ID: 1150069616

View in Genome Browser
Species Human (GRCh38)
Location 17:62139909-62139931
Sequence GGCCGTGGTGGACCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150069613_1150069616 -9 Left 1150069613 17:62139895-62139917 CCGCTTCTGCCGCTGGCCGTGGT No data
Right 1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG 0: 1
1: 1
2: 1
3: 15
4: 107
1150069610_1150069616 7 Left 1150069610 17:62139879-62139901 CCAGCGTGAGCAGCTTCCGCTTC No data
Right 1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG 0: 1
1: 1
2: 1
3: 15
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150069616 Original CRISPR GGCCGTGGTGGACCACCAGC AGG Intergenic
900096665 1:942682-942704 CGCCGTGGTTCAGCACCAGCAGG - Exonic
900254899 1:1692959-1692981 GCCCGGGCTGGACCACCAGGCGG - Intronic
900263648 1:1746238-1746260 GCCCGGGCTGGACCACCAGGCGG - Intergenic
900736545 1:4302875-4302897 GGCCATGGAGGAGCAGCAGCAGG - Intergenic
901033310 1:6321160-6321182 GGCCATGGTGGATAACCAACAGG - Intronic
901238441 1:7679808-7679830 GGCCGAGGTGGACCCCAGGCTGG - Intronic
903063302 1:20684819-20684841 GCCCGTTGTGGACCAGCAGCAGG - Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
915128061 1:153679405-153679427 GGCCGCGGTGGACCTCAAGTGGG + Exonic
915266961 1:154725978-154726000 GGCCGTGGTGGCCCGAAAGCTGG - Exonic
915714249 1:157929649-157929671 GGCCGTGGTGTGCCAGGAGCTGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
1064577617 10:16762026-16762048 GGCGGTTGTGGACCAACAGGGGG - Intronic
1067089323 10:43258592-43258614 GGCCGAGGGGCACCACCAGCAGG + Intronic
1070934675 10:80283964-80283986 GGCCATGGTGGACTACCAGCGGG - Exonic
1074704429 10:116118530-116118552 GGCCTTGGTGGACAAGGAGCAGG - Intronic
1076599494 10:131647753-131647775 GGCCTTTGCGGACCCCCAGCAGG + Intergenic
1076878904 10:133230585-133230607 GGCCGCGCTGGCCCAGCAGCAGG + Exonic
1078100476 11:8327670-8327692 GGCCATAGCTGACCACCAGCTGG + Intergenic
1078210027 11:9263508-9263530 GGGCGCGGTGGCCCACCACCCGG - Intronic
1080642149 11:34164342-34164364 GGCACTGGAGGACCACCAGCAGG + Intronic
1084181828 11:67450776-67450798 GGCCCTGGTGAACCACAAGCTGG - Intergenic
1089492703 11:118893823-118893845 GGCCGTGGCCGACCTCCTGCTGG + Exonic
1091596964 12:1884800-1884822 CGCCGTGGAGGACTACGAGCCGG - Exonic
1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG + Exonic
1095459865 12:42432057-42432079 GGTCGTGGTGGACCACGTGGTGG - Intronic
1102383563 12:112487501-112487523 GGCCTTGGTGGAAAAGCAGCTGG - Intronic
1107527596 13:41248480-41248502 GGCAGTGGGGTACCACCAGTTGG + Intronic
1112478003 13:99749546-99749568 AGCCATGGTGGACCACAAACTGG + Intronic
1113803057 13:113096388-113096410 GGTCGTGGCGGACCACGAGAAGG + Exonic
1116919698 14:50560249-50560271 GGCCATGGTGGTCCAGGAGCTGG - Exonic
1117369506 14:55063290-55063312 GGCATTGGTGGAGCACCAGAAGG - Exonic
1122901734 14:104784833-104784855 GGACGTGGAGGGCCACCAGCTGG - Intronic
1122921196 14:104880989-104881011 GGGGTTGGTGGGCCACCAGCTGG + Intronic
1131248752 15:90817586-90817608 TGCCATGGAGGGCCACCAGCAGG - Intergenic
1136591259 16:31219157-31219179 GGCTGTGCTGGAGCATCAGCTGG + Exonic
