ID: 1150065711

View in Genome Browser
Species Human (GRCh38)
Location 17:62107442-62107464
Sequence TAATCAGAGGCCAGTCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150065709_1150065711 29 Left 1150065709 17:62107390-62107412 CCATCTGAAAAAAAAAATGCTCA No data
Right 1150065711 17:62107442-62107464 TAATCAGAGGCCAGTCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150065711 Original CRISPR TAATCAGAGGCCAGTCACAG TGG Intergenic
No off target data available for this crispr