ID: 1150069415

View in Genome Browser
Species Human (GRCh38)
Location 17:62138936-62138958
Sequence CTGCCAGTGCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150069415_1150069424 0 Left 1150069415 17:62138936-62138958 CCCAGCTCCATCTGCACTGGCAG No data
Right 1150069424 17:62138959-62138981 GGGCCAGGGCTGCTCCCGCAGGG No data
1150069415_1150069426 6 Left 1150069415 17:62138936-62138958 CCCAGCTCCATCTGCACTGGCAG No data
Right 1150069426 17:62138965-62138987 GGGCTGCTCCCGCAGGGCCTCGG No data
1150069415_1150069423 -1 Left 1150069415 17:62138936-62138958 CCCAGCTCCATCTGCACTGGCAG No data
Right 1150069423 17:62138958-62138980 GGGGCCAGGGCTGCTCCCGCAGG No data
1150069415_1150069427 7 Left 1150069415 17:62138936-62138958 CCCAGCTCCATCTGCACTGGCAG No data
Right 1150069427 17:62138966-62138988 GGCTGCTCCCGCAGGGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150069415 Original CRISPR CTGCCAGTGCAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr