Intronic
913557197 1:119979317-119979339 CAACAAATGAAAAAGAAGGCAGG + Intronic
913940395 1:125098321-125098343 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
913944220 1:125142552-125142574 AAAAGAAAGAAAAAGAAGGAAGG + Intergenic
913954971 1:143281206-143281228 CAAAGAAAGAAAAAGATGGAAGG - Intergenic
913982468 1:143534235-143534257 CAAAGAAAGAAAAAGATGGAAGG + Intergenic
914001244 1:143696562-143696584 AAAGAAAAGAAAAAGAAGGCCGG - Intergenic
914222992 1:145697029-145697051 AAATGAAACAAAAAGGAGGCTGG + Intronic
914230740 1:145763399-145763421 CAATAAAATAAAAATGGGGCTGG + Intronic
915036562 1:152932499-152932521 CAATGAAAGAAAAAAGAAGGTGG + Intergenic
915174591 1:154004363-154004385 AAAAGAAAAAAAAAGAAGGCCGG - Intronic
915178016 1:154033009-154033031 GAAAGAAAGAAAAAGAAGGAAGG + Intronic
915575727 1:156775332-156775354 AAAAGAAAGAAAAATGAGGCAGG - Intronic
915791515 1:158676972-158676994 GAATGAAAGAAAAAGTAGAATGG + Intronic
915901648 1:159850937-159850959 CAAAGAGAGAAGAAAGAGGCTGG + Intronic
915967854 1:160327559-160327581 AAATTAAAAAAAAAGGAGGCTGG + Intronic
916085943 1:161269570-161269592 TAATGATACAAAAAGGAGGCAGG + Intronic
916534864 1:165694211-165694233 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
916660299 1:166917311-166917333 CAATGAAATAAGAAAGTGGCTGG - Exonic
916685713 1:167143611-167143633 GAATGAAAAAAAAAAGAGGCCGG - Intergenic
916889486 1:169102638-169102660 CAATGGAAGACAAAGAGGGCTGG - Intergenic
916894515 1:169148630-169148652 CACTGACTGAAAAATGAGGCAGG + Intronic
916960569 1:169884014-169884036 AAATAAAAGAAATTGGAGGCTGG - Intronic
917120537 1:171641363-171641385 GAAGGAAAGAAAGGGGAGGCAGG + Intronic
917518614 1:175729609-175729631 GAATGAAAGAAAAGGAAGGGAGG - Intronic
917654896 1:177116544-177116566 CAATGAAGGAAAAGAGAGGGAGG - Intronic
917662542 1:177191430-177191452 GAGTGAAAGAAAAAAGAGGAGGG - Intronic
917820010 1:178753237-178753259 GAATGAAAGAATACGAAGGCAGG - Intronic
918129776 1:181616734-181616756 CAAACAAAAAAAAAGGAGGTGGG + Intronic
918193321 1:182197701-182197723 CCATGAAATAAACAGCAGGCTGG + Intergenic
918345033 1:183599847-183599869 CAAAAAAAGAAAAAGAGGGCAGG - Intergenic
918420088 1:184355311-184355333 CAATGAATGAAGAATGAGGGGGG + Intergenic
918452308 1:184671381-184671403 TAAAGAAAGAAAAAGGGGGATGG - Intergenic
918638779 1:186812655-186812677 CACAGAAAGAAAAATGAGGAGGG + Intergenic
918887455 1:190213756-190213778 AAATGAGAGAGAAAGGAGGGAGG + Intronic
919225904 1:194701202-194701224 TAATGAGAAAAAAAGGAGGAAGG - Intergenic
919295871 1:195699119-195699141 CAATGAAAGAAAAAGGCTTTAGG + Intergenic
919694634 1:200561799-200561821 AAAAGAAAGAAAAAGAAGGGTGG + Intronic
919868531 1:201802482-201802504 AAAGAAAAGAAAAAGGAGGCCGG + Intronic
919908843 1:202097498-202097520 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
919969092 1:202560655-202560677 CACTGAATGAGATAGGAGGCTGG - Intronic
920055334 1:203186796-203186818 CAATGAAGGAATCACGAGGCTGG + Intergenic
920079415 1:203361514-203361536 AAAAGAAAGAAAGAGGAGGAGGG - Intergenic
920125673 1:203692174-203692196 CAAAAAAAGAAAAAAAAGGCCGG - Intronic
920328698 1:205188079-205188101 CACTGAATGAAAAAGGAGCGGGG - Intronic
920439165 1:205967049-205967071 AAAAAAAAGATAAAGGAGGCTGG + Intergenic
920528666 1:206685879-206685901 CAGAGAGAGAAAAAGGAGGGAGG - Intronic
920628229 1:207625239-207625261 ATATGAAAAAAATAGGAGGCAGG - Intronic
920683390 1:208090333-208090355 AAATGAAACAAAAAGGAGGTGGG + Intronic
921015827 1:211189847-211189869 AAATGAAAGTAAGAGTAGGCCGG - Intergenic
921125834 1:212177207-212177229 TGATGAAAGAAAAAGCAGGCGGG + Intergenic
921350017 1:214225354-214225376 CCATGAAAGAAAGTGGGGGCAGG - Intergenic
921642494 1:217571935-217571957 GAAAGAAAGAAAAGGGAGGAAGG + Intronic
922165747 1:223114461-223114483 AAATGAAAGAAATAGGAAGAAGG + Intronic
923002855 1:230022142-230022164 AAATGAGAGGAAAAGGAGGATGG + Intergenic
923005003 1:230041534-230041556 CAATGATAGTAAAAGCTGGCTGG - Intergenic
923200544 1:231706734-231706756 CATTGAAAGAAAAATGATGGTGG + Intronic
923566567 1:235080880-235080902 AAAAGAAAGAAAAAGGAGGGAGG + Intergenic
923682507 1:236129443-236129465 CAAAGGGAGAGAAAGGAGGCAGG - Intergenic
923799458 1:237193167-237193189 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
923892889 1:238235349-238235371 CAATGATAGAGGCAGGAGGCAGG - Intergenic
923901213 1:238327658-238327680 CAAAGAAAGAAAGAGGGGGAGGG + Intergenic
923964547 1:239122802-239122824 CAATAAAAGAAAAAAAGGGCTGG + Intergenic
923985555 1:239377767-239377789 CAATGACCGACTAAGGAGGCAGG + Intergenic
924082779 1:240416566-240416588 CAAAGAATGGAAAGGGAGGCTGG - Intronic
924196509 1:241613146-241613168 TAATTAAATAAAAAGGAGGAAGG - Intronic
924202542 1:241674958-241674980 GAAGGAAAGAAAAAGAAGGGAGG - Intronic
924202557 1:241675028-241675050 GAAGGAAAGAAGAAGGAGGGAGG - Intronic
924304793 1:242676533-242676555 CAATGAAAAAAAAATGGAGCAGG + Intergenic
924315567 1:242791892-242791914 CACTGAAAGGAAAGGGAAGCTGG + Intergenic
924469399 1:244326981-244327003 CCATGAAGATAAAAGGAGGCTGG - Intergenic
924485259 1:244476780-244476802 AAATGAAAGAATAGAGAGGCAGG + Intronic
924745031 1:246824013-246824035 AAATAAAAGAAAAAGAAGGCTGG - Intergenic
924794475 1:247283230-247283252 CAAGGAGAGACTAAGGAGGCAGG - Intergenic
1063286119 10:4690482-4690504 AAAGGGAAGAAAAATGAGGCAGG + Intergenic
1063289948 10:4735049-4735071 GAAGGAAAAAGAAAGGAGGCAGG - Intergenic
1063659574 10:8024928-8024950 AAAAGAAAGAAAGAGGGGGCAGG + Intergenic
1063675767 10:8139779-8139801 AAAGGAAAGAAAAATGAGCCAGG + Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1064470019 10:15626513-15626535 AAAAGAAAGAGAAAGGAGGCCGG - Intronic
1064520944 10:16200184-16200206 AATTAAAAGAAAAAGGAGGCTGG + Intergenic
1064755201 10:18566937-18566959 GAATGAAATATAATGGAGGCTGG - Intronic
1064759081 10:18600326-18600348 CATAGAATGAAAAAAGAGGCCGG + Intronic
1064787595 10:18916215-18916237 CAATCAAACAAAGAGGAGGCAGG - Intergenic
1064799264 10:19050381-19050403 GAATAAAAAAAAAAGAAGGCCGG - Intronic
1064880511 10:20047651-20047673 CCATGTAAGGAAAGGGAGGCTGG - Intronic
1065095124 10:22272798-22272820 CAAACAAAAAAAAAGGAGGGTGG - Intergenic
1065097686 10:22297896-22297918 GAAAGAAAGAAAAGGGAGGAGGG - Intergenic
1065205360 10:23352292-23352314 CAAGGGAAGAAAAAAGAGTCAGG + Intergenic
1065246020 10:23758660-23758682 GAAAGAAAGAAAAAGGGGGAGGG - Intronic
1065263776 10:23954266-23954288 CAATGAAAGGGAAAGGGGGCCGG + Intronic
1065743735 10:28819682-28819704 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
1065745369 10:28836188-28836210 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1066371546 10:34822057-34822079 GAAGGAAAGAAAAAGAAGGGAGG + Intergenic
1066549188 10:36536465-36536487 CAATGAAAGAAAAAAAAGAAAGG - Intergenic
1066572526 10:36789172-36789194 CAATTAAAGAAAAATTGGGCCGG + Intergenic
1066951464 10:42122108-42122130 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1067113367 10:43416576-43416598 TAATAAAATAAAAAGCAGGCCGG + Intergenic
1067147302 10:43702924-43702946 CAAGGAAGGAAAGAGGAGGAAGG - Intergenic
1067302394 10:45023997-45024019 CATAGAAATAAAAATGAGGCCGG + Intergenic
1068015403 10:51510093-51510115 CAGTGAAAGGAAAGGGAGGTTGG - Intronic
1068201438 10:53788721-53788743 AAATGAAAGAGAAAGAAGGAAGG + Intergenic
1068209873 10:53907569-53907591 TAATGGAAGAAAAATAAGGCAGG - Intronic
1068396878 10:56473712-56473734 GAATGAAGGAATAAGGAGGTGGG + Intergenic
1068711769 10:60142664-60142686 CTATGAAACAAAAAGAAGTCTGG + Intronic
1068755471 10:60648139-60648161 AAAGGAAAAAAAAAAGAGGCTGG - Intronic
1068882200 10:62061967-62061989 GAAAGAAAGAAAAAGGAAGAAGG - Intronic
1068893438 10:62172815-62172837 AAAAGAAAGAAAAAGAAAGCTGG + Intergenic
1069015122 10:63420722-63420744 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1069190576 10:65482947-65482969 AAAAGAAAGAAAAAAGAGGAAGG - Intergenic
1069274257 10:66569289-66569311 CAATGAAAGAAAATAGAGGAGGG - Intronic
1069434327 10:68367686-68367708 GAAAGAAAGAAAAAGCAGGGAGG - Intronic
1069497122 10:68915419-68915441 AAATAAAAGAAAAAAAAGGCTGG + Intronic
1069615672 10:69804642-69804664 CAAAAAAAAAAAAAGGTGGCAGG - Intronic
1069639006 10:69943142-69943164 AGCAGAAAGAAAAAGGAGGCTGG - Intronic
1070006967 10:72433724-72433746 CAATGAAAGAAGTTGTAGGCTGG - Intronic
1070052559 10:72903522-72903544 AATTAAAAGAAAAAGGGGGCTGG - Intronic
1070180622 10:74009902-74009924 AAAAAAAAGAAAAAGGTGGCTGG - Intronic
1071300984 10:84256017-84256039 CAAAGAAAAAAAAAAAAGGCTGG - Intronic
1071452050 10:85804972-85804994 AAATGAAGGAAAAAAGAGGATGG + Intronic
1071591209 10:86875023-86875045 AAAAAAAAGAAAAAGGAGCCAGG - Intronic
1071888304 10:89974567-89974589 CAAAGAAATAATGAGGAGGCTGG + Intergenic
1071917449 10:90310646-90310668 CAATGAGAGCACATGGAGGCAGG + Intergenic
1072195498 10:93114444-93114466 CAATGGGAGAAAGAGGAGGAGGG - Intergenic
1072279157 10:93850566-93850588 AAATGATAGAGACAGGAGGCAGG + Intergenic
1072678977 10:97492172-97492194 AAATTAGAGAAAAATGAGGCCGG + Intronic
1072723073 10:97792633-97792655 AAAGGAAATAAACAGGAGGCTGG + Intergenic
1072918780 10:99558071-99558093 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1072974725 10:100047687-100047709 CAAAAAAAGAAAAAACAGGCCGG + Intronic
1073023618 10:100469217-100469239 CATTGAAAGAAAAAAGAGAAAGG - Intronic
1073145103 10:101275487-101275509 CAAAAAAAGAAAAAAAAGGCTGG + Intergenic
1073146955 10:101287460-101287482 GATAGATAGAAAAAGGAGGCAGG - Intergenic
1073264913 10:102221213-102221235 GAATGAAAGACAAAGAAGGAAGG + Intergenic
1073560122 10:104489201-104489223 AAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1073643840 10:105279236-105279258 GAAAGAAAGAAAAAGAAGGAGGG - Intergenic
1074002116 10:109383836-109383858 AAAAGAAAGAAAAAGAAGGATGG - Intergenic
1074145282 10:110711695-110711717 GACTGATAGATAAAGGAGGCTGG - Intronic
1074220678 10:111434595-111434617 GAATCAAAGAGAAAGGAGGGTGG + Intergenic
1074534383 10:114318440-114318462 CATTGAGAAAAAAAAGAGGCTGG + Intronic
1074731564 10:116382808-116382830 CCAAGAAAAAAAAAGCAGGCAGG - Intergenic
1074799371 10:116983830-116983852 GAATGGAAGAAAAAGGAAGATGG + Intronic
1074910962 10:117908393-117908415 CAATGAAAGGAACTGGATGCAGG + Intergenic
1074959997 10:118435559-118435581 CAATGGAACAAAAAGAAAGCAGG - Intergenic
1075073552 10:119335193-119335215 GAAAGAAAGAAAGAGGAGGTGGG - Intronic
1075336387 10:121611990-121612012 AAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1075863477 10:125697432-125697454 GAAGGAAAGAAAAAGAAGGAGGG + Intergenic
1076884034 10:133253239-133253261 CAAAAAAAAAAAAAGAAGGCTGG + Intergenic
1077223615 11:1428089-1428111 AAGTGAAAGAAGATGGAGGCAGG + Intronic
1077631557 11:3814551-3814573 GAAAGAAAAAAAAAAGAGGCTGG - Intronic
1078047120 11:7925084-7925106 CTATTAAAGAAAAAGGAGAATGG + Intergenic
1078079851 11:8196037-8196059 CAAGGAAAGCAAATGGAAGCAGG + Intergenic
1078217424 11:9323304-9323326 TAAAGAAAGAGTAAGGAGGCTGG - Intergenic
1079285471 11:19126644-19126666 CAAAGAAAGGAACAGCAGGCTGG - Intronic
1079551599 11:21705677-21705699 CAAAGAGAGAAAAAGGAGGGGGG - Intergenic
1079561233 11:21822236-21822258 CAATAAAAGCAAAAGGAGGTGGG + Intergenic
1079911364 11:26314585-26314607 CAAAGAAAGAAAAAGAAGGAGGG - Intronic
1080197910 11:29633079-29633101 CCATGAAGGAAAAGAGAGGCAGG + Intergenic
1080330625 11:31133419-31133441 AGATGAAACATAAAGGAGGCAGG + Intronic
1080376863 11:31723212-31723234 TAAGGAAGGAGAAAGGAGGCTGG + Intronic
1080432115 11:32208953-32208975 AAAAAAAAGAAAAAGGAGGGAGG + Intergenic
1080659311 11:34283212-34283234 CAAAAAAAGAAAAAGATGGCCGG - Intronic
1081135761 11:39438490-39438512 GAAAGAAAGAAAAAAGAGGCCGG - Intergenic
1081179210 11:39966522-39966544 GAAGGAAAGAAAGAGGTGGCAGG - Intergenic
1081417040 11:42828231-42828253 GAATGAAAGAAAGAAAAGGCAGG + Intergenic
1081464816 11:43306672-43306694 GAAAGAAAGAAAAGGGAGGGAGG + Intergenic
1081914805 11:46723890-46723912 CAAAGAAAAAAAAAAGATGCTGG + Intronic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1082277471 11:50237388-50237410 AAATAAAACAAAAAAGAGGCTGG + Intergenic
1082920952 11:58493263-58493285 GAAAAAAAGAAAAAGGAGGCTGG + Intergenic
1083187962 11:61028492-61028514 CAGTGAAAGAACAGGCAGGCCGG - Intergenic
1083213602 11:61204594-61204616 CAATGAAAGGAACAGGCAGCAGG + Intronic
1083465907 11:62845931-62845953 AAATTAAATAAAAATGAGGCTGG - Intergenic
1083639917 11:64139959-64139981 AAAAGAAAAAAAAAAGAGGCAGG + Intronic
1083825433 11:65200637-65200659 CAAAAAAAGAACAAGGCGGCCGG - Intronic
1083918710 11:65768008-65768030 AAAAAAAAGAAAAAGAAGGCCGG - Intergenic
1083967933 11:66054179-66054201 CAAAAAAAAAAAAAAGAGGCAGG + Intronic
1084027632 11:66462123-66462145 CAAGGAAAGAAAAGGAAGGGAGG + Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084613107 11:70216739-70216761 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1084645528 11:70455176-70455198 GAAAGAAGGAAAAAGGAGGCTGG - Intergenic
1084893437 11:72248758-72248780 CCATCAAAGAAGAAGGAGACAGG + Intergenic
1085368931 11:75980022-75980044 CAATACCAGAAAAAAGAGGCAGG - Intronic
1086101851 11:83108920-83108942 CAGTGAAATAAAAAACAGGCAGG - Intergenic
1086171865 11:83845165-83845187 AAATGAAGGAAAAAGGATTCAGG - Intronic
1086381772 11:86262176-86262198 TAAAGAAAAAAAAAGCAGGCTGG - Intronic
1086453786 11:86942168-86942190 CAATAAAAGGAAAGGGAAGCAGG + Intronic
1086630450 11:89012071-89012093 CAATGAAAGAAAAAAAGGGTGGG + Intronic
