ID: 1150060478

View in Genome Browser
Species Human (GRCh38)
Location 17:62065037-62065059
Sequence GGTCCAGATGCCCGAGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150060478_1150060494 20 Left 1150060478 17:62065037-62065059 CCGGGAACTCGGGCATCTGGACC 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1150060494 17:62065080-62065102 CGGCCCAAGGGCGCACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 49
1150060478_1150060481 0 Left 1150060478 17:62065037-62065059 CCGGGAACTCGGGCATCTGGACC 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1150060481 17:62065060-62065082 AGACCCGGCCCCCTCCCCCACGG 0: 1
1: 0
2: 2
3: 48
4: 347
1150060478_1150060484 7 Left 1150060478 17:62065037-62065059 CCGGGAACTCGGGCATCTGGACC 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1150060484 17:62065067-62065089 GCCCCCTCCCCCACGGCCCAAGG 0: 1
1: 0
2: 3
3: 59
4: 569
1150060478_1150060486 8 Left 1150060478 17:62065037-62065059 CCGGGAACTCGGGCATCTGGACC 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1150060486 17:62065068-62065090 CCCCCTCCCCCACGGCCCAAGGG 0: 1
1: 1
2: 2
3: 33
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150060478 Original CRISPR GGTCCAGATGCCCGAGTTCC CGG (reversed) Intronic