1141694932 16:85614637-85614659 GGCGGTGGGGGAGCACCTGCCGG + Intronic
1142697910 17:1643756-1643778 GCACGTGGACGACCACCAGCCGG + Exonic
1143086722 17:4421569-4421591 GGCTGTGAGGGAGCACCAGCAGG + Intergenic
1144789746 17:17850807-17850829 GGCCTTGGGGGAGCATCAGCAGG - Intronic
1145207858 17:20994295-20994317 GGGCGTGGTGGATCAGCTGCTGG + Intergenic
1147739893 17:42665556-42665578 GGGAGTGGGGGCCCACCAGCTGG - Exonic
1147929380 17:43968147-43968169 GGCCGAGGTGGATCACTTGCGGG + Intronic
1148205527 17:45777427-45777449 AGCCATGGTGGAGCATCAGCTGG - Intergenic
1148241184 17:46000399-46000421 GGCCGCACTGGAGCACCAGCTGG + Intronic
1148455134 17:47807449-47807471 CGATGTGGTGGACCCCCAGCAGG + Exonic
1148847781 17:50539237-50539259 GGCCGTGGTCCACCATCAGCGGG + Exonic
1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG + Intergenic
1151447437 17:74176487-74176509 GGACTTGGGGGACCAGCAGCTGG - Intergenic
1155540988 18:26868035-26868057 AGTGGTGGTGGACCACCAGGAGG + Intergenic
1160728485 19:629608-629630 GGCCGTGGTGGACGACCAGCAGG + Exonic
1161160307 19:2757914-2757936 GGCCCTGGAGGCCCACCAGGTGG - Intronic
1161813149 19:6482084-6482106 GTCACTGGTGGACCACCAGAGGG + Intronic
1164158310 19:22609998-22610020 GCCCTTGCTGGACCACCAGCAGG - Intergenic
1166566671 19:43769781-43769803 GGCCGTGGTGGCCCGGAAGCTGG - Exonic
1166812407 19:45522357-45522379 GGTGGGGGTGGACCCCCAGCGGG - Exonic
1166852773 19:45768433-45768455 GGCCCTGGTGGCCTTCCAGCGGG - Exonic
925169969 2:1744359-1744381 GGCCGTGGTGGCCCAGAAGCCGG - Exonic
926088534 2:10035340-10035362 GGCAGTGATGGACAACCACCTGG - Intergenic
934717393 2:96551772-96551794 GGCCATGGGGGACACCCAGCAGG - Exonic
936045723 2:109186449-109186471 CGCCGTGCTGGACCACCCGTGGG + Intronic
938199589 2:129362069-129362091 GGCTGTGGGGGACCACAAGAGGG - Intergenic
942691864 2:178593846-178593868 GACCGTCCTGGACCACCAGTAGG - Exonic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946338733 2:219055374-219055396 GGCCGTGGCTGACCACCACCTGG - Exonic
946400745 2:219467196-219467218 GGCCGTGCTGGCCCCCCTGCAGG + Exonic
948858186 2:240740333-240740355 GGCCGTGGTGGACCACCGTGGGG - Exonic
948865018 2:240770844-240770866 GGCCATTGTGGAGCATCAGCAGG - Intronic
949032415 2:241803281-241803303 GGCCAGGGTGGCCCACCCGCGGG - Intronic
1169254279 20:4085423-4085445 GGCTGTGGCTGACCACCAGGGGG - Intergenic
1170945765 20:20889741-20889763 GGCCGTGGAGGAGCAGCAGAGGG - Intergenic
1172173966 20:32961240-32961262 GGACATGGTGGGCCACCAGGCGG - Intergenic
1174588255 20:51625239-51625261 GGGCGTGGAGGACCAGCTGCAGG - Exonic
1179411895 21:41168497-41168519 GGCCATGGTAGACAACCTGCAGG + Exonic
1180999149 22:19979899-19979921 GGCACTGCTGGACCACCCGCGGG - Exonic
1183395935 22:37570802-37570824 GACCTTGGTTGACCACAAGCTGG + Intronic
1184231881 22:43162802-43162824 GGCCTTGGTGGATCTCCTGCTGG + Exonic
1184681973 22:46077210-46077232 GGCTGAGGTGGCCCATCAGCTGG + Intronic
950787786 3:15450328-15450350 GGGCCTGGTGGACCATCACCTGG - Exonic
961013304 3:123449469-123449491 GGCCGCGGTGGGCCCGCAGCCGG - Exonic
961541793 3:127605056-127605078 AGCGGTGGTGGATCTCCAGCCGG - Exonic