1086651900 11:89301951-89301973 CCAAGAAAGAAAAAGCAGACAGG - Intergenic
1086748388 11:90458797-90458819 AAATGAAATAAAAAGCAGCCAGG - Intergenic
1086904465 11:92403145-92403167 CAAAGAAAGAAAAATGAAGATGG + Intronic
1087079181 11:94153218-94153240 CATACAAAGAAAAAGGAAGCAGG - Intronic
1087290504 11:96315543-96315565 CTATGAAAAAAACAGGAGTCTGG - Intronic
1087329171 11:96757813-96757835 TTAGGAAAGAAAAAGGAGTCAGG + Intergenic
1087368247 11:97248714-97248736 CAAGGAAGGAGAAAGGAGACTGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087600013 11:100302410-100302432 TAATGGAAGAATAAGGAAGCAGG - Intronic
1087726347 11:101721303-101721325 CACCTAAAGAAAAAGGAGACAGG + Intronic
1087774580 11:102245593-102245615 AAAAGAAAGAAAAATGAGCCAGG - Intergenic
1088079125 11:105888580-105888602 TAAAAATAGAAAAAGGAGGCCGG - Intronic
1088141081 11:106617126-106617148 AGAAGAAAGAAAAAGGAGGGAGG - Intergenic
1088306238 11:108411007-108411029 CAAAGAAAGTAAAAGGAAGGGGG - Intronic
1088742944 11:112781539-112781561 CAAGGAAAGAAAGAAGAGGCTGG + Intergenic
1088912757 11:114204434-114204456 GAATAAAAGAAAAATGAGACCGG - Intronic
1088989159 11:114936714-114936736 CATTGATAGAAAAATGAGGAAGG + Intergenic
1089134813 11:116240568-116240590 GAAAGAAAGAAAAGGGAGGGAGG + Intergenic
1089144565 11:116315759-116315781 CACTGAAAGAAGGAAGAGGCTGG + Intergenic
1089237257 11:117040940-117040962 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
1089923080 11:122229338-122229360 GGATGAAAAAAAAATGAGGCTGG + Intergenic
1089944727 11:122457203-122457225 GAAAGAAAGAGAAAGGAGGGAGG + Intergenic
1090061490 11:123467793-123467815 AAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1090145127 11:124313175-124313197 AAAGGAAAGAAAAAGAAGGAAGG + Intergenic
1090337561 11:125983101-125983123 AAATGAAAGAAAAGTGAGGGAGG - Intronic
1090377459 11:126301404-126301426 CAAAGAAAGAAAAAAAAGGGCGG + Intronic
1090534099 11:127621540-127621562 TAATGAAAGAGAAAGGAGAAAGG - Intergenic
1090987653 11:131785510-131785532 CACTGAAAGAAAGAGCATGCTGG + Intronic
1091259617 11:134224212-134224234 CCATTGAAGAAAAACGAGGCGGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091860373 12:3776150-3776172 GACTGAAAGAACAATGAGGCTGG + Intergenic
1091959825 12:4684236-4684258 AAATAAATGAAAAAGGAAGCTGG - Intronic
1092119239 12:6032341-6032363 AAAGAAAAGAAAAAAGAGGCCGG + Intronic
1092155943 12:6281548-6281570 TCAGGAAAGAAATAGGAGGCGGG - Intergenic
1092324714 12:7517823-7517845 GAAAAAAAGAAAAAGAAGGCTGG + Intergenic
1092549749 12:9485516-9485538 AAACGAAAGACAGAGGAGGCAGG - Intergenic
1092585253 12:9893700-9893722 CAAAGAAAAAAAAGGGAGGGAGG - Intronic
1092666962 12:10812065-10812087 CAAGGAAAGATAAAAGAGGGTGG - Intergenic
1092826474 12:12404541-12404563 CAATGACAGTAATAGGAGGTGGG - Intronic
1092881095 12:12888401-12888423 AAATGAAAGAAACAGTAGGACGG - Intergenic
1093013001 12:14128254-14128276 AAATGAGAGAAAGAGGAGGGAGG + Intergenic
1093243418 12:16706226-16706248 CACTGAAAGAAAAAGCAGTGTGG - Intergenic
1093262567 12:16957310-16957332 TAAATAAAGAAAAAGGAGGCTGG - Intergenic
1093437505 12:19152160-19152182 CAATGTAAAAAAAATGTGGCCGG - Intronic
1093544229 12:20327172-20327194 CTATAAGAGAATAAGGAGGCCGG - Intergenic
1093772560 12:23034506-23034528 GAAAGAAAGAAAAAGGAGGGAGG - Intergenic
1093781305 12:23140415-23140437 AAATGAAAGAAAATAGAGCCGGG - Intergenic
1093855873 12:24101407-24101429 GAAGGAAATAAAGAGGAGGCAGG - Intergenic
1093937819 12:25019775-25019797 CAGTGATATAAACAGGAGGCAGG - Intergenic
1094564095 12:31584204-31584226 CAGGGAGAGAGAAAGGAGGCTGG - Intronic
1094601331 12:31911618-31911640 TAATGAAAGAAAGAGGAGGAAGG + Intergenic
1094632914 12:32194978-32195000 TAATGAAAGAAATTGAAGGCTGG + Intronic
1094824966 12:34262905-34262927 CAAAAAAAGAAAGATGAGGCCGG - Intergenic
1094825065 12:34263601-34263623 AAAAGAAAGAAAAAGGTGGGGGG - Intergenic
1095086037 12:38058077-38058099 CAAAAAAAGAAAGATGAGGCCGG + Intergenic
1095643619 12:44515040-44515062 TTATTAAAGAAAAAGAAGGCAGG + Intronic
1095746021 12:45659832-45659854 TGAAGAAAGAAAAAGGAGGTGGG + Intergenic
1095929434 12:47610776-47610798 AAATGAAAGAAAGAGGAAACTGG - Intergenic
1096055101 12:48644094-48644116 CAAAGAAAGAAAAGGGTGGTGGG - Intergenic
1096151901 12:49319363-49319385 CAAAAAAAGTAAAAGCAGGCTGG + Intergenic
1096294606 12:50373099-50373121 GAAAGAAAGAAAAACTAGGCTGG + Intronic
1096313583 12:50543931-50543953 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1096328676 12:50689374-50689396 AAAAGAAAAAAAAAGGAGACCGG + Intronic
1096739572 12:53682715-53682737 CAAAAAAAAAAAAAAGAGGCCGG - Intergenic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1097309925 12:58107434-58107456 CAAGGAAAAAAAAATGTGGCTGG + Intergenic
1097351691 12:58556027-58556049 CTATGAAAGTTAAAGGAGGAAGG + Intronic
1097352810 12:58567142-58567164 CAGTGAAAAAAAAAGGGGGGGGG - Intronic
1097475000 12:60042625-60042647 CAAAGAAAGAAAAGGAAGGAAGG + Intergenic
1097558526 12:61171333-61171355 GAATGAGAGAAAAAGAAGGAAGG + Intergenic
1097698750 12:62799658-62799680 CAATGAAAATACCAGGAGGCTGG - Intronic
1097836775 12:64281272-64281294 CAAAAAAAGAAAAAAGAGCCCGG + Intronic
1097878782 12:64668567-64668589 AAAAGAAAGAACAACGAGGCTGG - Intronic
1097950912 12:65427466-65427488 CAGTGAAAGAAAAAGAAATCAGG - Intronic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098819674 12:75210819-75210841 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1098899818 12:76101330-76101352 CAAAAAAAGAAAAACAAGGCAGG - Intergenic
1098961768 12:76746290-76746312 GAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1099734913 12:86555069-86555091 CCTTAAAAGGAAAAGGAGGCAGG - Intronic
1099930500 12:89068732-89068754 CCATGAAAGGAAAAGAAGGGAGG + Intergenic
1100242673 12:92725449-92725471 CAAGGAGATAAAAAGGAGGGCGG + Intronic
1100282719 12:93133531-93133553 CAGTCAAAGAAAAAGCAGACTGG + Intergenic
1100407872 12:94286791-94286813 CAAGGAAAGAAGAAACAGGCTGG - Intronic
1100778116 12:97994544-97994566 GAGAGAAAGAAAAAGGAGCCTGG - Intergenic
1100823349 12:98452528-98452550 CAATAAAATAAAATTGAGGCCGG - Intergenic
1100840518 12:98607949-98607971 AAAAGAAAGAAAAAACAGGCAGG - Intergenic
1100853692 12:98739648-98739670 AAATGAAAGGAAAAGGAGAAGGG - Intronic
1101294145 12:103403384-103403406 AAAAAAAAGAAAAAGGATGCAGG + Intronic
1101385439 12:104253209-104253231 CAAGTAAAGAAAAAGGAAGGTGG + Intronic
1101466719 12:104957675-104957697 GAATGAAAGAAAAGGGTGACGGG + Intronic
1101514274 12:105419978-105420000 CTATGAAAGATAAAGGAGGAGGG + Intergenic
1101650659 12:106674316-106674338 AAAAGAAAGAAAATGGAGGTGGG - Intronic
1101896598 12:108761724-108761746 AAAAGAAAGAAAATGGAAGCTGG + Intergenic
1102074930 12:110052190-110052212 CAAAAAAAAAAAAAGAAGGCCGG - Intronic
1102079196 12:110084450-110084472 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1102513217 12:113429372-113429394 CATCGAAAGGAAAAGGAGACAGG - Intronic
1102697866 12:114814246-114814268 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1102864080 12:116360425-116360447 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1102974316 12:117195474-117195496 AAATGAAAGAAAAAGAAGGCTGG - Intergenic
1103040237 12:117688919-117688941 CAAGGAAGGAAAAAGGAGGCAGG - Intronic
1103151173 12:118640315-118640337 AAAAGAAAGTAAAAGGTGGCTGG + Intergenic
1103232696 12:119345205-119345227 TTAAGACAGAAAAAGGAGGCTGG + Intronic
1103314355 12:120040386-120040408 AAAGAAAAGAAAAAGAAGGCTGG - Intronic
1103695529 12:122812442-122812464 CAAAAAAAAAAAAAAGAGGCCGG + Intronic
1103787445 12:123443762-123443784 CAGTGAAAGTTAAAAGAGGCCGG - Intergenic
1103839791 12:123853108-123853130 AAATGCAAGAAAACGGGGGCAGG - Intronic
1103892865 12:124253170-124253192 CAATGAAAAAGGAATGAGGCTGG + Intronic
1104144972 12:126024419-126024441 CTACAAAAGAAAAAGTAGGCCGG + Intergenic
1104407707 12:128532340-128532362 AAAGAAAAAAAAAAGGAGGCCGG + Intronic
1104459895 12:128946627-128946649 AAAAAAAAAAAAAAGGAGGCCGG - Intronic
1104547153 12:129722720-129722742 GAAAAAAAGAAAAAGGAGCCAGG - Intronic
1105387975 13:19949590-19949612 GAAAGAAAGAAAAAATAGGCTGG + Intergenic
1105481953 13:20785888-20785910 GAAAGAAAGAAAGAGGAGGGAGG + Intronic
1105539199 13:21299966-21299988 CAATGAAAGAAACAAGTGACCGG - Intergenic
1105591957 13:21800432-21800454 AAAAGAAAGAAAACTGAGGCTGG - Intergenic
1105799044 13:23887656-23887678 CAATGAAAGAAACAAGTGACCGG + Intronic
1106031716 13:26010746-26010768 CCATGGAAGAAAGAGGAGACGGG + Intronic
1106044305 13:26123488-26123510 AAGGGAAAGAAAATGGAGGCTGG + Intergenic
1106216483 13:27706448-27706470 AAATGAAAAAAGAGGGAGGCAGG - Intergenic
1106289230 13:28345097-28345119 CTAAGAAATAAAAAGGAGACTGG - Intronic
1106290524 13:28357190-28357212 AAATGGAAGAAAAGGGAGGGGGG - Intronic
1106554889 13:30800916-30800938 GATTGAAAAAAAAAGGAGGGAGG - Intergenic
1106772080 13:32971389-32971411 GAAAGAAAGAGAAAGGAGGGAGG - Intergenic
1106848928 13:33767659-33767681 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
1107147646 13:37075911-37075933 CAATAAAAGCAAAATGAGGTTGG - Intergenic
1107363469 13:39644895-39644917 AAATTAAAGAAAAAAGAGGTAGG - Intergenic
1107458702 13:40579607-40579629 GAATGAAAAAAAAAGGGGGCGGG + Intronic
1107470676 13:40688377-40688399 CAAAAAAAGAAAAAAGAGGCCGG - Intergenic
1107475440 13:40731273-40731295 CAAGAAAAGACAGAGGAGGCCGG + Intronic
1107486086 13:40828799-40828821 CAAGAAAAGAAAAAGGAGGGTGG + Intergenic
1107571639 13:41666361-41666383 CAATGAGAGAAAAGGGAGAAAGG - Intronic
1107825967 13:44329585-44329607 AAAAGAAAGAAAAAGCAGGGGGG + Intergenic
1108087332 13:46807549-46807571 AAATAAAAGAAAAAGAAAGCGGG - Intergenic
1108125556 13:47238986-47239008 AAATGAGAGGAAAAGGAGGAAGG + Intergenic
1108549960 13:51534126-51534148 CATTCAAAGAAAACGGAAGCTGG + Intergenic
1108588462 13:51891719-51891741 AAATGGAAGGAAAAAGAGGCAGG + Intergenic
1108692583 13:52872618-52872640 CAGTGAAAGAAAAAGGAGCATGG + Intergenic
1108908398 13:55509179-55509201 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1108913242 13:55580666-55580688 AAATGAAAGCAAAGAGAGGCTGG + Intergenic
1109066168 13:57695439-57695461 GAAAGAAAGAAAAGGAAGGCAGG + Intronic
1109068476 13:57732965-57732987 CAATGATGGAAGTAGGAGGCCGG + Intergenic
1109422599 13:62132730-62132752 TTGTGAAAGAAAAAGAAGGCAGG - Intergenic
1109591705 13:64492182-64492204 AAAGGAAATAAAAAGGAGACGGG + Intergenic
1109658391 13:65425979-65426001 GAAGGAAAGAAAAAGGAGTGGGG + Intergenic
1109730660 13:66409154-66409176 AAATGAAAAAAAAAGGAGCCAGG + Intronic
1109771467 13:66979910-66979932 GAAAGAAAGAAAAAGGTGGAGGG - Intronic
1110226192 13:73122225-73122247 ATATAAAAGAAAAAAGAGGCTGG - Intergenic
1110669584 13:78161630-78161652 GCATGAAAGGAAAAGGATGCAGG + Intergenic
1110719207 13:78742617-78742639 GAAGGAAAGAAAGAGGAAGCTGG - Intergenic
1111178172 13:84625699-84625721 CAATGAAAAAAATAAGTGGCAGG - Intergenic
1111363650 13:87210980-87211002 TAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1111377297 13:87397260-87397282 AAAACAAACAAAAAGGAGGCTGG + Intergenic
1111446058 13:88347629-88347651 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1111474812 13:88730237-88730259 TTATGAAAGAAAAAAGAGGGAGG + Intergenic
1111671710 13:91339737-91339759 CAATGAAAAACAAACAAGGCTGG - Intergenic
1112074094 13:95889792-95889814 CACTGAATGACAAGGGAGGCTGG - Intronic
1112105366 13:96234112-96234134 AAAGGAAAGAAAAAGAAGCCAGG + Intronic
1112185157 13:97120894-97120916 CAATATAAGAACAAAGAGGCTGG - Intergenic
1112229994 13:97580370-97580392 AAATCAAAGAATAAGGAGGTAGG - Intergenic
1112672170 13:101653100-101653122 CAAAGAAAGAAAAAGAAGGAAGG + Intronic
1112798921 13:103089160-103089182 CTATGAAAGAAATAGGGGCCAGG + Intergenic
1113032307 13:106007750-106007772 CAAAAAAAGAAAAAGGAAACAGG - Intergenic
1113139112 13:107127512-107127534 GATTGAGAGGAAAAGGAGGCAGG + Intergenic
1113292277 13:108920331-108920353 AAAAGAAAGAAAAAGAAGGGAGG - Intronic
1113429267 13:110235352-110235374 CAATAAAAGAAAGAAGATGCCGG + Intronic
1113852474 13:113425666-113425688 AAAAGAAAGAAAAAAGAGGCCGG - Intronic
1113852793 13:113427523-113427545 AAAGAAAAGAAAAAAGAGGCCGG - Intronic
1114007221 14:18327843-18327865 CAATTAAAATAAGAGGAGGCAGG + Intergenic
1114227983 14:20756099-20756121 GAAAGAAAGAGAAAGAAGGCTGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114471497 14:22966084-22966106 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
1114935065 14:27524867-27524889 CAATAAAAGCAAAAATAGGCCGG - Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115054665 14:29108810-29108832 AAAAGAAAGAAAAAAGAGGGAGG + Intergenic
1115212753 14:30984217-30984239 CTATGAAGGAAAAATGAAGCAGG + Intronic
1115304125 14:31916462-31916484 AAATAAAATAAAAAGAAGGCAGG - Intergenic
1115701343 14:35956071-35956093 AAATGAAAGAAAAAAGATGATGG - Intergenic
1115833891 14:37375479-37375501 TAATAAATTAAAAAGGAGGCTGG - Intronic
1115992713 14:39166096-39166118 AAATAAAAAAAAAAAGAGGCTGG - Intronic
1116175768 14:41468704-41468726 CAATGAGAAAAGAAGGAGGCTGG - Intergenic
1116315158 14:43376952-43376974 GAAAGAAAGAAAAGAGAGGCAGG - Intergenic
1116330998 14:43597796-43597818 AAAGGAAAGAAAAAAGAGTCAGG + Intergenic
1116358883 14:43967722-43967744 AAATGAAAGAAAAAGAAGAATGG - Intergenic
1116396491 14:44453066-44453088 TAATGATAGAGACAGGAGGCAGG - Intergenic
