ID: 1150060478

View in Genome Browser
Species Human (GRCh38)
Location 17:62065037-62065059
Sequence GGTCCAGATGCCCGAGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150060478_1150060486 8 Left 1150060478 17:62065037-62065059 CCGGGAACTCGGGCATCTGGACC 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1150060486 17:62065068-62065090 CCCCCTCCCCCACGGCCCAAGGG 0: 1
1: 1
2: 2
3: 33
4: 299
1150060478_1150060481 0 Left 1150060478 17:62065037-62065059 CCGGGAACTCGGGCATCTGGACC 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1150060481 17:62065060-62065082 AGACCCGGCCCCCTCCCCCACGG 0: 1
1: 0
2: 2
3: 48
4: 347
1150060478_1150060494 20 Left 1150060478 17:62065037-62065059 CCGGGAACTCGGGCATCTGGACC 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1150060494 17:62065080-62065102 CGGCCCAAGGGCGCACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 49
1150060478_1150060484 7 Left 1150060478 17:62065037-62065059 CCGGGAACTCGGGCATCTGGACC 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1150060484 17:62065067-62065089 GCCCCCTCCCCCACGGCCCAAGG 0: 1
1: 0
2: 3
3: 59
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150060478 Original CRISPR GGTCCAGATGCCCGAGTTCC CGG (reversed) Intronic
900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG + Intergenic
907555161 1:55337064-55337086 TGTCCAGAGGCCAGAGTGCCGGG + Intergenic
920301509 1:204991867-204991889 GGGCCAGGTGCTCCAGTTCCTGG + Intronic
922403163 1:225282239-225282261 GGTCCATGAGCCAGAGTTCCAGG + Intronic
923101887 1:230823494-230823516 GGACCAGATGCCCCAGTAACGGG + Intergenic
924439416 1:244074003-244074025 GGCCCAGATCCCCTAGGTCCTGG - Intergenic
924798237 1:247308514-247308536 GCTGCAGGTGCCAGAGTTCCAGG - Exonic
1063011265 10:2023933-2023955 TGTCCAGATGCCTGAGAGCCAGG + Intergenic
1063134980 10:3208554-3208576 GGTCCTGATGGCCGAGTGCCAGG + Intergenic
1069714251 10:70510401-70510423 TGTCCAAATGCCTGACTTCCTGG + Intronic
1071329963 10:84549323-84549345 GGTACAGATGGCAGAGTGCCAGG + Intergenic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1080245002 11:30169755-30169777 GGTCCAGATGGCAGAGTGACAGG - Intergenic
1081840918 11:46200799-46200821 TGTCCTGAGGCCCGAGTACCAGG - Intergenic
1081937389 11:46914633-46914655 GGCCCAGATGCCCCATGTCCAGG + Intronic
1083306640 11:61765118-61765140 AGTCCAGATGGCCCAGCTCCAGG - Intronic
1083894623 11:65613841-65613863 GGCCCGGATGCCCAGGTTCCGGG - Exonic
1083938252 11:65881570-65881592 GGTCCAGCTGCCAGTGTCCCTGG - Intronic
1084410406 11:69003288-69003310 GGCCCAGATGTCGTAGTTCCAGG - Intergenic
1085045827 11:73352901-73352923 CGACCAGATCCCCGAGCTCCTGG + Exonic
1087734255 11:101814035-101814057 AGTCCAAAAGCCCGAGATCCAGG - Intronic
1089201281 11:116726017-116726039 GGCTCAGATGACCCAGTTCCAGG - Intergenic
1089523084 11:119078648-119078670 GTGCCAGATGCACGACTTCCAGG + Exonic
1092786667 12:12032879-12032901 TGTCCACATGCCGGATTTCCCGG - Intergenic
1094607297 12:31959645-31959667 GGGCCCGAGGCCCGGGTTCCGGG - Intronic
1096111435 12:49031504-49031526 GGTCCAGATGCCCAGGTACCAGG + Exonic
1096747198 12:53736838-53736860 GCACCAGATACCTGAGTTCCTGG + Intergenic
1102155107 12:110719272-110719294 GGTCCAGATGCCTCAGGACCGGG + Intergenic
1102806646 12:115787311-115787333 GCTCCACTTTCCCGAGTTCCAGG + Intergenic
1104662382 12:130620542-130620564 GGGCCAGATGCCCAAGCTCGGGG + Intronic
1104975718 12:132551125-132551147 GCTCCAGATGGCAGAATTCCCGG + Intronic
