ID: 1150069592

View in Genome Browser
Species Human (GRCh38)
Location 17:62139762-62139784
Sequence CCCGGACCTGCTGTCCTATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150069592_1150069600 29 Left 1150069592 17:62139762-62139784 CCGCATAGGACAGCAGGTCCGGG 0: 1
1: 1
2: 0
3: 7
4: 89
Right 1150069600 17:62139814-62139836 CACATACACCAGCTCCTTGAAGG 0: 1
1: 1
2: 0
3: 9
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150069592 Original CRISPR CCCGGACCTGCTGTCCTATG CGG (reversed) Intergenic
900576376 1:3384428-3384450 ACCTGACCTGCTGTCCACTGTGG - Intronic
901146011 1:7065118-7065140 CCAGGATCTGCTAGCCTATGTGG - Intronic
901604901 1:10451469-10451491 CCCGGGCTTCCTCTCCTATGAGG - Exonic
904130846 1:28274065-28274087 CCCAGACATGCTGTGCTTTGTGG + Exonic
906380502 1:45329368-45329390 CCAGGACTTGCTGGCCCATGCGG + Exonic
906979062 1:50608573-50608595 AGGGGACCTGCTGTCCTAGGAGG + Intronic
907307606 1:53522002-53522024 CCTGGCCCTGCTGTCTTAGGAGG - Intronic
912776175 1:112507915-112507937 CCCGTACCTGCTATCCTGGGAGG + Intronic
923020338 1:230158617-230158639 CCCAGGCCTTCTGTCCCATGGGG - Intronic
1069632668 10:69906506-69906528 CCTGGACCTGCTGTGCTGTAAGG - Intronic
1070048387 10:72862379-72862401 TTGGGAACTGCTGTCCTATGGGG - Intronic
1070127485 10:73633937-73633959 CATTGACCTGCTGGCCTATGGGG - Exonic
1075934801 10:126331241-126331263 TCTGGACTTGCTCTCCTATGAGG + Intronic
1076493761 10:130883215-130883237 CCCTCATCTGCTGTCCTGTGAGG + Intergenic
1078483832 11:11703998-11704020 CCCTGTCCTGCTGTCCCATTTGG + Intergenic
1080922762 11:36725218-36725240 CCAGAAGCTTCTGTCCTATGTGG - Intergenic
1082626384 11:55491833-55491855 CCCTCTCCTGCTTTCCTATGGGG + Intergenic
1084289362 11:68151916-68151938 CCCAGCCCTGCTGTCTTCTGTGG + Intergenic
1095953398 12:47793706-47793728 CCTAGACCTGCTGTCCAGTGGGG + Intronic
1099707184 12:86170979-86171001 CCCGGACATTCTGTTCTCTGAGG + Intronic
1102251342 12:111389620-111389642 CCTGGACCTGCCTTCCAATGTGG - Intergenic
1105542400 13:21326729-21326751 CCCGCACCTGCTGAACTTTGGGG + Intergenic
1105599077 13:21869727-21869749 CCTGAAGCTGCTGTCCTTTGAGG + Intergenic
1112207511 13:97339308-97339330 CCTGGACCTGATGTCCTGGGAGG + Intronic
1112784901 13:102940816-102940838 CCTGCAACTGCTGTCCTGTGAGG + Intergenic
1126069068 15:44849840-44849862 CCAGGACCTACTGTCCAGTGGGG - Intergenic
1126089747 15:45040933-45040955 CCAGGACCTACTGTCCAGTGGGG + Intronic
1129460451 15:75697713-75697735 CCCGGAGCTGCTGGCCCGTGGGG + Intronic
1141698663 16:85632554-85632576 TCCGAGCCTGCTGTCCCATGGGG + Intronic
1142001168 16:87665247-87665269 CCGGGACCTGCTGTTATATCGGG + Intronic
1142410457 16:89913345-89913367 CCCAGGCCTGCTGTCCTGAGAGG + Intronic
1147257974 17:39193495-39193517 CCTGGCCCTGCTGGCCTAGGGGG + Intronic
1147422811 17:40331066-40331088 CCTGGAGCTGCTGTCCAAAGAGG - Exonic
1147968948 17:44209498-44209520 CCAGGAGCTGCTGTCCAATGGGG - Exonic
1150069592 17:62139762-62139784 CCCGGACCTGCTGTCCTATGCGG - Intergenic
1151423156 17:74012025-74012047 CCTGTACCTGCTGTCTTCTGGGG + Intergenic
1158400438 18:57116802-57116824 CACGGGGCTGCTGCCCTATGGGG - Intergenic
1160516005 18:79479691-79479713 GCCTGACCCGCTGGCCTATGAGG - Intronic
1160727785 19:625176-625198 TCCGGACCTGCTGTCCTATGCGG - Exonic
1162527215 19:11213304-11213326 CCCGGAGCTGCTGTTCGAGGAGG - Exonic
1163440587 19:17320695-17320717 GCCGGTCTTGCTGTCCTAGGTGG + Exonic
925149454 2:1605263-1605285 TCCCCACCTGCTGTCCTGTGTGG - Intergenic
931956242 2:67428936-67428958 CCAGGACCTTCTGTACTATAAGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
947874656 2:233460271-233460293 CCCGGAGATGCTGTCCGAGGAGG + Exonic