1116534603 14:46014847-46014869 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1116828131 14:49691810-49691832 GAAAGAAAGAAAAAGGAGGAAGG - Intergenic
1116859847 14:49985502-49985524 CAATGAAATTAAAAGGGGCCGGG - Intronic
1117517923 14:56520880-56520902 CAAGGACAGAAACAGGAGACTGG - Intronic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1117727547 14:58689474-58689496 CAAAAAAAAAAAAAAGAGGCCGG + Intergenic
1117890665 14:60418450-60418472 CAAAGAAATAAAAATTAGGCAGG + Intronic
1118049688 14:62013501-62013523 CAGTGAATGAAGAAGCAGGCAGG - Intronic
1118194945 14:63616470-63616492 TAAGGCAAGAAAAATGAGGCAGG + Intronic
1118231216 14:63951602-63951624 CAATTAAAGAAAAGTAAGGCTGG - Intronic
1118579558 14:67280872-67280894 AAAAGAAAGAAAAGGGAGGGAGG - Intronic
1118798446 14:69167066-69167088 TAAAAAAAGAAAAAAGAGGCTGG + Intergenic
1119189641 14:72671907-72671929 CACTGAAAGCAAAAGGAAGTTGG + Intronic
1119337174 14:73843612-73843634 AAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1119337178 14:73843648-73843670 CAAAAGAAAAAAAAGGAGGCGGG - Intergenic
1119825568 14:77654634-77654656 AAAAAAAAAAAAAAGGAGGCAGG + Intergenic
1119965362 14:78909294-78909316 CAATCAAAGCAAAAGCAGACTGG + Intronic
1120818715 14:88891919-88891941 CAGTGAAGGGGAAAGGAGGCTGG - Intergenic
1121130766 14:91444660-91444682 GAAAGAAAGAAAAAGGAAGAAGG + Intergenic
1121167147 14:91814541-91814563 AAATCAAAGAAAAAGAAGGATGG + Intronic
1121518300 14:94568551-94568573 CAATGATAGAAAATGGAGGAGGG + Intronic
1121540501 14:94722484-94722506 TAAAGAAAGAAAGGGGAGGCTGG + Intergenic
1121569331 14:94935812-94935834 CAATGGAAGAGAAAGGGTGCTGG + Intergenic
1121962532 14:98274617-98274639 AAAAGAAAGAGAAAGGAGACAGG + Intergenic
1122161214 14:99785349-99785371 TTATTAGAGAAAAAGGAGGCTGG - Intronic
1122729848 14:103787944-103787966 TAATTAAAAAAAAAGGAGGCTGG - Intronic
1122908238 14:104812784-104812806 AAAAAAAAGAAAAAAGAGGCCGG + Intergenic
1123391136 15:19874497-19874519 CAATTAAAATAAGAGGAGGCAGG + Intergenic
1123395712 15:19933160-19933182 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1123683061 15:22776207-22776229 AGATGAAAGGGAAAGGAGGCGGG + Intronic
1123753773 15:23380429-23380451 CAAAGAAAGAGAGAGGAGGGAGG + Intergenic
1123763089 15:23447330-23447352 AGATGAAAGGGAAAGGAGGCGGG + Intergenic
1123803905 15:23851937-23851959 GAAAGAAAGAAAAAGAAGGAGGG + Intergenic
1123997156 15:25726897-25726919 CAAAAAAAAAAAAAGGAGCCGGG + Intronic
1124334813 15:28848731-28848753 AGATGAAAGGGAAAGGAGGCGGG + Intergenic
1124512200 15:30336845-30336867 CAGGGAAAGTAAGAGGAGGCAGG + Intergenic
1124633715 15:31352011-31352033 CAAAAAAAAAAAAGGGAGGCGGG + Intronic
1124636720 15:31370030-31370052 AAAAAAAAGAAAAAGGAGACAGG - Intronic
1124730714 15:32193906-32193928 CAGGGAAAGTAAGAGGAGGCAGG - Intergenic
1125052549 15:35317406-35317428 GAAAGAAAGAAAGAGGAGGGAGG + Intronic
1125126740 15:36232368-36232390 CCAAGAAAGAAGTAGGAGGCAGG + Intergenic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1125256191 15:37766253-37766275 CAAAGAAGGAAACAGGAGGAAGG + Intergenic
1125473209 15:40024692-40024714 TAAAAAAAAAAAAAGGAGGCTGG - Intronic
1125961425 15:43833054-43833076 TAATGAATGAAAAAGGACCCAGG - Intronic
1126173759 15:45716378-45716400 CAATGAAAGAAAAGTGATGAGGG - Intergenic
1126405041 15:48314835-48314857 CAGTGATTGAAAAAAGAGGCTGG - Intergenic
1126478198 15:49089355-49089377 TAATTAAATAAAAAGGAGGATGG + Intergenic
1126650898 15:50920407-50920429 CAAAAAAAAAAAAAGAAGGCCGG - Intronic
1127034295 15:54897812-54897834 CTATGAAAGAAAAATGATACTGG - Intergenic
1127105438 15:55608851-55608873 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
1127141405 15:55981359-55981381 AAAAGAAAAAAAAAGGAGGCCGG - Intronic
1127176558 15:56364447-56364469 AAAGAAAAGAAAAAAGAGGCTGG - Intronic
1127296635 15:57614547-57614569 CCTTGAAACAAGAAGGAGGCTGG + Intronic
1127418869 15:58784929-58784951 CAATGAAAAAAATAACAGGCTGG - Intronic
1127436382 15:58962509-58962531 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1127728227 15:61772084-61772106 AAAGGAAAAAAAAAGGTGGCAGG + Intergenic
1127853667 15:62937050-62937072 CATTAAAAGAAACAAGAGGCCGG - Intergenic
1127897535 15:63315581-63315603 GAAAGAAAGAAAAGGGAGGAGGG + Intergenic
1128220391 15:65964601-65964623 CAAGGAGAGAACAAGGAGGTGGG - Intronic
1128255082 15:66190466-66190488 CAAGGAAGGAAACAGGAGGAGGG + Intronic
1128390314 15:67178267-67178289 CAAAAAAAGAAAAAGCTGGCAGG - Intronic
1128398368 15:67252636-67252658 CAATTAAAGAAAAAAGAGGAAGG + Intronic
1128596749 15:68959128-68959150 TAAGGTAAGAAAATGGAGGCCGG + Intronic
1128610643 15:69070431-69070453 GAGAGAAAGAAAAGGGAGGCAGG + Intergenic
1128940860 15:71786733-71786755 GAAAGAAAGAAGAAGGAGGAGGG + Intergenic
1129138484 15:73575437-73575459 CAATAAAAGTCAAAGCAGGCTGG + Intronic
1129422001 15:75435826-75435848 CATTGAAAGAAAAATGTGCCTGG + Intronic
1129532086 15:76275881-76275903 CAATGTAAGAAACAGGAGATAGG - Intronic
1129546229 15:76398496-76398518 CAATGAATGAATAGGCAGGCGGG + Intronic
1129644059 15:77414117-77414139 AAAAGAAAGAAAATGCAGGCTGG - Intronic
1129748348 15:78040902-78040924 GAAAGAAAGAAAAGGGAGGCAGG + Intronic
1130079496 15:80720094-80720116 CAACAAAAAGAAAAGGAGGCTGG - Intronic
1130307087 15:82720440-82720462 GAAAGAAAGAAAATGTAGGCTGG - Intergenic
1130551449 15:84892215-84892237 TAAAAAAAGAAAAAGGAGGATGG + Intronic
1130620712 15:85459493-85459515 AAAAAAAAGAAAAAGCAGGCTGG - Intronic
1130748257 15:86680490-86680512 CAAAGAAAGAAAAATTAGGCTGG - Intronic
1131206436 15:90452291-90452313 CAATGAGGGAAAAAGGAGGTGGG + Intronic
1131727517 15:95243055-95243077 GAAAGAAAGAAAAAGAAGGGAGG + Intergenic
1131739329 15:95370232-95370254 CAGTGCAAAAGAAAGGAGGCAGG + Intergenic
1132173312 15:99686281-99686303 CAATGAAAAAAAAAGTATTCAGG - Intronic
1132526994 16:421946-421968 CAATAAAATAAAAATAAGGCTGG - Intergenic
1132681183 16:1142518-1142540 TAAAAAAAGAAAAAGGCGGCCGG + Intergenic
1133141994 16:3751948-3751970 CAATGAAAGGAACAGGGGGCAGG + Intronic
1133185298 16:4091970-4091992 CAATTAAAAATAAAGCAGGCTGG + Intronic
1133260979 16:4549793-4549815 AAATAAAATAAAAAGGAGCCTGG + Intergenic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133848037 16:9475586-9475608 CAATCAAAAAAAAAATAGGCTGG + Intergenic
1134268271 16:12710454-12710476 CAAAAAAAAAAAAAGGAGGGGGG + Intronic
1134462609 16:14442595-14442617 CAAAGAAAGAGAGAGGAGGGAGG - Intronic
1134619404 16:15676190-15676212 GAAAGAAAGAAAAAGAAGGAGGG - Intronic
1135023535 16:18982207-18982229 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1135031686 16:19043866-19043888 CAAAGAAAACAAAAGCAGGCCGG - Intronic
1135250275 16:20895347-20895369 TAATAAAACAAAAAGGGGGCAGG + Intronic
1135488001 16:22882734-22882756 CAAACAAACAAAAAAGAGGCTGG + Intronic
1135521418 16:23181639-23181661 GGAAGAAAGAAAAAGGAGGGAGG + Intergenic
1135703736 16:24656164-24656186 AAAGAAAAGAAAAATGAGGCCGG + Intergenic
1135943118 16:26840154-26840176 TAGTAAAATAAAAAGGAGGCTGG + Intergenic
1136102220 16:28004476-28004498 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1136183211 16:28569361-28569383 TAAAGAATGAAAAAGTAGGCTGG + Intronic
1136202775 16:28699838-28699860 AAAAGAAAAAAAAAAGAGGCTGG - Intronic
1136341321 16:29645586-29645608 CAATGAAAGAAAACCCATGCCGG - Intergenic
1136541081 16:30927913-30927935 AAACGAAAGGAAAGGGAGGCAGG + Exonic
1136589080 16:31206353-31206375 GAAAGAAAGAAGAAGGAGGAAGG - Intergenic
1136698163 16:32105340-32105362 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136769443 16:32822524-32822546 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1136798661 16:33048625-33048647 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136844578 16:33565922-33565944 CAAGGAAGGAAAAAGGGGGGGGG + Intergenic
1136901041 16:34038417-34038439 GAAAGAAAGAAAAAAGAGGAAGG + Intergenic
1136935662 16:34461460-34461482 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1136939710 16:34511310-34511332 AAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1136946047 16:34652485-34652507 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136956376 16:34791512-34791534 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136960110 16:34837254-34837276 AAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136964156 16:34887110-34887132 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1137088777 16:36162338-36162360 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1137093302 16:36221568-36221590 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1137279921 16:46967387-46967409 TTATTAAAGAAAAAGGAGGCCGG - Intronic
1137301438 16:47152105-47152127 AACTGAAGGAAAAAGTAGGCAGG - Intergenic
1137529714 16:49271054-49271076 AAAAAAAAAAAAAAGGAGGCAGG + Intergenic
1137550865 16:49436698-49436720 GAGAGAAAGAAACAGGAGGCAGG - Intergenic
1137816521 16:51403163-51403185 GAACGAAAGAAAAGGAAGGCAGG + Intergenic
1138091169 16:54175801-54175823 AAAAGAAAGAAAGAGGGGGCGGG - Intergenic
1138133914 16:54504871-54504893 CAATGAAGGAAAAAGGGGGGAGG + Intergenic
1138377727 16:56577549-56577571 AAAAGAAGGAAAAAGAAGGCTGG + Intergenic
1138411427 16:56843426-56843448 AAAAGAAAGAAAAAGGAGAGTGG - Intronic
1138446655 16:57068511-57068533 GAGTGAAAGAAAAGGGAGGTGGG - Intronic
1138506759 16:57482158-57482180 CAAAAGAAGAAAAAGAAGGCCGG - Intronic
1138587919 16:57983907-57983929 CAAAAAAAGAAAAAAAAGGCTGG - Intronic
1138621174 16:58212568-58212590 AAAGGAAAGAATAAGGAGGAAGG + Intergenic
1138899332 16:61250099-61250121 CTATGAAAGTAAAAGAATGCAGG - Intergenic
1138901964 16:61283090-61283112 AAAACAAAGAAAAAGGAGGAGGG - Intergenic
1138961112 16:62030968-62030990 ATATGAAAGAAAAAGAAGGAGGG + Intronic
1139107026 16:63838774-63838796 CAATGAACAAAAAACCAGGCTGG + Intergenic
1139253544 16:65519624-65519646 GAAGGAAAGAAAAAGGAAGGAGG - Intergenic
1139304884 16:65976767-65976789 AAATGAAAGGAAAAGGTGGAAGG - Intergenic
1139455552 16:67072760-67072782 AAAAAAAAGAAAAAAGAGGCCGG - Intronic
1139624041 16:68170787-68170809 CAATAAAAGAAAATCGAGGCCGG - Intronic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1139731200 16:68946796-68946818 CAATGAAAGAGAAATTAGGTGGG - Intronic
1139773391 16:69297321-69297343 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1139903951 16:70349997-70350019 CAATGAAAGTGACAGAAGGCTGG + Intronic
1139930527 16:70522715-70522737 CACTGAAAATTAAAGGAGGCAGG + Intronic
1140025077 16:71280832-71280854 CAATAAAAGAATAAGGGGGCAGG + Intergenic
1140293143 16:73683003-73683025 GAAAGAAAGAGAAAGGAGGGAGG + Intergenic
1140303870 16:73784125-73784147 AAAAGAAAAAAAAAGGAGACAGG + Intergenic
1140390853 16:74585408-74585430 CAAAAAAACAAAAAAGAGGCCGG + Intronic
1140563743 16:76014876-76014898 CAATGAAATAAAAAGAAAGGCGG - Intergenic
1140595587 16:76406061-76406083 CAAAGAAAAAAAAATTAGGCGGG + Intronic
1140805779 16:78530728-78530750 CAATGATAGGGACAGGAGGCAGG - Intronic
1141006848 16:80360431-80360453 GAAAGAAAGAAAAAAGAAGCTGG + Intergenic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1141599542 16:85117112-85117134 CAATAAAATAAAACAGAGGCAGG - Intergenic
1141866936 16:86756792-86756814 GAATCAAATAAAAATGAGGCTGG - Intergenic
1141915009 16:87089784-87089806 AAAGGAAGGAAAAAGGAGCCAGG - Intronic
1142021619 16:87786455-87786477 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1142150175 16:88509206-88509228 AAAGGAAAGAAAAAGGAGTGAGG - Intronic
1142224007 16:88868686-88868708 GAAGGAAAGAAAAGGGAGGGCGG + Intergenic
1142382842 16:89743525-89743547 CAAATAAACAAAAACGAGGCAGG + Intronic
1203071859 16_KI270728v1_random:1084629-1084651 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1203154745 16_KI270728v1_random:1866220-1866242 CAAGGAAGGAAAAAGGGGGGGGG + Intergenic
1142753869 17:2004070-2004092 CAAAAAAACAAAAAGCAGGCCGG + Intronic
1142991956 17:3737359-3737381 AAATGAAACGAAAAAGAGGCAGG + Intronic
1143083156 17:4396431-4396453 CAAAGAAGGCACAAGGAGGCCGG + Intergenic
1143150478 17:4804878-4804900 CATTGAAAGAAAAAGAAGGCGGG - Intergenic
1143308673 17:5970428-5970450 CAATAAAAGAAAAAAGGGCCGGG + Intronic
1143499013 17:7328136-7328158 CAAGGAAAGTTAGAGGAGGCAGG - Intronic
1143575996 17:7793423-7793445 GAAAGAAAGAAAAAGCAAGCAGG - Intronic
1143747975 17:9007456-9007478 GAATGAAAGAAAGAGAAGGAAGG - Intergenic
1143761819 17:9110264-9110286 AAAAGAAAAAAAAAAGAGGCAGG - Intronic
1143955475 17:10664840-10664862 CAAGGACAAAAAAAGGAGGCAGG + Intergenic
1144001199 17:11056817-11056839 CAATGAGAGAAAGCAGAGGCAGG - Intergenic
1144258379 17:13492691-13492713 GAAAGAAAGAGAAAGGAGGAAGG + Intergenic
1144305087 17:13962418-13962440 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1144394697 17:14832845-14832867 CTTTAAAAGAAAAAGCAGGCCGG - Intergenic
1144422653 17:15112164-15112186 TAAAGAAAGACATAGGAGGCCGG + Intergenic
1145079931 17:19886383-19886405 GAAAGAAAGAAAAAGAAGGGAGG - Intergenic
1145692331 17:26755569-26755591 CAAAGAAAGAAAAAGAAGGGAGG + Intergenic
1146217106 17:30986157-30986179 CAGTGAAGGAAAAGGGAGGGGGG - Intronic
1146299365 17:31676259-31676281 GAATGAAAGAAAAATGGGGCTGG + Intergenic
1146329254 17:31914374-31914396 AAAAGAAAGAAAAAGCAGCCAGG + Intergenic
1147127839 17:38384588-38384610 CAAAGAAAAAAAAAAGAAGCTGG - Intronic
1147347613 17:39812800-39812822 CAAAGAATGCAAAAAGAGGCAGG + Intronic
1148267028 17:46234194-46234216 CAAAGAAAGAAAAATTAGCCGGG - Intergenic
1148505246 17:48122020-48122042 CAGTGAAAGAAAAAGCAAGGAGG - Exonic