1107454996 13:40546617-40546639 GGCCCAGATGCGCAAGCTCCTGG + Intergenic
1117490388 14:56241055-56241077 GGTCCAGTTTCCAGTGTTCCAGG - Intronic
1117794507 14:59378210-59378232 GGGCAAGAAGCCCGAGTTCTTGG - Intergenic
1117843066 14:59881019-59881041 AGTCCTGAGGCCCCAGTTCCAGG - Intergenic
1118912010 14:70069478-70069500 GGTCCAGCTGCCCCAGGTCAAGG - Intronic
1121638210 14:95467859-95467881 GGACCAGAAGCCCGGGATCCTGG - Exonic
1124367180 15:29080411-29080433 GTTCCAGATGCCAGAGCTCCTGG + Intronic
1129758155 15:78111164-78111186 CATCCAGATGCCAGAGCTCCGGG - Exonic
1131063349 15:89417838-89417860 GGAGCAGATGCCCTTGTTCCTGG + Intergenic
1132320689 15:100922924-100922946 GGGCCAGGTGCCTGAGTTCTAGG + Intronic
1133027524 16:2995206-2995228 GGTCCAGATGCTGGGGTTCTGGG + Intergenic
1136737325 16:32476269-32476291 GATCCAGCAGCCCGAGATCCTGG - Intergenic
1139891831 16:70258088-70258110 GGTCCCGGTGTCCGAGTTGCTGG - Exonic
1141886249 16:86894397-86894419 GGACCAGAGGCCCGCGTGCCAGG + Intergenic
1203015745 16_KI270728v1_random:353308-353330 GATCCAGCAGCCCGAGATCCTGG + Intergenic
1203034080 16_KI270728v1_random:626466-626488 GATCCAGCAGCCCGAGATCCTGG + Intergenic
1142596226 17:1031376-1031398 GGGGCAGATGCCCGAGCGCCAGG + Intronic
1143447626 17:7018561-7018583 GGTCCAGATGGCCCTCTTCCTGG - Intergenic
1145032407 17:19514875-19514897 GTTCCAGATTCCCAAGTTTCTGG - Intronic
1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG + Exonic
1146845078 17:36177324-36177346 CGTCCAGATGCCCCAGTGCAGGG + Intronic
1146857389 17:36265259-36265281 CGTCCAGATGCCCCAGTGCAGGG + Intronic
1146863230 17:36323116-36323138 CGTCCAGATGCCCCAGTGCAGGG - Intronic
1146873300 17:36389169-36389191 CGTCCAGATGCCCCAGTGCAGGG + Intronic
1146880652 17:36440255-36440277 CGTCCAGATGCCCCAGTGCAGGG + Intergenic
1147066090 17:37923704-37923726 CGTCCAGATGCCCCAGTGCAGGG - Intergenic
1147076181 17:37989795-37989817 CGTCCAGATGCCCCAGTGCAGGG + Intronic
1147077622 17:38003264-38003286 CGTCCAGATGCCCCAGTGCAGGG - Intronic
1147087706 17:38069340-38069362 CGTCCAGATGCCCCAGTGCAGGG + Intergenic
1147093558 17:38127199-38127221 CGTCCAGATGCCCCAGTGCAGGG - Intergenic
1147103648 17:38193289-38193311 CGTCCAGATGCCCCAGTGCAGGG + Intergenic
1147555700 17:41477627-41477649 GGCCCAGCTGGCCGAGATCCGGG - Exonic
1148783220 17:50133161-50133183 AGTCTAGGTGCCAGAGTTCCAGG - Intergenic
1149848226 17:60019825-60019847 CGTCCAGATGCCCCAGTGCAGGG + Intergenic
1149861941 17:60126699-60126721 CGTCCAGATGCCCCAGTGCAGGG - Intergenic
1150060478 17:62065037-62065059 GGTCCAGATGCCCGAGTTCCCGG - Intronic
1150086577 17:62276404-62276426 CGTCCAGATGCCCCAGTGCAGGG + Intronic
1165830234 19:38727058-38727080 GGAGCAGATGCAGGAGTTCCGGG + Exonic
1167612782 19:50515302-50515324 GGTCAAGGTGCCCGAGTTGCAGG - Intergenic
934697921 2:96413591-96413613 GGTCCAGAAGACAGAGTTACAGG + Intergenic
937248896 2:120511190-120511212 GGTCCAGGTGCCGGGGCTCCAGG + Intergenic
946765316 2:223035383-223035405 GGTCTGGATGCCTGGGTTCCAGG - Intergenic
1175855789 20:62120250-62120272 GGGCCAGATGCCCCAGTCGCTGG + Intergenic
1176130124 20:63493272-63493294 GGTCCAGATGCCGTGGTTCAAGG - Exonic
1177744730 21:25197920-25197942 GGTCCAAAGGCCTGAGTTGCAGG + Intergenic
1179834606 21:44021895-44021917 GGTCAAGAAGCCCGAGATCAAGG - Intronic
1181555669 22:23670485-23670507 GGTCCACTTGCCCGGTTTCCAGG + Intergenic