961568490 3:127781792-127781814 GGTCGTGGGCGAACACCAGCAGG + Exonic
965710775 3:171554610-171554632 GGCTGTGGATGACCAGCAGCTGG - Intergenic
966530112 3:180968212-180968234 GGTCGTGGTGGACCACGTGGTGG + Exonic
966930586 3:184673088-184673110 GGCCCTGGTGGACCTGCAGTTGG + Intronic
967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG + Intronic
968901414 4:3433672-3433694 GGGCGTGGTGGAGCACCACGTGG - Intronic
973126830 4:46596173-46596195 GGCCTAGGTGGGCCAACAGCTGG + Intergenic
985647861 5:1093562-1093584 GGGCGTGGTGGAGCACGAGGAGG - Exonic
997621891 5:135304546-135304568 TGCAGTGGTGGGCCCCCAGCAGG + Intronic
998413390 5:141928159-141928181 GGCCGTGCTGGCCCTGCAGCTGG + Exonic
998463780 5:142327029-142327051 GGCCATGGGTGAGCACCAGCTGG - Intergenic
1002061941 5:176630351-176630373 GGCCGGGGTGGACCAGGGGCCGG + Exonic
1006134334 6:31886822-31886844 GGCCGTGGTGAACAACCACCTGG - Exonic
1006374211 6:33662904-33662926 GGTCGTGGTGGACCACCTAGGGG - Exonic
1007521126 6:42452379-42452401 GGCCGAGGCGGACGACCAGCCGG - Intergenic
1007570978 6:42890695-42890717 GGCCCTGCTGGACCAGCTGCAGG + Exonic
1007594461 6:43043070-43043092 GGCCGTGGTGGAGAAGCAGGTGG - Exonic
1010808169 6:80263706-80263728 GACCTTGGTAGACAACCAGCTGG + Intronic
1019180508 6:170184655-170184677 GGCAGAGGTGAACCAACAGCTGG + Intergenic
1019522229 7:1466189-1466211 GGCTCTGGCTGACCACCAGCAGG - Intergenic
1022104356 7:27187905-27187927 GGTTGTGGTGGCCCGCCAGCGGG + Intergenic
1023965931 7:44963070-44963092 GGGCGTGCAGCACCACCAGCTGG + Exonic
1026582803 7:71632268-71632290 GGCCCTGGGGGACCACCTGCCGG + Intronic
1032383636 7:131506854-131506876 GGCCTGCGTGGAGCACCAGCTGG - Intronic
1034897473 7:154886668-154886690 GACTGCGGTGGACCAGCAGCAGG - Intronic
1036496836 8:9277466-9277488 GGCCTTGGAGAACCACCAGATGG - Intergenic
1039750055 8:40470337-40470359 GGACGTGGAGGACCACCAAGGGG + Intergenic
1045112681 8:98949045-98949067 GGCCACGGTGGACCACCTGCAGG + Exonic
1049320990 8:141996304-141996326 GGCCCTGGGGTCCCACCAGCTGG + Intergenic
1049784542 8:144444201-144444223 GGCCGCGCTGTGCCACCAGCTGG - Exonic
1052615322 9:30831897-30831919 GGACGTGGGGCAGCACCAGCAGG + Intergenic
1057444952 9:95107236-95107258 GGCCGTGCTGGGCCACCTCCTGG - Exonic
1060968524 9:127724787-127724809 TGCCGAGGCGGACTACCAGCAGG + Exonic
1061516455 9:131093083-131093105 GGCCCTGGCTGCCCACCAGCCGG - Intronic
1062482014 9:136756912-136756934 GGGAGTGCTGGCCCACCAGCGGG + Intronic
1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG + Exonic
1062606029 9:137349244-137349266 GGGCTTGGTGCACCTCCAGCAGG + Exonic
1203782926 EBV:110906-110928 GGCCCTGGTGGACTACCTGTCGG - Intergenic
1200212499 X:154352975-154352997 GGCAGTGGCTGCCCACCAGCTGG - Intronic
1200951460 Y:8903089-8903111 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202161487 Y:21940223-21940245 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202229869 Y:22646150-22646172 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202313287 Y:23550015-23550037 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202557515 Y:26120579-26120601 GGCCGACGTGGAGCAGCAGCAGG - Intergenic