1148519877 17:48262797-48262819 CAATGAAATACCAAGGAGGAGGG - Intronic
1148681201 17:49474556-49474578 CTAGGAAAGAACAAGGAGGAAGG - Intronic
1148691715 17:49531481-49531503 CAATTAAAAATAAATGAGGCTGG - Intergenic
1148726728 17:49797357-49797379 CAATGTATAAGAAAGGAGGCTGG - Intronic
1148774158 17:50085208-50085230 AAAAGAAAGAAAAGGGAGGAAGG + Intronic
1149109293 17:53007795-53007817 CTATGAAAGGACAAGGATGCAGG + Intergenic
1149444527 17:56703471-56703493 AAATGATAGGAGAAGGAGGCCGG - Intergenic
1149569546 17:57662858-57662880 CAATGTCAGACAAAGGAGGCCGG + Intronic
1149747469 17:59113222-59113244 TAAGAAAAGAAAAAAGAGGCCGG + Intronic
1149932469 17:60769699-60769721 CAAGGAGAGAGACAGGAGGCAGG - Intronic
1149982579 17:61323084-61323106 AAATGAAAGAAAAAGGAGAATGG + Intronic
1150051481 17:61968619-61968641 CATTTAAATAAAAAGGAGGCCGG - Intronic
1150060230 17:62061670-62061692 CAATGAAAGAAAAAGGAGGCTGG + Intronic
1150423616 17:65058984-65059006 GAAAGAAAGAAAAAGAAGGCCGG + Intergenic
1150465208 17:65386814-65386836 AAAGAAAAGAAAAAAGAGGCAGG - Intergenic
1150786118 17:68164154-68164176 CAATGTAAAGAAAAGGTGGCCGG + Intergenic
1150835355 17:68558739-68558761 GAAGGAAAGAGAAAGGAGGGAGG - Intronic
1150921927 17:69492977-69492999 CAATTAAAAAAAAATGATGCTGG - Intronic
1151327693 17:73388993-73389015 TAACGAAAGAAAAAGGAAGGAGG - Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151479729 17:74362836-74362858 CAATGTAAGGAAACTGAGGCAGG + Intergenic
1151764820 17:76127498-76127520 ACAAGAAAGAAAAAAGAGGCTGG + Intergenic
1151915495 17:77114845-77114867 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
1151926627 17:77202320-77202342 TACTTAAAAAAAAAGGAGGCTGG + Intronic
1151973770 17:77472425-77472447 GAATGAATGAAAGAGGAGGCTGG + Intronic
1152044059 17:77924419-77924441 GAAAGAAAGAAAAACAAGGCTGG + Intergenic
1152076037 17:78160576-78160598 GAAAAAAAGAAAAAGGATGCTGG - Intronic
1152083490 17:78203354-78203376 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1152084688 17:78210838-78210860 AAAAGAAAGAAAAAAGAGCCAGG - Intergenic
1152103983 17:78318400-78318422 GTACGGAAGAAAAAGGAGGCTGG - Intergenic
1152266927 17:79300583-79300605 CAGTGACAGAACCAGGAGGCTGG + Intronic
1152506737 17:80754308-80754330 GAATGACACAAAAAGAAGGCGGG - Intronic
1152621651 17:81367890-81367912 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1152670559 17:81602406-81602428 CAATTAAAAAAAAATCAGGCCGG + Intronic
1203183852 17_KI270729v1_random:93122-93144 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1153569158 18:6451126-6451148 TCAGGAATGAAAAAGGAGGCTGG - Intergenic
1153843805 18:9030648-9030670 TAATGATAGCAACAGGAGGCAGG - Intergenic
1154474611 18:14744348-14744370 TAATGAAAGGAAATGGTGGCTGG + Intronic
1155013397 18:21806496-21806518 CAATTAAGAAAAAAAGAGGCTGG - Intronic
1155164993 18:23224863-23224885 AAAAGAAAGAAAAAGAAGGCCGG - Intronic
1155194266 18:23458455-23458477 GAAAGAAAGAACCAGGAGGCTGG + Intronic
1155508583 18:26554086-26554108 GAAAGAAAGAAAAAGAAGGAAGG + Intronic
1155563378 18:27105071-27105093 CAAAGAAAGAAAAAGAAGAAAGG - Intronic
1156171215 18:34488609-34488631 AAATGAAAAATAAAGGAGGGAGG - Intergenic
1156351354 18:36304021-36304043 AAAAGAAAGAAAAAGGTGGAAGG + Intronic
1156781456 18:40855507-40855529 AAAAGAAAGAAAGAGGAGGAGGG - Intergenic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1157043668 18:44069034-44069056 CAAGGAAAGAAAAGGAAGGAAGG - Intergenic
1157780889 18:50438194-50438216 CAATGACAGAATAGGGAGGTTGG + Intergenic
1158362733 18:56693866-56693888 CAAAAAAACAAAAAGTAGGCTGG - Intronic
1158548968 18:58418774-58418796 GAATGAAAAAAAGTGGAGGCTGG - Intergenic
1158569341 18:58583755-58583777 GAAAGAAAGAAAAAGGCGGGGGG + Intronic
1158844764 18:61430065-61430087 CAATGAAAAAAAAAAAAGCCAGG - Intronic
1158950726 18:62492494-62492516 CAAAGAAAGAAAAAGAAAGAAGG - Intergenic
1159076038 18:63682971-63682993 GAAAGAAAGAAAAAGAAGGAGGG - Intronic
1159313110 18:66736103-66736125 AAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1159343578 18:67169267-67169289 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1159899409 18:74030789-74030811 TCATAAAAGAAAAAGGTGGCTGG + Intergenic
1160199191 18:76782074-76782096 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1160228854 18:77031458-77031480 AAAGCTAAGAAAAAGGAGGCAGG + Intronic
1160459229 18:79025176-79025198 AAATGAAATAAAAATTAGGCGGG + Intergenic
1160510101 18:79448651-79448673 CAGAGAAATAAAAAGGGGGCAGG + Intronic
1161093224 19:2373794-2373816 CAAAGAAAGCAAAAGTTGGCCGG - Intergenic
1161246884 19:3257770-3257792 AAATAAAAAAAAATGGAGGCTGG - Intronic
1161350551 19:3788993-3789015 CCATGAAAGAAAGTTGAGGCCGG - Intronic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161775043 19:6256456-6256478 CAAAAAAAGAAAAAAAAGGCGGG + Intronic
1161845245 19:6708443-6708465 AAAGAAAAGAAAAAGAAGGCCGG - Intronic
1161999794 19:7736499-7736521 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1162136139 19:8556324-8556346 TAATTAAAAAAAAAAGAGGCCGG - Intronic
1162261438 19:9537588-9537610 CAATGAAAAAAAAAAAAAGCTGG - Intronic
1162330630 19:10027101-10027123 GAATGAAAGAAAGAGAAGGAAGG - Intergenic
1162458429 19:10799828-10799850 TAAAAAAAGAAAAAGCAGGCTGG - Intronic
1162567814 19:11453949-11453971 AAATGAAAAAAAAAGGGGGGTGG - Exonic
1162570474 19:11469078-11469100 CAAAGAAAAAAAAAGTAGCCAGG - Intronic
1162742419 19:12781004-12781026 AAAATAAAGAAAAAGAAGGCTGG + Intronic
1162776308 19:12981774-12981796 AAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1162814987 19:13188446-13188468 AAAAGAAAGTAAAAAGAGGCTGG - Intergenic
1163023987 19:14498948-14498970 CTTTAAAAGAAAAAAGAGGCCGG + Intergenic
1163140645 19:15345953-15345975 AAAAGAAAAAAAAAAGAGGCTGG + Intergenic
1163160513 19:15461417-15461439 GGAAGAAAGAAAAAGGAGGAGGG - Intronic
1163187687 19:15650650-15650672 GAAAGAAAGAAAAAGAAGGCAGG - Intronic
1163256536 19:16159398-16159420 AAAAGAAAGAAAAAGCTGGCCGG + Intergenic
1163286147 19:16349246-16349268 CAAAAAAAAAAAAAAGAGGCAGG + Intergenic
1163298498 19:16428393-16428415 GAAAGAAAGAAAAGGGAGGGAGG + Intronic
1163358831 19:16832492-16832514 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1163462828 19:17448885-17448907 TAAAACAAGAAAAAGGAGGCCGG + Intronic
1163462884 19:17449213-17449235 AAAATAAAGAGAAAGGAGGCCGG + Intronic
1163504251 19:17695484-17695506 GAAACAAAGAAAAAGGAGGGAGG + Intergenic
1164452327 19:28377527-28377549 AAAGAAAAGAAAAAAGAGGCTGG - Intergenic
1164517589 19:28949249-28949271 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1164559148 19:29276650-29276672 AAAGGAAAGAAAAAGGAGAAAGG - Intergenic
1164734036 19:30527211-30527233 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1165123035 19:33574792-33574814 AAAAGAGAGAGAAAGGAGGCAGG - Intergenic
1165171337 19:33894118-33894140 TAAAAAAAGAAAAAAGAGGCTGG - Intergenic
1165687710 19:37836626-37836648 AAAAGAAAGAAAAAGAATGCAGG + Intergenic
1165752093 19:38266377-38266399 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
1166126076 19:40716142-40716164 CAATGAGAGAAATCGAAGGCAGG - Intronic
1166559558 19:43723134-43723156 CAAAAAAAGAAAAAATAGGCTGG + Intergenic
1166860334 19:45806695-45806717 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1167069921 19:47215374-47215396 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1167103044 19:47415867-47415889 GAAAGAAAGAAAAAGAGGGCCGG - Intronic
1167123392 19:47532472-47532494 CAATGAAGGAAAACAGAGGAAGG - Intronic
1167143283 19:47666870-47666892 CAAAGAAGTAAAAAGGAGGGAGG - Intronic
1167177768 19:47877534-47877556 AAAAGAAAGAAAAAGAAGGCTGG - Intronic
1167203306 19:48082793-48082815 GAAAGAAAGAAAAAGCAAGCCGG - Intronic
1167256373 19:48432204-48432226 AAAAGAAAGAAAAAGAAGGCCGG - Intronic
1167353284 19:48989088-48989110 GAAAGAAAGAAAAAGGAGAGAGG - Intronic
1167429110 19:49444062-49444084 GAAGGAAAGAAAAGGCAGGCAGG - Intergenic
1167637591 19:50664099-50664121 AAAGAAAAGAAAAAGGAGGCTGG - Intronic
1167738141 19:51310174-51310196 CAGTGAAAGAACAGGGAGCCAGG + Intergenic
1167845972 19:52164408-52164430 GAAAGAAAGAGAAAGGAGGGAGG + Intronic
1167896199 19:52584456-52584478 TAAAGAAACAAAAAGCAGGCTGG - Exonic
1167904970 19:52651730-52651752 GAAGGAAAGAAAAAACAGGCTGG + Intronic
1168058083 19:53874618-53874640 GAAGGAAAGAAAAAGGTGGGAGG - Exonic
1168143884 19:54408460-54408482 CAATGAAGGAAGAAGGAAGGAGG + Intergenic
1168210604 19:54887322-54887344 CTAAAAAAGAAAAAAGAGGCTGG + Intronic
1168236745 19:55068537-55068559 CAAAAAAAGAAAGAGGAGGCCGG + Intronic
1168320249 19:55504791-55504813 CAGAGAAAGAAACAGGTGGCCGG - Intronic
1168350386 19:55672334-55672356 CCAGCAAAGAAAAAGGAGGGGGG - Intronic
1202671979 1_KI270709v1_random:63669-63691 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1202685702 1_KI270712v1_random:47902-47924 CAAAAAAAAAAAAAGGGGGCGGG + Intergenic
925228340 2:2206319-2206341 CAATAAAAGAAAAAGGTGAATGG - Intronic
926140375 2:10364578-10364600 AAAAAAAAAAAAAAGGAGGCGGG - Intronic
926262851 2:11283262-11283284 CAAAAAAAAAAAAAAGAGGCTGG + Intronic
926785797 2:16517330-16517352 CAATGAGGGACAAAGAAGGCTGG - Intergenic
927262264 2:21103151-21103173 CACTGATACAAACAGGAGGCAGG - Intergenic
927308868 2:21605520-21605542 CAATGATAGAACAAAAAGGCAGG - Intergenic
927493858 2:23539424-23539446 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927789407 2:25998717-25998739 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
927796519 2:26053995-26054017 AAAAGAAAGAAAAAGAAGCCGGG - Intronic
928536084 2:32243112-32243134 AAAAGAAAGAAAATTGAGGCTGG + Intronic
929065331 2:37967474-37967496 CAATCAAAGCAAAAGCAGACTGG + Intronic
929282818 2:40100954-40100976 CAAAGTATGTAAAAGGAGGCTGG - Intronic
929638456 2:43549741-43549763 CTATGAAAGAAAAATGAAGCAGG + Intronic
929693162 2:44091378-44091400 CAAGGGAAGAAAATGGAAGCTGG + Intergenic
929716121 2:44311738-44311760 CAATTCAAGAAATAGGAGGTTGG - Intronic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930050742 2:47214423-47214445 CAAAAAAAGAAAAAGGAAGAAGG + Intergenic
930308804 2:49712025-49712047 AAAAGAAAGAAAAATGAGACAGG - Intergenic
930333792 2:50019648-50019670 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
930616400 2:53598751-53598773 GAAAGAAAGAAAAAGAAGGAAGG + Intronic
930673710 2:54177874-54177896 AAAGAAAAGAAACAGGAGGCCGG - Intronic
931038886 2:58275002-58275024 GAATGAATGAAAAAGAAAGCTGG + Intergenic
931044385 2:58334002-58334024 CAATGGAAAAGAAAGGAGGAGGG - Intergenic
931435811 2:62245286-62245308 CGATAAAAGAAAAAGTAGGCTGG + Intergenic
931533341 2:63242850-63242872 AAAAGGAGGAAAAAGGAGGCAGG - Intronic
931960075 2:67472750-67472772 CTAAGAAAGAAAAAGTAGCCAGG + Intergenic
932296019 2:70623919-70623941 AAATGAAAGCAAAGAGAGGCTGG - Intronic
932472012 2:71965764-71965786 CAAAGCAAGAAAAATGAGGGAGG - Intergenic
932549821 2:72756806-72756828 AAATGAAGGAAAAAGGATGAGGG + Intronic
932602191 2:73135383-73135405 GAAAGAAAGAAAAAGAAGGAAGG + Intronic
932686380 2:73874011-73874033 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
933075344 2:77918381-77918403 CAATGAAAAAAAAGGGGTGCAGG + Intergenic
933300042 2:80531035-80531057 CAATGCAGGTAATAGGAGGCAGG + Intronic
933506535 2:83182927-83182949 CAATGGAATAAAAAAGAGACTGG + Intergenic
933683164 2:85121098-85121120 TAATAAAAAAAAAAAGAGGCTGG - Intergenic
933725473 2:85424402-85424424 GAAAGAAAGAAAAAGAAGGGAGG - Intronic
934260125 2:91466807-91466829 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
934303429 2:91798734-91798756 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
934329830 2:92054023-92054045 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
934468048 2:94283928-94283950 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
934509838 2:94928761-94928783 CAAAAAAAAAAAAAGGAGGGGGG + Intergenic
934525098 2:95046976-95046998 GAAAGAAAGAAAAAGAAGGAAGG + Intronic
934545569 2:95212163-95212185 TAGGGAAAGAAAAAGGAGTCTGG - Intronic
934585472 2:95489163-95489185 AAAAGAAAGAAAAAGAAGGAAGG + Intergenic
934593994 2:95587593-95587615 AAAAGAAAGAAAAAGAAGGAAGG - Intergenic
934673631 2:96233537-96233559 AATTGAAAAAAAATGGAGGCCGG - Intergenic
934879525 2:97963188-97963210 AAAGGAAAGAAAAAGAAAGCTGG + Intronic
934962339 2:98687688-98687710 GAAACAAAGAAAAAGGAGACAGG - Intronic
935165374 2:100564590-100564612 CATCAAAAGAAAAATGAGGCCGG - Intronic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935483603 2:103624114-103624136 CAATGTAACAAAAAGGTGGAAGG - Intergenic
935920404 2:108006514-108006536 CAATCAAAAAAATTGGAGGCTGG - Intronic
936547969 2:113409180-113409202 CAATGAAAAGAAGAGGAGGCAGG + Intergenic
936928077 2:117758443-117758465 GAAAGAAAGAAAAAAAAGGCTGG + Intergenic
937181018 2:119996526-119996548 CAAGGAAAGAAGAAGGAACCAGG + Intergenic
937716152 2:125035868-125035890 CAATGAAAAAAAAAGTATGTAGG - Intergenic
938295915 2:130179415-130179437 CAAAAAAAGAAAAAAGAGGCTGG - Intronic
938419949 2:131137241-131137263 CAAAAAAAGTAAAAAGAGGCCGG - Intronic
938529347 2:132167607-132167629 CAATTAAAATAAGAGGAGGCAGG - Intronic
938626483 2:133114672-133114694 CAAGGAAGGAAAAAAGAGGTGGG - Intronic
938784566 2:134614135-134614157 CAATGAAACAAAACAGAGACTGG + Intronic
939191359 2:138920260-138920282 GAATAAAAGAAAAAGGAAGGAGG - Intergenic
939497909 2:142946242-142946264 CAATGATACAAAAAGTAGCCAGG - Intronic
