ID: 1150069774

View in Genome Browser
Species Human (GRCh38)
Location 17:62140574-62140596
Sequence CGGGACTCCCCGCCAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150069774_1150069782 -3 Left 1150069774 17:62140574-62140596 CCCTTCTTTGGCGGGGAGTCCCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1150069782 17:62140594-62140616 CCGGGCGGCCGCAAGGCCGCAGG 0: 1
1: 1
2: 1
3: 18
4: 194
1150069774_1150069783 -2 Left 1150069774 17:62140574-62140596 CCCTTCTTTGGCGGGGAGTCCCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1150069783 17:62140595-62140617 CGGGCGGCCGCAAGGCCGCAGGG 0: 1
1: 1
2: 0
3: 12
4: 94
1150069774_1150069779 -10 Left 1150069774 17:62140574-62140596 CCCTTCTTTGGCGGGGAGTCCCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1150069779 17:62140587-62140609 GGGAGTCCCGGGCGGCCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150069774 Original CRISPR CGGGACTCCCCGCCAAAGAA GGG (reversed) Intergenic
902393820 1:16121372-16121394 CTGGACACCCTTCCAAAGAAAGG - Intergenic
902763439 1:18599291-18599313 CAGGACTCCCAGCCAGTGAATGG - Intergenic
905037409 1:34927158-34927180 TGGGACTCCTTGCCAAAGAGAGG - Intronic
1065113803 10:22464923-22464945 CGAGATCCCCTGCCAAAGAATGG + Intergenic
1077139659 11:1018555-1018577 CGGGACTCCCCGCCGTAGGCGGG + Exonic
1101579577 12:106030852-106030874 GGAGACGCCCAGCCAAAGAAGGG + Intergenic
1103760058 12:123242768-123242790 CGAGACTCCCAGACAAAGGATGG - Intronic
1107701908 13:43057218-43057240 CTGGTGTCCCCGACAAAGAAGGG - Intronic
1108671711 13:52696954-52696976 CAGGACACCCCTCCAAAAAATGG - Intronic
1113924266 13:113931481-113931503 AGGGCCTCCCCGCCAAGGGAGGG - Intergenic
1129893391 15:79086823-79086845 GGGGACTCCATGCCAAAGAAGGG + Intronic
1130747808 15:86674932-86674954 CCGGACTCCCAGCCATAGGAGGG + Intronic
1130927203 15:88394553-88394575 CAGGACTCCCCCCAAAATAAGGG - Intergenic
1143446419 17:7012766-7012788 GGGGACTCCCCGGCAAGGATCGG + Intronic
1147171028 17:38618966-38618988 CACGACTCCCTTCCAAAGAAGGG + Intergenic
1148580810 17:48742505-48742527 CTCCACTCCCTGCCAAAGAAAGG + Intergenic
1150069774 17:62140574-62140596 CGGGACTCCCCGCCAAAGAAGGG - Intergenic
1160930082 19:1566430-1566452 CGGGAATCCAGGCCAGAGAAAGG - Intronic
1162994142 19:14323089-14323111 CAGGACCCCCCAACAAAGAATGG - Intergenic
1163729101 19:18939730-18939752 CGGGGCTCTCCACCAAAAAATGG + Intronic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
929927842 2:46230290-46230312 CAGGCCTCCCCGCCAAGGCAGGG + Intergenic
1173352364 20:42256904-42256926 ATGGAGTCACCGCCAAAGAAGGG + Intronic
1181036539 22:20172437-20172459 AGGGACTCCCCACCCCAGAAAGG + Intergenic
1182865754 22:33602867-33602889 CTGGACTCCTACCCAAAGAAAGG + Intronic
951990534 3:28671521-28671543 CTGCCCTCCCCCCCAAAGAATGG + Intergenic
959893419 3:111581604-111581626 GGTGACTCCCTGCCAAGGAAAGG - Intronic
962431954 3:135328119-135328141 CAGGACTCCATGCCAAAGAGGGG + Intergenic
976115652 4:81723008-81723030 AGGCACTCCCCTCCAAAGCATGG + Intronic
977572002 4:98638416-98638438 CGGGCCTCCCCCACAAAGTATGG - Intronic
990538859 5:56752143-56752165 TAGGACTCCCTGCCAAAGAGTGG + Intergenic
992621307 5:78595839-78595861 CAGGAATCCCCTCCAAAGAGAGG - Intronic
997472128 5:134122967-134122989 AGGGCCACCCAGCCAAAGAATGG - Intronic
998031260 5:138870580-138870602 GGAGATTCCCAGCCAAAGAAGGG + Exonic
1004352022 6:14898384-14898406 CAGGACTCCTGGTCAAAGAAAGG - Intergenic
1005968383 6:30742873-30742895 CGGGATTCCCGGCTCAAGAAGGG - Intergenic
1006911295 6:37565346-37565368 CCGGATTCCCCTCCAAACAATGG - Intergenic
1019202979 6:170334011-170334033 CAAGACTCCCAGCCACAGAATGG - Intronic
1040847400 8:51858250-51858272 GGGGAGTCCCGGCCAAAGCAGGG - Intronic
1047232327 8:123008140-123008162 CGGACCTACCCGCCATAGAAAGG - Intergenic
1061449694 9:130661354-130661376 CGGGAAGCCGCGCCGAAGAAAGG + Intergenic
1061926255 9:133807480-133807502 CTGCACTCACCTCCAAAGAATGG - Intronic
1193808287 X:86019418-86019440 AGGGATTCCAAGCCAAAGAAAGG + Intronic