1183102768 22:35594007-35594029 GGTCTGAATGCCAGAGTTCCGGG - Intergenic
1184759272 22:46535754-46535776 GGTCCAGGTGCCCGAGGACGTGG - Exonic
950419713 3:12891646-12891668 GGTCCAGAGGCCCAAGAACCTGG + Intergenic
951355824 3:21665518-21665540 GGTACAGCTGCCTGAGTTCGAGG - Intronic
953173097 3:40525133-40525155 GGCCCAGATGCCCACGGTCCGGG - Exonic
954807132 3:53227063-53227085 GGACCAGATGCCCCAGTGCAAGG - Intronic
958771352 3:98429144-98429166 GGTCCAGATGGCCCAGTACTTGG - Intergenic
961215984 3:125160939-125160961 ATTCCACATGCCCGGGTTCCGGG + Intronic
962444701 3:135454244-135454266 GGTTCAGCTGCCCCAGTTCTGGG + Intergenic
963827361 3:149970439-149970461 GGTCCAGGTGCCCGGGTTGGGGG - Intronic
968160278 3:196421269-196421291 AGCCAAGATGCCAGAGTTCCAGG + Intronic
968984337 4:3867022-3867044 AGGCCAGAAGCCCGAGATCCAGG + Intergenic
973910212 4:55572392-55572414 GTTCCAGATTCCCTAGTTTCTGG - Intronic
974521238 4:62982959-62982981 TGTCCAGATGCGGGAGTTCTTGG + Intergenic
977358911 4:95980345-95980367 ACTCCAGATGGCCGAGTTCAGGG + Intergenic
979293482 4:119003857-119003879 ATTCCAGCTGCCAGAGTTCCGGG + Intronic
984104220 4:175524455-175524477 GGTCCAGAAGTCCCAGTTCTAGG + Intergenic
985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG + Intergenic
985539982 5:483320-483342 GGTCCAGATGAACGGGTTCACGG + Exonic
986353177 5:6899347-6899369 GGTCCACATTCCCGGCTTCCTGG + Intergenic
992265812 5:75017341-75017363 ATTCCAGATGCCCCAGTTCTAGG - Intergenic
995180075 5:109222848-109222870 TGCCCAGATCCTCGAGTTCCAGG + Intergenic
998885129 5:146686198-146686220 GTTCCAGGTGCCGGAGTTGCAGG + Intronic
999274869 5:150323505-150323527 GGTCCAGGTGTCCTGGTTCCCGG - Intronic
1000263288 5:159610837-159610859 GGTCCAGATGCCTCATTTCCTGG - Intergenic
1002434435 5:179222123-179222145 GGTCCAGAAGCCTGAGTTTGGGG + Intronic
1006943607 6:37769443-37769465 GGTCCAAAGGCCCGAGGACCAGG - Intergenic
1014632521 6:123803860-123803882 GGGCCAGATGCCCGAGGGCGCGG + Intergenic
1015181640 6:130366698-130366720 GGTCCAGACTCCCCAGTCCCGGG + Intronic
1017313531 6:153002490-153002512 GGTCAGGAGGCCCGAGTTGCTGG - Exonic
1018584026 6:165335800-165335822 GGCCCAGATGACCGAGTGACTGG - Intronic
1019500032 7:1360192-1360214 GGTCCAGATGCCCCATGTCCCGG + Intergenic
1019500079 7:1360346-1360368 GGTCCAGACGCCCCACATCCCGG + Intergenic
1032171920 7:129592080-129592102 GGTTCAGATGCCTGAGTTGTAGG + Intergenic
1032270572 7:130400904-130400926 GGTCCACCTGTCTGAGTTCCCGG + Intronic
1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG + Intergenic
1034427719 7:151023403-151023425 GGCCCAGGGGACCGAGTTCCGGG + Intronic
1036206163 8:6806999-6807021 GGACCAGGTCCCAGAGTTCCGGG - Intergenic
1039608667 8:38902013-38902035 GTTCCAGAAGCCCGAAGTCCAGG - Intronic
1047998662 8:130358831-130358853 GCTCCGGAAGCCCGAGTCCCTGG + Intronic
1053196622 9:36124914-36124936 GGTCCTGATGTTCCAGTTCCAGG + Intergenic
1055937266 9:81614740-81614762 GGTTCTGATGCACCAGTTCCTGG + Intronic
1059425148 9:114216313-114216335 CCTCCACATGCCCGAGCTCCTGG - Intronic
1059455696 9:114398636-114398658 GCTCCCTATGTCCGAGTTCCTGG - Intergenic
1060832074 9:126723070-126723092 GGTCCCGATCCCCGAGTGCCTGG - Intergenic
1060929395 9:127479421-127479443 GCTCCCGCTGCCCCAGTTCCAGG - Exonic
1061244611 9:129394983-129395005 TGTCCAGATGCCCAAGCCCCTGG - Intergenic
1194965768 X:100287138-100287160 GGTGCAGAGGCTCGAGGTCCTGG - Intergenic
1198432084 X:136577556-136577578 GGTCCTGTTGCCCTAGTTTCAGG + Intergenic