939527385 2:143314000-143314022 CAATAAAATTACAAGGAGGCTGG - Intronic
939715753 2:145581756-145581778 CAATGAAAGTACAATGAGGTAGG - Intergenic
940217004 2:151312127-151312149 AAGTGAAAGCAAAAAGAGGCTGG - Intergenic
941216847 2:162721856-162721878 CAATGAAGGAAAAATGATGGCGG + Intronic
941943911 2:171073878-171073900 GAAAGAAAAAAAAAGGAGGGGGG - Intronic
942157586 2:173147584-173147606 CAAAAAAAGAAAAAAAAGGCTGG - Intronic
942262310 2:174181012-174181034 CAAGGAATGTACAAGGAGGCTGG + Intronic
942724291 2:178989841-178989863 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
943043071 2:182825814-182825836 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
943063160 2:183060010-183060032 CAATGAAAGAAAATGTAGGTAGG + Intergenic
943070522 2:183135623-183135645 TAGTGATAGAAAAAGTAGGCAGG + Intronic
943158805 2:184219640-184219662 CAATGAAACAAGATGGAGGGAGG - Intergenic
943215633 2:185029975-185029997 CAATGAGAGAAAATGGACACAGG - Intergenic
943228748 2:185216453-185216475 GAAAGAAAGAGAAAGAAGGCAGG + Intergenic
943308127 2:186292529-186292551 CAAAAAAAGAAAAAGGATGCAGG + Intergenic
943608049 2:189999066-189999088 CAATAAAAGAAAAAATAGGCTGG - Intronic
943648694 2:190433892-190433914 TAAAGAAAGTGAAAGGAGGCAGG + Intronic
944376393 2:199048865-199048887 CAATAAAAAAAAAAGCAGCCAGG - Intergenic
944674302 2:202022342-202022364 CAATGAGAGCACATGGAGGCAGG + Intergenic
944711462 2:202338506-202338528 AAAACAAAGAAAAAGGAGGGAGG - Intergenic
944759110 2:202795005-202795027 TAATAAAAAAAAAAGGAGGGGGG + Intronic
944848232 2:203690408-203690430 CCAAGAAAGACAAAGGAGTCAGG - Intergenic
944906930 2:204271023-204271045 AAATGAAAGAAAACTGAGACAGG + Intergenic
945093809 2:206200426-206200448 CAAAGAAAGAAAAAGAATGGTGG + Intronic
945113121 2:206383122-206383144 AAATAAAAAGAAAAGGAGGCCGG - Intergenic
945825159 2:214712803-214712825 CAAAGAAAAAAAAGGGAGGGTGG - Intergenic
946144008 2:217714989-217715011 GAATGGAAGAGAGAGGAGGCTGG + Intronic
946303950 2:218845184-218845206 GAAAGAAAGAAAAAGGGGGGGGG + Intergenic
946454325 2:219811902-219811924 CAATGAAACAAAAAATAGGGTGG - Intergenic
946718453 2:222578541-222578563 ATGTAAAAGAAAAAGGAGGCCGG + Intronic
946872398 2:224096303-224096325 CAGTGAAAAAAAAAACAGGCAGG + Intergenic
947189182 2:227484061-227484083 CCATAAAAGAAAATGGAGGGTGG - Intronic
947206031 2:227661971-227661993 TAATGGAAGAAAAAAGAGGGTGG - Intergenic
948052316 2:234988056-234988078 CAAAGAAAAAAAAATGTGGCTGG - Intronic
948250889 2:236528011-236528033 GAAAGAAAGAAAAAGGGGGAGGG - Intergenic
948823508 2:240562380-240562402 TAGTAATAGAAAAAGGAGGCTGG - Exonic
948998791 2:241599911-241599933 CGAAGAAAGACAAACGAGGCTGG + Intronic
949008887 2:241667307-241667329 TCATGAAAGCAAAAGGGGGCGGG + Intronic
1168817926 20:753560-753582 CTATGAAAGAAACAGGAGAATGG + Intergenic
1169066603 20:2697556-2697578 GAAAGAAAGAAAAAGGGGGTAGG + Intronic
1169583719 20:7057263-7057285 CAAAGAAGGAAAAAGTAGGGTGG - Intergenic
1169592542 20:7161507-7161529 CAAAGAAAGAAAAAGGGTGAAGG + Intergenic
1169649303 20:7849220-7849242 CAAAGAGAGAGAAAGGAGGGAGG + Intergenic
1169941195 20:10939204-10939226 AAAGGAAAGAGAAATGAGGCTGG + Intergenic
1170011641 20:11729714-11729736 AAATGAAAGAAAAAAAATGCAGG + Intergenic
1170102279 20:12715327-12715349 GAATGAAGGAGAAAGGAGTCTGG - Intergenic
1170102600 20:12718946-12718968 AAATGAAAGATTAAGGAGGGAGG + Intergenic
1170176706 20:13479068-13479090 GAAAGAAAGAAAAGGGAGGATGG + Intronic
1170336394 20:15275021-15275043 CAATAATTGAAAAAGGAGGCTGG + Intronic
1170469123 20:16650634-16650656 CATTGAAATAGAAAGAAGGCAGG - Intergenic
1170951403 20:20939555-20939577 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1170989652 20:21290360-21290382 CAATGAATGAATAATGAGACGGG + Intergenic
1171206017 20:23282167-23282189 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1172056624 20:32158684-32158706 CATTGAAAGTGAAATGAGGCTGG + Intronic
1172352630 20:34255312-34255334 GGAAGAAAGAAAAAGGTGGCAGG - Intronic
1172439180 20:34953572-34953594 GAAAGAAAGAAAAAGAAGGAAGG - Intronic
1172570307 20:35964995-35965017 CTATGAAAGATATATGAGGCCGG - Intronic
1172570762 20:35968534-35968556 CAATGAAAGATTCTGGAGGCAGG - Intronic
1172643113 20:36453634-36453656 AAAAAAAAGAAAAAAGAGGCTGG + Intronic
1172655570 20:36535108-36535130 AAATGCAAAAAAAAGGAAGCTGG + Intergenic
1172740753 20:37164575-37164597 TAATGAAAAAGAAAAGAGGCTGG - Intronic
1172760921 20:37321009-37321031 CAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1172764648 20:37345149-37345171 CAAAGAAGGAATATGGAGGCAGG + Intronic
1172961618 20:38804581-38804603 CAGTGAAAAAAAAAGGATTCGGG + Intergenic
1172998556 20:39089365-39089387 GAAGGAAGGAAAAAGGAGGGGGG - Intergenic
1173102084 20:40096617-40096639 AAGTGAAAGCAAAAAGAGGCTGG - Intergenic
1173270840 20:41533299-41533321 AAACGGAAGAAAAAGGAGCCAGG - Exonic
1173272171 20:41547312-41547334 AAATGACAGAAAAACAAGGCTGG + Intronic
1173425476 20:42939446-42939468 GAAGGAAAGGAAAAGGAGGGGGG - Intronic
1173496842 20:43525621-43525643 CAACAATAGAAAAAGGAGGCAGG + Intronic
1173726424 20:45301365-45301387 CAGTGACAGAAATAGGAGCCTGG + Exonic
1173734686 20:45351235-45351257 ATATTAAAAAAAAAGGAGGCCGG - Intergenic
1174038027 20:47680102-47680124 CAAAAAAAGAAACAGGAGCCAGG - Intronic
1174234449 20:49077454-49077476 CAATAAAAGAAATAATAGGCAGG - Intronic
1174244357 20:49165337-49165359 CAAAAAAAGAAAAAATAGGCCGG - Intronic
1174463174 20:50697575-50697597 CAAAAAAATAAAAAGAAGGCCGG - Intergenic
1174817214 20:53697298-53697320 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1174828054 20:53786887-53786909 CAATGGATGAAAAAGCAGGAAGG + Intergenic
1175096380 20:56544520-56544542 CAATAAAAAAACAAGGCGGCTGG + Intergenic
1175101953 20:56585601-56585623 AAAAGAAAAAAAAAAGAGGCCGG + Intergenic
1175152398 20:56945571-56945593 TAATAAAAGAAAAGGGGGGCCGG + Intergenic
1175273990 20:57754904-57754926 GAAGGAAAAAAAAAGGAGGAAGG - Intergenic
1175363816 20:58436620-58436642 AAAATAAAGAAAAAGCAGGCTGG - Intronic
1177462714 21:21433802-21433824 AAAAGAGAGAAAAAGGAGGGTGG + Intronic
1177563978 21:22794868-22794890 AAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1177672825 21:24255763-24255785 CAAAGAATGCAAAAGCAGGCTGG + Intergenic
1177748079 21:25245535-25245557 CTATGAAAGACAAAGGAGTGTGG + Intergenic
1177955109 21:27588554-27588576 GAAAGAAAGAAAAAGGAGGAAGG + Intergenic
1178062972 21:28872529-28872551 CTATGAAAGAGAAAGGTGACAGG - Exonic
1178105982 21:29319699-29319721 CCAGGAAAGAATAAGGAGGCTGG + Intronic
1178240469 21:30893878-30893900 AAATGAAAGAAAAAGGGGAGTGG - Intergenic
1178290056 21:31359467-31359489 CAAAGAAAGAAAGAGAAGGTAGG + Intronic
1178538295 21:33428520-33428542 TAATGAAATGAAGAGGAGGCTGG - Intronic
1179068074 21:38044964-38044986 CAATGAAATACAAAGGATTCTGG + Intronic
1179107295 21:38413817-38413839 CAAAGAAAGAAAACCCAGGCAGG - Intronic
1179387740 21:40958237-40958259 AAGTGAAAGAAAAGAGAGGCTGG - Intergenic
1179538730 21:42070023-42070045 CAAGAATACAAAAAGGAGGCTGG - Intronic
1179664126 21:42898241-42898263 CAATGATTGAAAAACGAGGCAGG - Intronic
1179678725 21:43002701-43002723 AAATGAAAGAAAAAGGAACAAGG - Intronic
1179769873 21:43606480-43606502 CAATGGTAGGAAAAGGAGGCAGG + Intronic
1180206207 21:46262669-46262691 TAAAGAAATAAAAAGGAGGCCGG + Intronic
1180431728 22:15258650-15258672 CAATTAAAATAAGAGGAGGCAGG + Intergenic
1180514287 22:16126573-16126595 CAATTAAAATAAGAGGAGGCAGG + Intergenic
1180589690 22:16926583-16926605 CAATGAAAAAAAGAGGAGGCAGG - Intergenic
1180590460 22:16932810-16932832 CAGTGAATGAAAAAGGCTGCGGG + Intergenic
1180681556 22:17630572-17630594 AAAGAAAAGAAAAAGAAGGCCGG - Intronic
1180833314 22:18917362-18917384 CAAGGAAATAAAAGGGAAGCAGG + Intronic
1180840644 22:18957412-18957434 CAAGGAAAGGAAATGGGGGCTGG + Intergenic
1180861013 22:19082788-19082810 AAAGAAAAGAAAAAGGTGGCTGG + Intronic
1181060844 22:20281362-20281384 CAAGGAAAGGAAATGGGGGCTGG - Intronic
1181091930 22:20479389-20479411 CAAACAAACAAAAAGTAGGCCGG + Intronic
1181093020 22:20487214-20487236 CAAAAAAACAAAAAAGAGGCTGG - Intronic
1181599873 22:23943798-23943820 CCAAGAAAGAAAGTGGAGGCTGG + Intergenic
1181608632 22:23997517-23997539 CCAAGAAAGAAAGTGGAGGCTGG - Intergenic
1181704482 22:24641112-24641134 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1181882263 22:25990387-25990409 AAAATAAAGAAAAATGAGGCCGG + Intronic
1182102249 22:27666146-27666168 AAATTAAAGAAAAAGTAGCCAGG + Intergenic
1182227418 22:28809800-28809822 CAATTAATGGAAAAAGAGGCCGG + Intergenic
1182348966 22:29687778-29687800 GAAGGAAAGAAAAAGGAGTGGGG + Intronic
1182480064 22:30602516-30602538 AAATAAAAGAAAAAAGAGGCCGG - Intronic
1182960142 22:34464295-34464317 CAAAGAAAGAAGAACAAGGCAGG - Intergenic
1182975403 22:34619627-34619649 CAATGAAAGCATAAAGAGTCTGG + Intergenic
1183134599 22:35874477-35874499 GAATGAAAGAAAAAGAAGGATGG + Intronic
1183295970 22:37029764-37029786 AAATAAAACAGAAAGGAGGCGGG - Exonic
1183364015 22:37397740-37397762 CAATGTAAGAAGAAGTGGGCAGG - Intronic
1183452161 22:37902636-37902658 CAAGTAAACAACAAGGAGGCCGG - Intergenic
1183691707 22:39393563-39393585 TAAAGAAAAGAAAAGGAGGCTGG - Intergenic
1184040085 22:41937840-41937862 CAAAGAAAAAAAAAGGAGTGGGG - Intergenic
1184309631 22:43632879-43632901 CCAGGAAACAAAAAAGAGGCAGG - Intronic
1184323555 22:43763333-43763355 CAATTAAAAAAAAAGATGGCCGG - Intronic
1184794679 22:46725025-46725047 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1184868109 22:47214807-47214829 GAATGAAAGAAAAATGAGAAAGG - Intergenic
1185031149 22:48443648-48443670 GAAAGAAAGAAAAGGGAGGAAGG + Intergenic
1185090466 22:48765995-48766017 CAATGAAATAGAAAAGAGACAGG - Intronic
1185203746 22:49524429-49524451 CAATGAATGAAAAAGGGAGGAGG + Intronic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1203283400 22_KI270734v1_random:142666-142688 CAAGGAAATAAAAGGGAAGCAGG + Intergenic
949180113 3:1118903-1118925 AAATAAAAGAAAAAGGAGAGAGG - Intronic
950269122 3:11599296-11599318 CAATAAAAGAAAAATGAGGGGGG + Intronic
950382186 3:12625967-12625989 CATTAAAAAAAAAAGTAGGCCGG + Intronic
950717347 3:14858623-14858645 GAATGAATGAAAAACCAGGCAGG + Intronic
950729593 3:14946458-14946480 CAACGTCAGAAAAAGGAGGAAGG + Intergenic
950743975 3:15072433-15072455 CAATGAACCAAAAAGGAAGAAGG + Exonic
950935110 3:16831681-16831703 GAAAGAAAGAAAAAAGAGGGAGG + Intronic
951051956 3:18103819-18103841 CATAGAAAGAAAAAGGAGTAGGG - Intronic
951309169 3:21102962-21102984 CAATGAAAAAAAAAGGCTTCAGG - Intergenic
951686523 3:25350526-25350548 CTATGAAGAAAAAAGGAGGCAGG - Intronic
951847304 3:27098071-27098093 AAATGAAAGCAGAAAGAGGCAGG + Intergenic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
952088088 3:29850903-29850925 CAATGAATGAAAAAGGGGGAGGG - Intronic
952102811 3:30034650-30034672 AAAAGAAAGAAAAGGGAGGGAGG + Intergenic
952263878 3:31766911-31766933 AAATGAAAGAAAGAGGAGGTGGG - Intronic
952314899 3:32224091-32224113 CAAGAAAAGAAAAAGGAGTGGGG + Intergenic
952582481 3:34851168-34851190 CAAAGCAAGAAAAAATAGGCTGG + Intergenic
952585798 3:34890247-34890269 AAAAGAAAGAAAAAGAAGGAAGG - Intergenic
953370698 3:42386091-42386113 GAAAGAAAAAAAAAGGATGCAGG - Intergenic
953502717 3:43453477-43453499 CAATAAAAGAAAAAGAAGATAGG - Intronic
953573354 3:44091859-44091881 GCAATAAAGAAAAAGGAGGCAGG - Intergenic
954189617 3:48948255-48948277 AAATAAAATAAAAAGGAGGCCGG - Intronic
954356736 3:50088299-50088321 CTAAAAAATAAAAAGGAGGCCGG - Intronic
954552775 3:51495993-51496015 CAAGGAAAAAAAAAAAAGGCCGG + Intronic
954776119 3:53020101-53020123 CAAGAAAAAAAAAAGTAGGCCGG + Intronic
954959446 3:54551136-54551158 GCAGGAAATAAAAAGGAGGCTGG - Intronic
955534618 3:59909777-59909799 CAATGAATGAAAAAGAACACAGG + Intronic
955573980 3:60338844-60338866 GAATTAAAGAGAAAAGAGGCTGG + Intronic
955704590 3:61715161-61715183 CAAAGAAAAAAAAAGCAAGCAGG - Intronic
955756299 3:62228224-62228246 AAAACAAAGAAAAAGGAGGCTGG + Intronic
955757107 3:62236257-62236279 CAATAAAAGAAAAAGGCTGTAGG - Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956286461 3:67615139-67615161 AAAAGAATGAAAAATGAGGCAGG + Intronic
956542694 3:70360205-70360227 GAATGAAACAAAATGGTGGCGGG - Intergenic
956593082 3:70936160-70936182 GACTGAAAGAGAAATGAGGCTGG - Intergenic
956846410 3:73187633-73187655 CAATAAAAGAAAAAGAAGAGGGG - Intergenic
957049772 3:75402387-75402409 CAAAAAAAAAAAAAGGAGGAAGG + Intergenic
957146590 3:76432830-76432852 CAGTGAGAGAAAAAAGAGGAAGG + Intronic
957261774 3:77910888-77910910 CAATGAAAGAGAAATGAAGCAGG + Intergenic
957325521 3:78687925-78687947 CAATAAAACAAAAACGCGGCTGG - Intronic
957335991 3:78830145-78830167 CATAGAAAGAAAAACGAGACTGG - Intronic
957376569 3:79366434-79366456 CAAAGTCAGAAAGAGGAGGCTGG - Intronic
958005289 3:87802248-87802270 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
958737380 3:98024741-98024763 CAATGAAAGAAGAATCAGGATGG + Intronic
958929479 3:100193669-100193691 CAAAAAAAGAAAAATTAGGCTGG - Intronic
959069431 3:101688587-101688609 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
959119752 3:102219386-102219408 AAAAGAAAGAAAAAAGAAGCTGG - Intronic
959658832 3:108842529-108842551 CATTGAAACAAACAGGAGGCTGG - Intronic
959877983 3:111408603-111408625 CAATGAAAAAAAAAGTATTCAGG + Intronic
959932087 3:111996172-111996194 CATAGAAAGAAAAATGAGGCTGG - Intergenic
959936664 3:112036566-112036588 CAAAAAAAAAAAAAGGAGGGGGG + Intronic