1172766060 20:37351496-37351518 CTTGGACCTGCTGGGCTATGAGG + Intronic
1172969993 20:38866255-38866277 CCCGGGTGTGCTGTCCTCTGTGG + Intronic
1174677584 20:52373266-52373288 CCCAGACCTGCCTACCTATGGGG + Intergenic
1179891295 21:44336344-44336366 CCCTTACCTGATGTCCTTTGAGG - Intronic
1179998172 21:44983576-44983598 CCAGGGCCTTCTGTCCTATGTGG - Intergenic
1180006076 21:45021331-45021353 CCCGGACATGCTGCCCTCTTGGG + Intergenic
1182846111 22:33432251-33432273 CCAGGACTTGCTGACCTGTGAGG + Exonic
1184068273 22:42132570-42132592 CCCGGTCCTCCTGTCCTCAGTGG - Intergenic
1185127532 22:49019870-49019892 CAGGGACCTGCTGTCCGAGGGGG - Intergenic
952929144 3:38346459-38346481 CCTGGGCCTGCCGTCCTCTGTGG - Intergenic
953752335 3:45618358-45618380 AAGGGCCCTGCTGTCCTATGGGG + Intronic
966007602 3:175035378-175035400 CCCTGACCTGCTGACTAATGTGG - Intronic
968509844 4:990800-990822 CCCAGGCCTTCTGTCCTAGGTGG - Intronic
968845107 4:3036652-3036674 CCCGGCACTGCTGTCCTCAGAGG - Intronic
978406044 4:108379873-108379895 CCCAGACTTGCTCTCCTTTGTGG + Intergenic
985604915 5:853331-853353 CCCCGACTCGCTGTCCTCTGCGG - Intronic
985604966 5:853556-853578 CCCGGGCTTGCTGTCCTCTGTGG - Intronic
985604984 5:853620-853642 CCCTGGCTTGCTGTCCTCTGTGG - Intronic
985605047 5:853876-853898 CCCTGGCTTGCTGTCCTCTGTGG - Intronic
985605056 5:853908-853930 CCCTGGCTTGCTGTCCTCTGTGG - Intronic
985605065 5:853940-853962 CCCTGGCTTGCTGTCCTCTGTGG - Intronic
985605344 5:855036-855058 CCCTGGCTTGCTGTCCTCTGTGG - Intronic
985605417 5:855326-855348 CCCTGACTCGCTGTCCTCTGTGG - Intronic
988527474 5:31999648-31999670 CCCTGACCAGATGTCCTCTGGGG - Intronic
1003409623 6:5851118-5851140 CCCGCACCTGCTGAACTTTGGGG - Intergenic
1005651586 6:27890044-27890066 CCTGCACATGCTGTCCTTTGGGG - Intergenic
1008329858 6:50231940-50231962 CCCATAGCTGCTGTCCTATGGGG - Intergenic
1012451529 6:99357106-99357128 CTGAAACCTGCTGTCCTATGAGG - Intergenic
1017764771 6:157597654-157597676 CCCAGCCCTGCTGTCCTGTGTGG + Intronic
1021954781 7:25813400-25813422 TCAGGACCTGCAGGCCTATGAGG - Intergenic
1022616600 7:31937332-31937354 TCAGGACCTGCTGTGTTATGTGG + Intronic
1023826619 7:44014328-44014350 CGGGGACCTACTGTCCTTTGGGG - Intergenic
1024185291 7:46942747-46942769 CTGGGACCTGCTGGCCTGTGAGG + Intergenic
1026373878 7:69730471-69730493 TCCTTACCTGCTGTGCTATGAGG + Intronic
1029110811 7:98212284-98212306 CCTGGACTGGCTGTCCTAGGAGG - Exonic
1029347334 7:99987966-99987988 CCCGGACCCGCTGTCCCTTAGGG + Intergenic
1029737778 7:102474083-102474105 CGGGGACCTACTGTCCTTTGGGG - Intronic
1029754909 7:102567732-102567754 CGGGGACCTACTGTCCTTTGGGG - Intronic
1029772859 7:102666812-102666834 CGGGGACCTACTGTCCTTTGGGG - Intronic
1037806426 8:22060116-22060138 CCTGGACCTGCCTTCCTCTGTGG + Intronic
1038432627 8:27512273-27512295 CCCTAGCCTGCTGTTCTATGGGG - Intronic
1040067028 8:43154348-43154370 CCAGGACCTGCTGTGCGGTGGGG - Intronic
1045474749 8:102543297-102543319 CTGGGACCTGCTCTCCAATGAGG - Intergenic
1048458544 8:134600986-134601008 TCCAGACCTGCTGTCCCAGGAGG - Intronic
1048987666 8:139743724-139743746 ACCGGGCCAGCTGTCCTGTGGGG + Intronic
1053348216 9:37393808-37393830 ACCGGACGTGCTGACCTCTGTGG + Intergenic
1058336214 9:103832721-103832743 CCGGGACCTGCTGTGGTGTGGGG - Intergenic
1060828790 9:126701132-126701154 TCCGGACCTGCTGTCCCTGGTGG - Intergenic
1061679642 9:132236640-132236662 CCTGGGCCTGGTGTCCTCTGTGG + Intronic
1062402292 9:136377995-136378017 CCTGGGCCTGCTGTCCCAGGAGG - Exonic
1062441484 9:136571631-136571653 CCCTTCCCTGCTGTCCTGTGGGG + Intergenic
1189134215 X:38532428-38532450 CCAGGAGCTGCTGTCCAATGGGG - Intronic
1197762743 X:130039179-130039201 CTGGCTCCTGCTGTCCTATGGGG + Exonic