960189390 3:114685007-114685029 GCATAAAAGAAAAAGGAAGCGGG - Intronic
960190334 3:114696748-114696770 CAATGAAAGAAAAGGGGGAGGGG + Intronic
960547072 3:118927617-118927639 CAACGAAGGAAAAAGAAAGCGGG + Intronic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
961588028 3:127950733-127950755 CAAATAAAGAAAAATGAGGCCGG + Intronic
961865940 3:129953531-129953553 GAAAGAAAGAAAAAGAAGGGAGG - Intergenic
961974650 3:131010488-131010510 TAAAGATAGAAAAAGGTGGCCGG - Intronic
961984036 3:131113614-131113636 GAAAAAAAGAAAAAGCAGGCCGG + Intronic
961986885 3:131144237-131144259 CAAGCAATGAAAAAGAAGGCTGG - Intronic
962694059 3:137930245-137930267 GAAAGAAAGAAAAAGGAGGGAGG + Intergenic
962748618 3:138416691-138416713 AAGTGAAAGAAAAAGGAGGAGGG - Intergenic
963129813 3:141847713-141847735 CGATGAAGGAAAAAGGAGTTAGG + Intergenic
963163834 3:142180596-142180618 CAAAGAAAGAGAAAGAAGGCTGG - Intronic
963398198 3:144760094-144760116 CTATGAAAAAAAAAGGAGGCTGG - Intergenic
963531070 3:146473993-146474015 CAATAACAGAGAAAGGAGGCTGG - Intronic
963542469 3:146610425-146610447 GAATGAAAGAAAAAGAATCCTGG + Intergenic
963810769 3:149774267-149774289 GAATGAATGACAAAAGAGGCAGG - Intronic
963814473 3:149813780-149813802 CAGGGAAAGAAAAAGGGGGTGGG - Intronic
963835017 3:150049427-150049449 TAATGAAAGAAAAAAGAGAAAGG + Intronic
964093884 3:152908848-152908870 TAATAAAAGAATAAGAAGGCTGG - Intergenic
964094065 3:152911246-152911268 CAAAGATTGAAATAGGAGGCAGG - Intergenic
964286877 3:155127494-155127516 CAACTAAATATAAAGGAGGCAGG + Intronic
964420626 3:156498964-156498986 CAGTCAAAGAAAAAGCAGACTGG + Intronic
964446057 3:156759120-156759142 CAATGAAATAAATATGAGTCTGG + Intergenic
964496157 3:157292685-157292707 TAAAAAAAGAAAAAAGAGGCCGG + Intronic
964525692 3:157613579-157613601 CGAGGAAAGGAAAAGGAGGGAGG + Intronic
964630516 3:158804929-158804951 GAATGAAAGAGAAAGGAAGTAGG + Intronic
964779069 3:160315103-160315125 GAAAGAAAGAAAGAGGAGGGAGG + Intronic
964791505 3:160457332-160457354 TATAGAAAAAAAAAGGAGGCCGG + Intronic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965355693 3:167670383-167670405 CAAAAAAAGAAAAAGCTGGCCGG + Intergenic
965484135 3:169257923-169257945 CAGTGTAAGAAAAAGTAGCCGGG + Intronic
965530552 3:169766201-169766223 CTATGAAAGAAAAAGGGGATGGG - Intergenic
965663149 3:171063675-171063697 GAAGGAGAGAAAAAGGTGGCAGG - Exonic
965755760 3:172025586-172025608 AAATGAAATAAAAACAAGGCAGG - Intergenic
965832153 3:172804103-172804125 ACTTTAAAGAAAAAGGAGGCAGG - Intronic
965919352 3:173893836-173893858 CGATGACATAAAAAGGAGGTTGG - Intronic
966142229 3:176769494-176769516 AAAAGAAAGAAAGAGGAGGGAGG + Intergenic
966160279 3:176960183-176960205 CAACGGAAGAGAAAGGGGGCGGG + Intergenic
966247108 3:177821378-177821400 GAAAGAAAGAAAGAAGAGGCCGG + Intergenic
966351714 3:179038415-179038437 TAAAAAAAGAAAAATGAGGCAGG + Intronic
967141903 3:186568602-186568624 GGATGAAAAAAATAGGAGGCCGG + Intronic
967180832 3:186902463-186902485 TAAAAAAAAAAAAAGGAGGCTGG + Intergenic
967218823 3:187232230-187232252 CAAGGAAAAAAAAAGGGGGGGGG - Intronic
967363725 3:188661853-188661875 GAATGAAAGAAAAATGAGTTAGG - Intronic
967399431 3:189044256-189044278 CAAAGAAAAAAAAATGTGGCCGG + Intronic
967599200 3:191364361-191364383 GAAAAAAAAAAAAAGGAGGCCGG - Intronic
967631642 3:191749799-191749821 AAAAGAAAGAAAAAGGAAGAAGG + Intergenic
967728321 3:192882730-192882752 CAAAGAAAAAAAAAGGAAACTGG - Intronic
967817390 3:193810943-193810965 CAAAGAAAGAAATATGAGACTGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968170674 3:196507275-196507297 CAGTGATAGCAATAGGAGGCAGG - Exonic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968679486 4:1906955-1906977 CAAAGAAAGAGAGATGAGGCCGG - Intronic
968881973 4:3305611-3305633 AAATGAGGGAAAATGGAGGCAGG + Intronic
970125799 4:12809182-12809204 CAATCAAAGAAAAAGAAAGAAGG + Intergenic
970343379 4:15130048-15130070 TACTGAGAGAGAAAGGAGGCAGG - Intergenic
970417360 4:15872742-15872764 GATAGAAAGAAAAAGGGGGCCGG + Intergenic
970617221 4:17780010-17780032 CAAGGAATGAAAAAAGAGACTGG - Intronic
970769831 4:19598269-19598291 AAATGAAAGATAAAAAAGGCAGG - Intergenic
971040276 4:22744252-22744274 AAAAGAAAGAAAATGGAGGAAGG - Intergenic
971394276 4:26214266-26214288 GAAAGAAAGAGAAAGGAGGAAGG + Intronic
971468538 4:26992614-26992636 TAATGAAACAAAAAGGTGGAGGG + Intronic
971562629 4:28100641-28100663 GAATAAAAAAAAAAAGAGGCCGG - Intergenic
971834853 4:31749507-31749529 GAATGAAAGAAAATGAAGGAGGG - Intergenic
971842235 4:31868425-31868447 GAAAGAAAGAGAAAGGAGGGAGG - Intergenic
972518801 4:39834233-39834255 CAGTGAAAGGAAAAGCAGACTGG + Intronic
972610593 4:40652172-40652194 CACAAAAAGAAAAAAGAGGCCGG + Intergenic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
973830112 4:54750714-54750736 CAATCAAAGAAAAAGAAATCAGG + Intergenic
973890880 4:55366161-55366183 TAATGCAGGAAAAGGGAGGCAGG - Intronic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
974852386 4:67419747-67419769 AAATGAGAGAAAATGGGGGCCGG + Intergenic
975065821 4:70062222-70062244 AAATGAAAGTAAAAGCATGCTGG - Intergenic
975127215 4:70796327-70796349 CAATCAAAGCAAAAGCAGACGGG - Intronic
975569937 4:75805358-75805380 CAAGGAAAAAAAAAAAAGGCAGG - Intronic
975950419 4:79763562-79763584 GAAAGGAAGAAAAAGGTGGCAGG + Intergenic
976355362 4:84110881-84110903 CAAGGGAGGAAAAAGGAGGAAGG - Intergenic
976839407 4:89413839-89413861 CTAAGAAAAAAAAAGCAGGCTGG - Intergenic
977451329 4:97201727-97201749 TAATAAAAGAAAAATGGGGCTGG - Intronic
977455329 4:97252510-97252532 GAAGGGAAGAAAAAGGAGGGTGG - Intronic
977457318 4:97277774-97277796 AAAAGAAAGAAAAAGAAGTCAGG + Intronic
977817751 4:101434870-101434892 CAGTGTAAGAAAATTGAGGCTGG - Intronic
978131811 4:105207467-105207489 CATTGAAGGAGAAAGGAGGAGGG + Intronic
978160680 4:105544232-105544254 GAATAAAAGAAACAGGAAGCTGG + Intergenic
979282522 4:118883747-118883769 CAAATAAAATAAAAGGAGGCGGG + Intronic
980270740 4:130580973-130580995 GAAAGAAAGAAAAAGGAAGTGGG + Intergenic
980276854 4:130664176-130664198 AAATGAAAAAACAAGGAGGGGGG - Intergenic
980467368 4:133203300-133203322 AAAAGAAAGAAAAAGAAGGAAGG - Intronic
980648431 4:135676835-135676857 AAATCAAACAAAAAAGAGGCAGG + Intergenic
980770497 4:137365520-137365542 CAATATAAGAGAAAGGAGGGAGG + Intergenic
980795164 4:137673305-137673327 GAAGGAAAAAAAAAGGAGGGTGG - Intergenic
980872988 4:138631493-138631515 CAAAGTAAGAAAAAGAAGGAAGG - Intergenic
981923551 4:150113692-150113714 CAATGAAAAAAAAAAAAGGTTGG - Intronic
982297152 4:153840957-153840979 CAAGGCAAGAAAAATGTGGCTGG - Intergenic
982328552 4:154156079-154156101 ATAAGAAAGAAAAAAGAGGCCGG - Intergenic
982368151 4:154603282-154603304 AAATTAAAGAAAAATTAGGCAGG + Intergenic
982485704 4:155963052-155963074 CAATGAAAGAAAATGGGAGATGG - Intergenic
983067699 4:163230071-163230093 GAAAGAAAGAAAGAGGAGGGAGG + Intergenic
983453335 4:167933139-167933161 GAATAAAGGAAAATGGAGGCAGG + Intergenic
983490881 4:168387628-168387650 GAATGAAGGAAGAAGGATGCTGG + Intronic
983822137 4:172207999-172208021 CAATGAAAGAAGACGGAGTGAGG + Intronic
983923967 4:173376261-173376283 CAATGAAAAAGCAAGGAAGCAGG + Intronic
984140926 4:176002570-176002592 TAATGAAAGTGAAAGGGGGCAGG - Intronic
984281660 4:177678061-177678083 GAAAGAAAGAAAAAGTAGGAAGG - Intergenic
984339658 4:178440042-178440064 AAAGGAAAGAAAAAAGAAGCTGG + Intergenic
984455751 4:179965985-179966007 GAATGGAAGAAAAAGTGGGCTGG + Intergenic
984764038 4:183385897-183385919 TAAGGAAAAAAAAAGAAGGCTGG + Intergenic
984766857 4:183406476-183406498 TAAAAAAATAAAAAGGAGGCCGG + Intergenic
984879890 4:184401471-184401493 AAATTAAAGAAAAGGCAGGCAGG + Intronic
985068908 4:186149466-186149488 TAATGAAAGAAAGAGGAAGCAGG + Intronic
985211292 4:187598271-187598293 CAATTTAAAAAATAGGAGGCTGG + Intergenic
985219217 4:187685138-187685160 TAAAGAAAGAAAAAGAAGGAAGG - Intergenic
985504422 5:271006-271028 AAAAGAAAGCAAAAGCAGGCCGG - Intergenic
986154002 5:5155726-5155748 GAATGACAGGAACAGGAGGCAGG + Intronic
986393663 5:7306741-7306763 AGATGAAAGGGAAAGGAGGCGGG + Intergenic
987261221 5:16205404-16205426 CAAAGGAAGAAAATGGAAGCTGG - Intergenic
987549010 5:19353805-19353827 GAAAGAAAGAAAAAGCAGGAAGG + Intergenic
988189927 5:27917022-27917044 GAAGGAAAGAAAAATGATGCTGG - Intergenic
988710716 5:33771812-33771834 GAAAGAAAGAAAAAGGATGAGGG - Intronic
988898492 5:35704190-35704212 AGATGAAAGAACAAGGTGGCTGG - Intronic
988976779 5:36523927-36523949 CAATGAAAGAATCAGTAGGAGGG - Intergenic
989120178 5:37997282-37997304 CAAGAGGAGAAAAAGGAGGCAGG - Intergenic
989511390 5:42291763-42291785 CAAAGGAAAAAAAAAGAGGCAGG + Intergenic
989662907 5:43818590-43818612 CCATGAAAGAGAAAGAAGGAAGG - Intergenic
989746272 5:44834026-44834048 CAATGAATGAGAAAGGGGGAGGG - Intergenic
990366201 5:55072928-55072950 CAATGAAACACAAAGGATGTGGG - Intergenic
990406276 5:55494045-55494067 CAAAGAAAGAAAAAGGATTATGG + Intronic
990515992 5:56531369-56531391 CAATGAAGGAAAGAAGAAGCGGG - Intronic
990760539 5:59124802-59124824 GGATGGAAGAAAAATGAGGCTGG + Intronic
991266749 5:64728895-64728917 TATTTAAAGAAAAAGCAGGCTGG + Intronic
991442059 5:66661174-66661196 CAATGAAGGAAACATGAGGTGGG + Intronic
991492412 5:67195933-67195955 TAATGAGAGAAAAAGGAGAAGGG - Intronic
991704834 5:69348231-69348253 AAAAAAAAGAAAAAAGAGGCTGG - Intergenic
991766200 5:69983008-69983030 AAATAAAAAAAAAAGGAGCCAGG + Intergenic
991781119 5:70135146-70135168 AAATAAAAAAAAAAGGAGCCAGG - Intergenic
991873564 5:71135460-71135482 AAATAAAAAAAAAAGGAGCCAGG - Intergenic
991902797 5:71477141-71477163 AAAGGAAAGGAAAAAGAGGCTGG - Intronic
992019385 5:72607186-72607208 GAATGAAAGAAATAGGAAGGGGG + Intergenic
992039134 5:72811704-72811726 CAATAAAAGAAAAAGTAAACAGG - Intergenic
992170880 5:74100877-74100899 CAGTGAAAGGAAAAGCAGACTGG - Intergenic
992341401 5:75827159-75827181 CAATGAAACTAGAAGAAGGCTGG - Intergenic
992366364 5:76094306-76094328 CAATGAATGAAAAGGGATACAGG - Intronic
992415409 5:76548018-76548040 AAATGAAATTAAAAGGAGGTAGG - Intronic
992437831 5:76772520-76772542 CAATAAAAAAAAAAGGAGCGGGG + Intergenic
992654930 5:78899938-78899960 CAATGAAAGACAAAACAAGCTGG - Intronic
992729952 5:79654133-79654155 GAGTTAATGAAAAAGGAGGCCGG + Intronic
992781087 5:80128557-80128579 CAGTGAAGAAAAGAGGAGGCAGG + Intronic
992816921 5:80451110-80451132 CACTGAAAAATCAAGGAGGCAGG - Intronic
992941440 5:81766299-81766321 GAATGGAGGAAAAAGGAGGAAGG + Intergenic
993113238 5:83685680-83685702 CAATGAATGAATAAGGAGATTGG + Intronic
993249648 5:85503257-85503279 CGTTGAAACAAAGAGGAGGCAGG - Intergenic
993283562 5:85959951-85959973 GAAAGAGAGAAAAAGGAGGGAGG - Intergenic
993301968 5:86222993-86223015 GAATGATAGAAAACAGAGGCTGG + Intergenic
993388813 5:87292595-87292617 CATTGAAAGAAAAAGTCGGAGGG - Intronic
994173153 5:96680473-96680495 CAAACAAAGAAAAAAGATGCAGG - Intronic
994706289 5:103210601-103210623 CTATGAAAGAAAAGGGAGCTAGG - Intronic
995213358 5:109566640-109566662 CACTGAAAAACAGAGGAGGCTGG + Intergenic
995235861 5:109829531-109829553 CAATCAAAGCAAAAGAAGACTGG - Intronic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
995602108 5:113808605-113808627 CAATAAAAGAAAGAGCAGGAGGG - Intergenic
995731488 5:115247743-115247765 CAATTAAAGAAAAGGCAGACAGG + Intronic
995818917 5:116204423-116204445 AAAAGAAAAAAAAAGGAGGATGG - Intronic
996406100 5:123105681-123105703 GAATGAAAGAAAAAGAACGAAGG - Intronic
996941626 5:129013252-129013274 CAAAGAAACAAAAAGCAGGAAGG - Intronic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
996979374 5:129471437-129471459 GAAAGAAAGAAAAAGAAGGAAGG + Intronic
997062304 5:130521647-130521669 CAATGGCAGAAAAATGAGGGAGG + Intergenic
997076946 5:130690125-130690147 CAAAGAGATAAAAAGGAGGAGGG + Intergenic
997256723 5:132434685-132434707 CTATGAAAGATAAAGGAGAAAGG + Intronic
997507729 5:134431618-134431640 AAAAGAAAGAAAAAGAAGGTAGG - Intergenic
997533805 5:134600027-134600049 AAAAAAAAGAAAAAGAAGGCTGG + Intergenic
997571480 5:134931196-134931218 AAAAAAAAGAAAAAGAAGGCCGG - Intronic
997929756 5:138062525-138062547 AAAAGAAAGAAAAATCAGGCCGG + Intergenic
997965904 5:138355995-138356017 AAATGAAAGAAAAAAAAGGCAGG - Intronic
997969153 5:138386137-138386159 CAAAGAAATTAAAAGGAGACAGG + Exonic
998110596 5:139499365-139499387 TAACAAAAGAAAAAGTAGGCTGG - Intergenic
998261303 5:140633738-140633760 CAAGGAAAAAAAAAGGAAGGGGG - Intergenic
998740909 5:145200285-145200307 CAATTAAATAAAAATGAGGTGGG - Intergenic
999513101 5:152273343-152273365 CCATGAAAGAAAAGGAAGGAAGG + Intergenic
999791552 5:154944496-154944518 CAATGAAAGAATACAGAGACAGG - Intronic
999964471 5:156793954-156793976 AACTGAAAGAAAAAAGAGGGTGG + Intergenic
1000289676 5:159858735-159858757 CAATGACAGAAGAAGGTGGCAGG + Intergenic
1000308652 5:160019881-160019903 AAATGAAAGAAAAGGGAGGCAGG - Intronic
1000569046 5:162887739-162887761 CAAAGCAAGAAAAAGCAGACAGG + Intergenic
1000606565 5:163333855-163333877 CAAGGAAAGAGAAAGGAGATAGG - Intergenic
1000717897 5:164669409-164669431 CTATTAAAGAATAAGGAGACTGG - Intergenic
1000735852 5:164899495-164899517 AAAGGAAAGAAAGAGGAGGCAGG - Intergenic
1001220048 5:169892848-169892870 CAATAAAAGAGAAAGGAGAGAGG - Intronic
1001468664 5:171992131-171992153 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1001937894 5:175718863-175718885 TAATGAAAGACCAAGGAGGATGG - Intergenic
1001957837 5:175860552-175860574 GAAAGAAAGAAAAAGAAGGGAGG + Intronic
1002041168 5:176515376-176515398 AAAAAAAAGAAAAAGCAGGCCGG - Intergenic
1002134958 5:177101728-177101750 AAAAGAAAAAAAAAGAAGGCCGG + Intergenic
1002335395 5:178474272-178474294 CAAGGAAAGAAGAACTAGGCGGG - Intronic
1002663347 5:180805453-180805475 CAGTAAAAGTAAAAGCAGGCTGG + Intronic
1003307050 6:4939085-4939107 AAATGAAAGAAAACGTAGACTGG + Intronic
1003517284 6:6827593-6827615 TTGTGAAAGAAAAAGGAGGCCGG + Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003590670 6:7433947-7433969 AAAAGAAAGAAAAATCAGGCTGG - Intergenic
1003714225 6:8628420-8628442 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1003973418 6:11321082-11321104 GAATGAAAGAAAAAGAGGGAGGG + Intronic
1004040894 6:11974115-11974137 TAATGAAAGAAAAAGAATGATGG + Intergenic
1004067534 6:12263483-12263505 AAAGGAATGAAAAATGAGGCTGG - Intergenic
1004117983 6:12789924-12789946 CAGTGAAAGAAAAAGAGGGAGGG - Intronic
1004582708 6:16969969-16969991 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1004740291 6:18453432-18453454 CAAACAAAAAAAAAGCAGGCTGG - Intronic
1004788744 6:18999396-18999418 CAATGTAAGAAGATGGATGCTGG - Intergenic
1005040537 6:21596066-21596088 AAAAGAAAGAAAAAGTAAGCAGG + Exonic
1005062783 6:21792637-21792659 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1005286214 6:24329810-24329832 GAATGAATAAAAAAGGGGGCAGG + Intronic
1005492461 6:26359408-26359430 CAATAAAAGAAGAAAGAGGCTGG - Intergenic
1005749351 6:28868667-28868689 GAATGTAAGAAATGGGAGGCAGG - Intergenic
1005904179 6:30246487-30246509 CAATATAAGAAAAAATAGGCTGG - Intergenic
1005938325 6:30542054-30542076 CAATGAAAGAAAAAAATGGAGGG - Exonic
1005961062 6:30693466-30693488 CAACAAAAAAAAAAGGAGCCGGG + Intergenic
1006244102 6:32715164-32715186 GAATTAACGAAAGAGGAGGCCGG + Intergenic
1006400268 6:33813508-33813530 CAATGGGAGGAAGAGGAGGCTGG - Intergenic
1006645059 6:35510050-35510072 AAAAAAAAGAAAAAGAAGGCAGG - Intronic
1007043011 6:38742595-38742617 GAAAGAAAGAAAAAGAAGCCAGG - Intronic
1007177731 6:39908266-39908288 CTAGGAAAGAAAAAGCAGGGGGG - Intronic
1007458953 6:42002864-42002886 AAAAGAAAGAAAAGAGAGGCCGG + Intronic
1007606366 6:43120876-43120898 CAATGAATGAAAAATGCAGCTGG - Intronic
1007624185 6:43233697-43233719 GAAAGAAAGAAAAAGAAGACTGG - Intergenic
1007671443 6:43557796-43557818 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1007850812 6:44801126-44801148 GGAGGAAATAAAAAGGAGGCTGG + Intergenic
1007930979 6:45690264-45690286 GGAAGAAAGATAAAGGAGGCTGG - Intergenic
1008073375 6:47119944-47119966 TAATAATAGAAAAAGGAGGAGGG + Intergenic
1008610106 6:53177805-53177827 CGAAAAAAGAAAAAGTAGGCCGG - Intergenic
1008759337 6:54834919-54834941 CATTTAAAAAAAAAGCAGGCCGG - Intergenic
1009473979 6:64064125-64064147 TAATGAAAGAAACATGATGCAGG - Intronic
1009901209 6:69809838-69809860 GAATGAAAGAAAGAGGAAGGAGG + Intergenic
1009965083 6:70569258-70569280 CAAAGAAAGAAAAAAGAGGCCGG - Intronic
1010049498 6:71485769-71485791 CAATAAAAGAAAATAGGGGCTGG - Intergenic
1010219764 6:73438361-73438383 AAATGAAAGAAAGTGAAGGCTGG - Intronic
1010583304 6:77626512-77626534 CAATAAAAGAAACAGGATGGTGG - Intergenic
1010634352 6:78239543-78239565 CAATGATACAAACAGGAGGTAGG + Intergenic
1010776689 6:79894669-79894691 CAATGAGTGAAAGAGGAGGAAGG - Intergenic
1010935999 6:81862286-81862308 CCATGCAAGATAAAGGAGGATGG - Intergenic
1011198505 6:84807800-84807822 AAATGAAAGCAAAAAAAGGCTGG - Intergenic
1011261264 6:85472162-85472184 CAAGGAAAGGAAGAAGAGGCTGG + Intronic
1011262291 6:85482354-85482376 GAAAGAAAGAAAAAAGAGGAAGG + Intronic
1011290836 6:85775501-85775523 CAATGGAAACAAAAAGAGGCAGG - Intergenic
1011659032 6:89578278-89578300 AAAAAAAAAAAAAAGGAGGCGGG - Intronic
1011695743 6:89911211-89911233 AAAAGAGAGAAAAAGGAGGGAGG - Intergenic
1011828765 6:91343121-91343143 AAATGAAAGAAAAAGGAGTTTGG - Intergenic
1011952951 6:92990467-92990489 GAAAGAAAGAGAAAGCAGGCAGG - Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012117795 6:95326005-95326027 GAAAGAAAGAAAAAAGAGCCTGG + Intergenic
1012217842 6:96610254-96610276 CAATGAAATAGAACAGAGGCAGG - Intronic
1012257976 6:97056072-97056094 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
1012613028 6:101239439-101239461 CAAGTGAAAAAAAAGGAGGCCGG + Intergenic
1013229104 6:108145293-108145315 AAAAGAAAGAAAGAAGAGGCAGG + Intronic
1013291641 6:108724776-108724798 CAATGGAACAAAATGGAGTCTGG + Intergenic
1013533376 6:111040726-111040748 AAATGAAAAAAGAAGGAGGAAGG + Intergenic
1013575018 6:111474340-111474362 CAATGAGAGGACAAGGAAGCAGG - Intronic
1013636788 6:112036667-112036689 CAAAGAAAGAGAAAAGAAGCAGG - Intergenic
1013696731 6:112711213-112711235 CAATAAAAGCAAGAGCAGGCTGG + Intergenic
1013840476 6:114386641-114386663 CAAAGAGAGGAAAAGGAGGGAGG + Intergenic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014106774 6:117573416-117573438 TAAAGAAAGAAAGAAGAGGCTGG + Intronic
1014345218 6:120261903-120261925 AAATGAAAGAAAAAAGAAACGGG + Intergenic
1014635355 6:123839733-123839755 CCATGAATCAAAAAGGAGACTGG - Intronic
1014705044 6:124735858-124735880 GTATGAAAGAATAGGGAGGCTGG - Intronic
1014748014 6:125222541-125222563 GAAGGAAACAAAGAGGAGGCTGG - Intronic
1014888826 6:126816458-126816480 GAAGGAAAGAAAAAGAAGGAAGG - Intergenic
1014891718 6:126852032-126852054 AAGTGAAAGAAAATAGAGGCTGG - Intergenic
1015233078 6:130938901-130938923 CAGAGGAAGAAAAAGTAGGCAGG + Intronic
1015556808 6:134470878-134470900 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1015832286 6:137383537-137383559 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1015844983 6:137510937-137510959 CAATAAAACAAAAATGAGGCTGG - Intergenic
1016191155 6:141266615-141266637 CACTGAAAGAAAAAGGAAGTCGG + Intergenic
1016811468 6:148265306-148265328 CCAAGAAAGAAAAAGGAGGGAGG + Intergenic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1017354011 6:153480851-153480873 CCATTAAAGAAAAAGGAGAAGGG + Intergenic
1017614133 6:156226980-156227002 AAAAGAAAGAAAATCGAGGCCGG + Intergenic
1017635696 6:156440961-156440983 GAAAGAAAGAGAAAGGAGGGAGG + Intergenic
1018135885 6:160778168-160778190 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1018153833 6:160966292-160966314 GAAAGAAAGAAAAAGAAAGCTGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018436987 6:163770453-163770475 AACTGAAAGACAAAGCAGGCTGG + Intergenic
1018651813 6:165998737-165998759 CAATGAATGAGAAAGCAGGATGG - Intergenic
1019393479 7:803159-803181 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1019762752 7:2825726-2825748 CACTGAAAGAAGGAGGATGCAGG + Intronic
1020019016 7:4851042-4851064 AAATGCAAGAAAAAGTAGCCGGG + Intronic
1020121455 7:5506238-5506260 AAAAGAAAAAAAAAAGAGGCCGG - Intronic
1020203448 7:6097884-6097906 AAAAGAAAGAAAAAGAAGGCCGG - Intergenic
1020353877 7:7255698-7255720 CAATGAAAGAAAATGGCTGTGGG - Intergenic
1020395927 7:7717351-7717373 AGATGAAAGAAACAGGAGGCTGG - Intronic
1020651918 7:10885940-10885962 AAATTAAAGAAAGATGAGGCTGG - Intergenic
1020729840 7:11867160-11867182 CAAATAAAGAAAATGTAGGCCGG + Intergenic
1020740164 7:12006049-12006071 AGATGAAAGAAAATGGAGCCAGG - Intergenic
1020820208 7:12957883-12957905 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1020906690 7:14072031-14072053 CATTGAAAGAATAATGAGGCCGG - Intergenic
1020954893 7:14728694-14728716 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1021316007 7:19147714-19147736 GAAAGAAAGAAAAAGGAGTAAGG - Intergenic
1021962348 7:25885402-25885424 GAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1022254682 7:28644077-28644099 CAAAGAAAGAAAAGGAAGGAAGG + Intronic
1022382918 7:29876929-29876951 CAAGAAAAAAAAAAGGAGCCAGG - Intronic
1022663241 7:32386071-32386093 AAAAGAAAGAAAAAGGTGGAGGG - Intergenic
1022689570 7:32634467-32634489 CAATAAAAAAAATAGTAGGCAGG + Intergenic
1022730274 7:33016373-33016395 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
1023013751 7:35945118-35945140 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1023200774 7:37694557-37694579 CAATGAAGGAATATTGAGGCTGG + Intronic
1023222906 7:37938608-37938630 CAGTTAAAGCAAAAGCAGGCTGG - Intronic
1023227899 7:37990990-37991012 GAACGAAAGAAAAAGAAAGCAGG - Intronic
1023442727 7:40201190-40201212 GAATGAAGGAAAAAGGAAGGAGG + Intronic
1023512215 7:40965376-40965398 AAAAGAAAGAAAGAAGAGGCAGG - Intergenic
1024077379 7:45828719-45828741 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1024381164 7:48697759-48697781 CAATGAAAGCAAAAGATGTCTGG - Intergenic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1024642042 7:51337482-51337504 AAAGAAAAGAAAAAGAAGGCTGG + Intergenic
1024683876 7:51723705-51723727 CAATGAAAGGAAAGGGAAGGGGG - Intergenic
1025064624 7:55842614-55842636 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1025113109 7:56235880-56235902 AAAAGAAAAAAAAATGAGGCAGG + Intergenic
1025116593 7:56263554-56263576 CAATGAAAGACAACCAAGGCTGG - Intergenic
1025127030 7:56352684-56352706 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1025216101 7:57057913-57057935 AAAAGAAAAAAAAAAGAGGCTGG + Intergenic
1025263638 7:57438874-57438896 AAAGAAAAAAAAAAGGAGGCAGG - Intergenic
1025321594 7:58100196-58100218 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1025474739 7:60905453-60905475 CAAAGAAATAAAAAGAAGGAAGG + Intergenic
1025512264 7:61584421-61584443 CAAAGAAATAAAAAGAAGGAAGG - Intergenic
1025551202 7:62252021-62252043 CAAAGAAATAAAAAGAAGGAAGG - Intergenic
1025565822 7:62432932-62432954 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1025602346 7:63012599-63012621 CAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1025635596 7:63317261-63317283 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
1025647100 7:63430919-63430941 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1025655279 7:63512790-63512812 AAAAGAAAAAAAAAAGAGGCTGG - Intergenic
1025767406 7:64468342-64468364 AAATAAAATAAAAAGGAGGTGGG + Intergenic
1025965090 7:66262326-66262348 CAATGAAAGAAGAGGAAGGGAGG - Intronic
1025969895 7:66313110-66313132 CAAAGAAACAAAAATGATGCTGG + Intronic
1026099059 7:67369659-67369681 GAAAGAAAGAGAAAGGAGGGAGG - Intergenic
1026103679 7:67403573-67403595 CAAAAAAAAAAAAAAGAGGCAGG - Intergenic
1026162289 7:67880454-67880476 AAATGAAACAGAATGGAGGCAGG - Intergenic
1026494866 7:70893400-70893422 AAAAGAAAGATAAAGGAGGATGG + Intergenic
1026639906 7:72114972-72114994 CAACAAGAGAAAAAGGAGGCTGG + Intronic
1026643537 7:72148606-72148628 AAAGAAAAGAAAAAAGAGGCTGG + Intronic
1026856651 7:73759428-73759450 CAAAAAAAGAAAAAAAAGGCCGG + Intergenic
1026860466 7:73784004-73784026 CAATAACAGAAAAAGAGGGCTGG - Intergenic
1026951608 7:74351075-74351097 GAAAGAAAGAAAAAGAAGGAAGG + Intronic
1026953300 7:74361511-74361533 AAAAGAAAAATAAAGGAGGCTGG - Intronic
1027186543 7:75974821-75974843 TAAAAAAAGAAAAAAGAGGCTGG - Intronic
1027385417 7:77654962-77654984 CATTTAAATAAAAAGGAGGCTGG - Intergenic
1027684030 7:81259111-81259133 CAATTAAAGGCAGAGGAGGCAGG - Intergenic
1028209518 7:88056078-88056100 CAATGAAATTAAATGGAAGCAGG - Intronic
1028526402 7:91791364-91791386 AAATTAAAAAAAAAGGAGTCAGG - Intronic
1028625262 7:92870473-92870495 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1028941299 7:96525252-96525274 CAAAAAAAAAAAAAGGAGTCAGG - Intronic
1029298984 7:99563612-99563634 AAACTAAAGAAAAAGGAGGCTGG - Intronic
1029386334 7:100246096-100246118 AAATGAAAAAAAAAAAAGGCCGG - Intronic
1029524481 7:101086724-101086746 AAATAAAATAAAAAGAAGGCAGG + Intronic
1029625902 7:101720056-101720078 TAATGAAAGAAAAAAATGGCCGG - Intergenic
1029656014 7:101925035-101925057 TGATGAAAGGAAAATGAGGCTGG - Intronic
1030006783 7:105128015-105128037 CATTGAAAGAAAAAGAAGGTAGG - Intronic
1030017894 7:105243157-105243179 TAATAAAAGAAAAAGGAGCTGGG - Intronic
1030034652 7:105398373-105398395 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1030074479 7:105724590-105724612 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1030108107 7:106004008-106004030 AAAAGAAAGAAAAAAAAGGCAGG + Intronic
1030365506 7:108641378-108641400 GAAAGAAAGAAAAAAGAGGGAGG - Intergenic
1030388538 7:108896166-108896188 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1030512696 7:110503948-110503970 CAATGATACCAAAAGGAGGGAGG - Intergenic
1030574437 7:111268323-111268345 CAGAGATAGAAAAGGGAGGCAGG + Intronic
1030576891 7:111298868-111298890 CAATGCAAGAAGAAGAATGCAGG + Intronic
1030633875 7:111926154-111926176 AAAAGAAAGAAAAAGAAGGAAGG + Intronic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1030819502 7:114078511-114078533 AAAAGAAAGAAAAAGGTGGTTGG + Intergenic
1031023829 7:116658683-116658705 CAATGTAAAAAAAAGAAGGGGGG + Intergenic
1031054185 7:116975702-116975724 CAAAGAAAAAAAAAAAAGGCTGG - Intronic
1031639226 7:124141290-124141312 AAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1031662751 7:124446775-124446797 CAATGGAAGAATAAGAAGACTGG + Intergenic
1032540431 7:132698459-132698481 GAAAGAAAGAAAAAGTAGGAAGG + Intronic
1033327498 7:140391629-140391651 TAATTAGAGAAAAAGGAGTCAGG + Intronic
1033334196 7:140438371-140438393 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1033644829 7:143293024-143293046 AAATAAAATAAAAAGGAGGGGGG + Intronic
1033938935 7:146626941-146626963 GAAATAAAGAAAAATGAGGCTGG - Intronic
1034036154 7:147824724-147824746 TAAAGAAAAAAAAAGGAAGCTGG - Intronic
1034315217 7:150124608-150124630 TATTGAAAGAAAAAGAAGCCAGG - Intergenic
1034438823 7:151076443-151076465 CACTTAAATAAAAAGGAGGGAGG - Exonic
1034791674 7:153976191-153976213 TATTGAAAGAAAAAGAAGCCAGG + Intronic
1035183364 7:157107039-157107061 GAAAGAAAGAAAAAATAGGCTGG - Intergenic
1035898051 8:3426454-3426476 CAATTAATGGAAAAGGAAGCTGG + Intronic
1035903182 8:3479574-3479596 CATTGAAAGAAATGGCAGGCTGG - Intronic
1036024654 8:4891929-4891951 CAATAAAAGAAAAAAGAAGATGG + Intronic
1036623866 8:10448246-10448268 AAATTAAATAAAATGGAGGCAGG + Intergenic
1036985177 8:13521198-13521220 CAATGAAAGAACATGGACACAGG + Intergenic
1037156760 8:15710111-15710133 AAATAGAAGAAAAAGGAGGTAGG - Intronic
1037221211 8:16524321-16524343 TAATAAGAGAAAAAGGAGGCAGG - Intronic
1037785969 8:21903469-21903491 CAAAAAAATAAAAAGCAGGCCGG + Intergenic
1037938902 8:22935218-22935240 CAATTAAAGAAATGGGAGACTGG + Intronic
1038038962 8:23707890-23707912 GAAAGAAAGAAAAAGGAGGGAGG - Intergenic
1038045500 8:23762329-23762351 GAATGAAAGAAAAAGAAAGAGGG - Intergenic
1038472212 8:27834595-27834617 CTATGAAAATAAAATGAGGCCGG + Intronic
1038510406 8:28129038-28129060 AAATGAAAGAAAAAAAAGGGGGG - Intronic
1038981287 8:32762166-32762188 CAATCTATGAAAAAGTAGGCAGG + Intronic
1039182082 8:34878191-34878213 AAAGAAAAGAAAAAGGAGGGAGG + Intergenic
1039532482 8:38275956-38275978 CAATGAGAGAAGAAGGAACCTGG - Intronic
1039602975 8:38857411-38857433 CAATTAAAAAAAAAACAGGCAGG - Intergenic
1039606192 8:38882954-38882976 AAAAGAAAGAAAAACGAGGCCGG + Intergenic
1039763363 8:40601721-40601743 GAAAGAAAGAGAAAGCAGGCAGG + Intronic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040072779 8:43201936-43201958 CACTGAAAGAAAAGGGTGGCAGG - Exonic
1040108048 8:43551077-43551099 CCAAGAAAAAAAAAGCAGGCAGG - Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040513360 8:48114920-48114942 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1040699851 8:50049060-50049082 CAATTAAAGCTAAAGAAGGCAGG + Intronic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041352137 8:56957870-56957892 CAATGAGAAAAAAAGGTGGGGGG + Intergenic
1041436966 8:57852647-57852669 CAATCAGAAAAAAAGGAGGCAGG + Intergenic
1041802350 8:61813596-61813618 GAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1042077379 8:65011157-65011179 CCAAGAAAGAAAAAGGAAGAAGG - Intergenic
1042215111 8:66423424-66423446 GAAAGAAAGAAAAAGGAGGGGGG - Intergenic
1042403478 8:68376571-68376593 ACATAAAAGAAAAGGGAGGCAGG - Intronic
1042929081 8:73995919-73995941 CTGTGAAAGAAAAATAAGGCTGG + Intronic
1043037884 8:75220499-75220521 AAAAGAGAAAAAAAGGAGGCAGG + Intergenic
1043059825 8:75486408-75486430 CAATGAAGGAAAAAGAAAGATGG - Intronic
1043113578 8:76219027-76219049 CAATGAAAGAAAAATGAACCTGG - Intergenic
1043368947 8:79568674-79568696 GAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1043440019 8:80268684-80268706 CATTTAAAAAAAAAGAAGGCCGG - Intergenic
1043702093 8:83301691-83301713 AAATGAAAGCAAAAGGAGCTAGG - Intergenic
1043826291 8:84932838-84932860 CAGTGAAAGAAAGAAGAGGTAGG - Intergenic
1043852416 8:85229808-85229830 TAATGAAAGAAAAAAGAGGAAGG + Intronic
1044187448 8:89271672-89271694 TAATGAAAGAAAAAAAATGCAGG + Intergenic
1044313239 8:90719519-90719541 AAATGAAAGAAACAGGTAGCAGG + Intronic
1044328777 8:90892225-90892247 CAATGAAATAAAATTGAGGTGGG + Intronic
1044543286 8:93431369-93431391 CAGGCAAGGAAAAAGGAGGCAGG + Intergenic
1044553799 8:93540395-93540417 CAGTAAAAGAAAAAGAAGACAGG + Intergenic
1044585386 8:93864919-93864941 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1044877761 8:96688386-96688408 CATTAAAAGAAAAATGAGGTGGG - Intronic
1044968686 8:97598516-97598538 CAATGAAAAAGGAAGGAGGTTGG - Intergenic
1045024111 8:98070358-98070380 AAAGAAAAGAAAAAAGAGGCCGG + Intronic
1045828091 8:106425213-106425235 AAAGAAAAGAAAAAAGAGGCAGG - Intronic
1046486731 8:114896704-114896726 TAATGACAGAAACCGGAGGCTGG - Intergenic
1046494717 8:114998669-114998691 CAATAAAAAAAAAAGGAGGAAGG - Intergenic
1046623951 8:116557778-116557800 CAAAGAAAGAAAAAGATGACAGG - Intergenic
1046799121 8:118405674-118405696 CAAAGAAAGAAAAGGAAGGGAGG + Intronic
1046857790 8:119053670-119053692 CAATTAAAAAAAAAGGTGGGGGG + Intronic
1047017639 8:120740543-120740565 CAAATAAAGAAAAAAGAGGTGGG + Intronic
1047036675 8:120947555-120947577 CAATGAAAGAAAAATCTGACAGG + Intergenic
1047371248 8:124257828-124257850 AAATAAAATAAAAAAGAGGCTGG + Intergenic
1047770397 8:128025943-128025965 GAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1047857715 8:128930483-128930505 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1048048171 8:130792687-130792709 CAATAAAAGAAAATGGATGAGGG - Intronic
1048665937 8:136661554-136661576 AAATAAAAGAAATAGCAGGCCGG + Intergenic
1048798816 8:138177125-138177147 CAATGAAAGAAAATTTTGGCTGG + Intronic
1049123261 8:140759559-140759581 GAAAGAAAGAAAAAGTTGGCTGG + Intronic
1049397346 8:142407288-142407310 CAATGAGTGAAAGAGGAGACAGG - Intergenic
1049450518 8:142659097-142659119 CAATGAAATAGAAAAAAGGCTGG + Intronic
1049503536 8:142982119-142982141 CAATCACAGAAAATGGGGGCAGG + Intergenic
1049772440 8:144389824-144389846 CAAAAAAAAAAAAAAGAGGCTGG - Intronic
1049990180 9:982801-982823 AAGAGAAAGAAAGAGGAGGCGGG - Intronic
1050083785 9:1942671-1942693 GATTGAAAGAAAAATGAGGCTGG + Intergenic
1050240822 9:3632640-3632662 AAATAAAAGAAATAGGAAGCAGG + Intergenic
1050569950 9:6927424-6927446 AAATGTTAGAAAAAAGAGGCTGG - Intronic
1050720283 9:8581444-8581466 TAAAGAAAGAAAAGGGTGGCCGG + Intronic
1051064041 9:13079959-13079981 AAATGAAAGAAAAAGAAGAAAGG + Intergenic
1051069312 9:13144467-13144489 CAATAAAAGAAAAAGATAGCGGG - Intronic
1051605879 9:18917445-18917467 AAGGGAAAGAAAAGGGAGGCAGG + Intergenic
1051624403 9:19084922-19084944 AAAAGAAAAAAAAAAGAGGCGGG - Intronic
1051672735 9:19528488-19528510 AAAAGAAAGAAAAAGGAGGAGGG - Intronic
1052061950 9:23970884-23970906 CAATGCTAGAAAAAGGAGATAGG + Intergenic
1052332645 9:27285436-27285458 CAATGAAAGAAAAACTAGGCCGG - Intronic
1052366362 9:27615906-27615928 AAATGAAAGGCAAAAGAGGCAGG + Intergenic
1053374122 9:37590716-37590738 CAATGAAAAAGGCAGGAGGCAGG + Intronic
1053615167 9:39758031-39758053 AAATGAAAGAGAAAGGAGCTTGG + Intergenic
1053707947 9:40773880-40773902 CAATTAAAATAAGAGGAGGCAGG - Intergenic
1053873334 9:42517294-42517316 AAATGAAAGAGAAAGGAGCTTGG + Intergenic
1053899415 9:42778626-42778648 AAATGAAAGAGAAAGGAGCTTGG - Intergenic
1053944465 9:43292208-43292230 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1054238352 9:62584359-62584381 AAATGAAAGAGAAAGGAGCTTGG - Intergenic
1054262237 9:62878950-62878972 AAATGAAAGAGAAAGGAGCTTGG + Intergenic
1054268995 9:62949458-62949480 AAATGAAAGAGAAAGGAGCTTGG - Intergenic
1054408543 9:64785528-64785550 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1054417858 9:64894669-64894691 CAATTAAAATAAGAGGAGGCAGG - Intergenic
1054552482 9:66618879-66618901 AAATGAAAGAGAAAGGAGCTTGG - Intergenic
1054710286 9:68504273-68504295 GAATGAAAGAAACAGCATGCTGG - Intronic
1054752672 9:68924116-68924138 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1054853030 9:69868372-69868394 AAAAGAAACAAAAATGAGGCTGG + Intronic
1055684656 9:78758432-78758454 GAAAGAAAAAAAAAGCAGGCTGG + Intergenic
1055694904 9:78873360-78873382 GAATAAAGGAACAAGGAGGCCGG - Intergenic
1055821247 9:80267243-80267265 CAAGAAAACAAAAAGGAGTCCGG - Intergenic
1056811486 9:89768479-89768501 CAATCAGAGCAAAAGCAGGCTGG + Intergenic
1057096690 9:92317112-92317134 TAATAAAAGAAAAATCAGGCTGG - Intronic
1057184975 9:93052419-93052441 CCATGGATGAATAAGGAGGCAGG - Intergenic
1057364776 9:94409121-94409143 AAAAAAAAAAAAAAGGAGGCCGG - Intronic
1057387108 9:94614091-94614113 AAAAGAAAGAAAAAGGAAGAAGG + Intronic
1057642700 9:96840948-96840970 CAATGAGAGAAAAAGCTGGTTGG + Intronic
1057882392 9:98802424-98802446 CAATGGAAAAAAAAAAAGGCTGG - Intergenic
1058221857 9:102313299-102313321 CAATGCAAGAAAAAAAAAGCCGG + Intergenic
1058432187 9:104928937-104928959 TAATGAAATTAAAAGGGGGCTGG - Intergenic
1058599520 9:106654071-106654093 AAATAAAGGAAAAAGGAGGCCGG - Intergenic
1059003461 9:110375477-110375499 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
1059347833 9:113643570-113643592 CAATGCAAGAAAAAGAAGGAAGG - Intergenic
1059412626 9:114142477-114142499 CAATGAAGGGAAAATGAGTCTGG - Intergenic
1059759579 9:117325352-117325374 CAATGAAAAAGACAGGAGGAGGG - Intronic
1060180840 9:121532638-121532660 AAGTAAAAGAAAAAAGAGGCCGG - Intergenic
1060476350 9:123989687-123989709 CAAAGAAAAAAAAAGTAGCCAGG + Intergenic
1060724214 9:125996609-125996631 CAAAAAAAGTAAAAAGAGGCTGG - Intergenic
1060751337 9:126171395-126171417 AAAAAAAAGAAAAAAGAGGCTGG - Intergenic
1061259750 9:129473420-129473442 GAAAGAAAGAAAAAGGAGGAAGG + Intergenic
1061872219 9:133527144-133527166 GAATGAAAGTCCAAGGAGGCGGG + Intronic
1061937489 9:133866182-133866204 CAAAGACAGAAAGAGGAGCCAGG - Intronic
1062335727 9:136065895-136065917 TAAAGAAAGTAAAAAGAGGCCGG + Intronic
1062485995 9:136776057-136776079 TAATAAAAGAAAAAGGTGCCAGG + Intergenic
1203446734 Un_GL000219v1:63742-63764 AAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1203587601 Un_KI270747v1:20786-20808 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1185586320 X:1244412-1244434 GAAAGAAAGAAAAGGGAGGAAGG + Intergenic
1185635949 X:1552006-1552028 GAAAGAAAGAAAAGGAAGGCAGG + Intergenic
1185654749 X:1675707-1675729 CAAAAAAAAAAAAAAGAGGCGGG - Intergenic
1185991227 X:4894869-4894891 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1186581775 X:10827405-10827427 CACTCAAAGAAAAAGGAAGGAGG + Intronic
1186621064 X:11240746-11240768 TAATTAAAGCAAAATGAGGCCGG + Intronic
1186652550 X:11576877-11576899 CAATGACAAAAAAAGGGGGATGG - Intronic
1186723709 X:12334307-12334329 GAAAGAAAGAAAAGGAAGGCTGG - Intronic
1186825636 X:13337266-13337288 CAATAAAGAAAATAGGAGGCCGG - Intergenic
1187129972 X:16493198-16493220 GAAGGAAAGAAAAAGTAGGAAGG - Intergenic
1187644916 X:21336541-21336563 TAAAAAAAGAAAAAGGAGACAGG + Intergenic
1187695325 X:21913589-21913611 GAAAGAAAGAAAGAGGAGGGAGG + Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188777744 X:34242431-34242453 CAATAAAAGAAAAGGAAGGCAGG + Intergenic
1188781111 X:34286558-34286580 CACTGAAGAAAGAAGGAGGCTGG + Intergenic
1188951121 X:36376487-36376509 TAGGGAAAGAAAAAGAAGGCTGG - Intronic
1189009455 X:37031673-37031695 CAAAGAAAGAAAAAGAAAGAAGG + Intergenic
1189239562 X:39515205-39515227 CAATGAATGAAAAATGAGGCTGG + Intergenic
1189345086 X:40234740-40234762 AAAAAAAAGAAAAATGAGGCAGG - Intergenic
1189570965 X:42296631-42296653 CAATGAAACAATATTGAGGCTGG + Intergenic
1189766962 X:44381733-44381755 CAATTAAAAAAAAATTAGGCTGG - Intergenic
1190136641 X:47804806-47804828 GAAGGAAAGAAAAAGAAGGTGGG - Intergenic
1190157713 X:48007155-48007177 CAATGAAAGAAGCTGAAGGCTGG + Intronic
1190173485 X:48130040-48130062 CAATGAAAGAAGCTGAAGGCTGG + Intergenic
1190227547 X:48557811-48557833 AAAAAAAAGAAAAAAGAGGCTGG + Intronic
1190743015 X:53302774-53302796 CAATGAAATAAAAATTAGCCAGG + Intronic
1190801526 X:53793876-53793898 CGAAGAAAAACAAAGGAGGCTGG - Intergenic
1190952948 X:55163614-55163636 AAATCTAGGAAAAAGGAGGCTGG + Intronic
1191244160 X:58212790-58212812 CAATGAAAGAGAAACCTGGCTGG + Intergenic
1192103161 X:68287177-68287199 GAAAGAAAGAAAAGGGAGGGAGG + Intronic
1192448315 X:71226659-71226681 CAAAGAAAGAAAAGGAAGGAAGG + Intergenic
1192602707 X:72481597-72481619 CAACAAAAAAAAAAGGAAGCAGG - Intronic
1193473657 X:81937044-81937066 AAATGACAGAAAATGGAGACTGG - Intergenic
1193824438 X:86205540-86205562 AAAAGAAAGAAAAAGAAGGAAGG - Intronic
1194758331 X:97764056-97764078 CAATGAGGGAAAGAGGAGACAGG - Intergenic
1195054074 X:101125692-101125714 AAAAGAATGAAAAAGGTGGCTGG - Intronic
1195084982 X:101405622-101405644 CTAAAAAAGAAAAAAGAGGCCGG + Intronic
1195579657 X:106487051-106487073 GAAAGAAAGAAAAAGAAGGGAGG - Intergenic
1195591625 X:106634807-106634829 CAAACAAACAAAAAGGAAGCTGG - Intronic
1195631547 X:107060621-107060643 CAATAAAAAAAAATGGAGGCAGG - Intergenic
1195701373 X:107708232-107708254 CACTGAAAGAAACAGGGGGTAGG - Intergenic
1195977506 X:110543532-110543554 CAAGGAAATAATAAGGAGGAAGG + Intergenic
1196397987 X:115286554-115286576 GAAATAAAGAAAAGGGAGGCCGG - Intergenic
1196834534 X:119802150-119802172 GAAAGAAAGAAAAGGGAGGGAGG - Intergenic
1197192944 X:123669160-123669182 CAAAAAAAAAAAAAGGAGGGAGG + Intronic
1197339873 X:125254152-125254174 AAAGGAAAGAAAGAGGAGGAAGG - Intergenic
1197875169 X:131095269-131095291 CAAAGAATGGAACAGGAGGCAGG - Intergenic
1198021150 X:132659273-132659295 CGAAAAAAGAAAAATGAGGCTGG - Intronic
1198129927 X:133683385-133683407 CAGTGATAGTAAAAGGAGACAGG + Intronic
1199305039 X:146257995-146258017 CATTGAAAGAGAAAGGAGAATGG + Intergenic
1200041448 X:153373302-153373324 CAATGAAAGAAAGAGGGAGATGG + Intergenic
1200861754 Y:7999817-7999839 CAATGAAAGAAAGAAAAGGAAGG + Intergenic
1200961140 Y:8997308-8997330 CATTGACTGACAAAGGAGGCTGG - Intergenic
1201219194 Y:11750251-11750273 CACTGAAAGGAAAGGGAAGCTGG + Intergenic
1201461326 Y:14228409-14228431 AAATGAGATAAAAATGAGGCGGG + Intergenic
1201538896 Y:15084723-15084745 GAAAGAAAGAAAAAAGAGGGAGG + Intergenic
1202269295 Y:23054810-23054832 AAATGAAAGAAAAAGAAGGAAGG + Intergenic
1202422290 Y:24688560-24688582 AAATGAAAGAAAAAGAAGGAAGG + Intergenic
1202448498 Y:24981530-24981552 AAATGAAAGAAAAAGAAGGAAGG - Intergenic